KR101498110B1 - Specific primer set for diagnosing Monosporascus cannonballus resistance, and uses thereof - Google Patents

Abstract

One aspect of the invention relates to a black dot root rot (Monosporascus cannonballus) resistant diagnostic primer set, a method for starting the primer black dots root rot which comprises a set (Monosporascus cannonballus) resistance object sorting and compositions and kits for them.

Description

Specific primer sets for diagnosing Monosporacea cannonballus resistance, and uses thereof

The present invention relates to a primer set for diagnosing an individual having resistance to a black spot root rot disease (Monosporascus cannonballus) and a use thereof, and more particularly to a primer set and a composition using the primer set, a diagnostic kit and a black spot root rot resistance And a method for evaluating the same.

Fruits and vegetables such as melon, watermelon, melon, and cucumber, which are fruits and vegetables, are one-year-old vines and are the main fruit of summer fruits. It also has a year-round production system using facility houses. However, the occurrence pattern of pathogens according to the cultivation environment has been mainly caused by fungus fungi, plague, and vine blight due to fungal infectious diseases of poultry and vegetables. However, in the case of grafting, The fungus of the fungus is decreased, but the root of the root rot and the whole body is dried and the black spot root rot is severe. The onset occurs mainly in the main complex and its damage is gradually increasing.

The causative organism of this disease is monophosphorus cannonballus , which is a fungus, and the perithecia forms dozens of acorns and one large spore in the acorns. The large peritoneal and large aspergillus spores are an important characteristic of identification of this species. Aspergillus spores do not germinate under laboratory conditions, and incomplete generations are not yet known.

Root of Pak and Vegetables Black spot rot disease is the most damaging to watermelon and melon. It is also found in domestic watermelons and melon jujube complexes. First of all, consideration should be given to the control of roots of black spot rot disease. As mentioned above, the survival period of the bacteria in the soil is long and the damage of the poultry and crops is concerned.

It is known that pumpkin seedlings are somewhat tolerant to this disease. However, it is feared that there will be difficulties in commercialization of watermelon and melon seedlings because fruit quality is deteriorated at all. Many chemical pesticides have been tested in the chemical control method such as PC Envy. However, it is known that there is not enough control except for methyl bromide, chloropicrin and dazomet powder, which are soil fumigants. Recently, however, the use of these soil fumigants has been limited and studies are under way.

Korean Patent Publication No. 10-2012-0138399

In accordance with one aspect of the present invention, a primer set for the diagnosis of resistance to black spot rot rot disease is to identify the resistant individuals by judging whether the plants are infected during the pathology test of black dot rot rot disease.

One aspect of the present invention is a primer set comprising a primer set represented by SEQ ID NOs: 1 and 3, a primer set represented by SEQ ID NOs: 1 and 4, a primer set represented by SEQ ID NOs: 1 and 5, a primer set represented by SEQ ID NOs: 2 and 3, It is possible to provide a primer set capable of diagnosing at least one black spot rot fungus resistance-resistant individual selected from the group consisting of a primer set represented by SEQ ID NO: 2 and a primer set represented by SEQ ID NO: 2 and 5 .

One aspect of the present invention is that the subject can provide a set of primers that are melon or watermelon.

One aspect of the present invention is that the primer set can provide a primer set that is suitable for Real time-PCR.

One aspect of the present invention can provide a composition for screening a black spot root rot disease resistant object comprising the primer set.

One aspect of the present invention is a primer set comprising: the primer set; And a reagent for carrying out an amplification reaction. The black spot root rot disease resistant object selection kit can be provided.

One aspect of the present invention is a method for amplifying a nucleic acid comprising the steps of 1) performing a PCR using the genomic DNA of an individual as a template using the primer set according to claim 1, and 2) detecting the PCR product Black spot rot rot disease resistance.

According to one aspect of the present invention, the primer set for the diagnosis of resistance to black spot root rot disease can detect the rapid and accurate infection of melon or watermelon at the pathological test of black spot root rot disease and develop a resistance gene gene-related marker of melon or watermelon Can be used as basic data for.

FIG. 1 shows PCR results of a monosporascus cannonballus bacterium using a primer developed according to an aspect of the present invention.
FIG. 2 is a graph comparing detection specificity and primer efficiency of black spot root rot disease with melon, watermelon and soil infectious fungi using real time PCR.

Monosporascus cannonballus is a major disease of melons, watermelons, cucumbers, and other foliage and crops, and it is urgently required to develop disease resistant varieties and trees. However, it is difficult to evaluate resistance because the symptom duration is long and the mark is located in the bottom part. Therefore, it is necessary to formulate a simple and rapid resistance test, and accurate resistance evaluation should be done for this.

In one aspect of the present invention, a primer capable of enhancing the accuracy of selection by testing PCR for the infection of a plant after inoculation with a black spot root was developed in consideration of a method using PCR in the diagnosis of a disease by the development of biotechnology, Were selected for real time PCR to determine the extent of infection.

Primer production and specificity assays black dots root rot (Monosporascus cannonballus) to collect the nucleotide sequence one kind of NCBI after the genomic DNA isolated from holding strains 1 species produce a primer root black dots in six by making primer combinations against rot ( Monosporascus cannonballus) Specific amplified combinations were selected.

The results are shown in Fig. As can be seen from Fig. 1, all six combinations were found to be resistant to black spot root rot (Monosporascus cannonballus) Specific band pattern. In addition, since the test for determining the infection in the resistance test should be performed in a state where the plant DNA and the pathogen DNA are mixed, the primer combination developed in the melon and watermelon was not amplified at all. The same results were obtained for two other soil infectious fungi. However, the prior art showed a strong band pattern in the black spot root rot (Monosporascus cannonballus) , but it was confirmed that the same band was amplified in melon, watermelon and other fungi and showed a strong band pattern in the thin band fission.

The primer base sequences and the sequence numbers for the diagnosis of Monosporascus cannonballus according to one aspect of the present invention are shown in Table 1 below.

Primer name The primer first base sequence (5'-3 ') SEQ ID NO: KMC105F cctgtagttgtggccttacc One KMC204F cggatctcttggttctggca 2 KMC454R attactgcgcttggggtcac 3 KMC356R gagggttgaaatgacgctcg 4 KMC314R ctaatgggcgcaatgtgcgt 5

In addition, the results of the primer combination for diagnosis of Monosporascus cannonballus and the PCR product size according to one aspect of the present invention are shown in Table 2 below.

Primer name The primer first base sequence (5'-3 ') Primer name The primer 2 base sequence (5'-3 ') PCR product
Size (bp) KMC105F cctgtagttgtggccttacc KMC454R attactgcgcttggggtcac 350 KMC105F cctgtagttgtggccttacc KMC356R gagggttgaaatgacgctcg 252 KMC105F cctgtagttgtggccttacc KMC314R ctaatgggcgcaatgtgcgt 210 KMC204F cggatctcttggttctggca KMC454R attactgcgcttggggtcac 251 KMC204F cggatctcttggttctggca KMC356R gagggttgaaatgacgctcg 153 KMC204F cggatctcttggttctggca KMC314R ctaatgggcgcaatgtgcgt 111

Referring to FIG. 2, real time PCR was performed using the primer combination, and the KMC105F / KMC314R combination showed a clear melting curve as compared with the other combinations. In the case of the prior art, strong amplification was observed in the case of Parkinsonian fungus and the same pattern as that of agarose electrophoresis was observed. Therefore, it is possible to judge whether Monosporascus cannonballus is infected with the melting curve only by real time PCR without electrophoresis. The combination of KMC105F / KMC314R can be used to test the degree of infection of Monosporascus cannonballus Primer efficiency.

Table 3 below compares the values in Fig.

division Test section Control (Japanese patent) KMC105F /
KMC314R KMC105F /
KMC356R KMC204F /
KMC314R JMC128F /
KMC435R Sample M1 M1 M1 M1 Melt. Temp. 80.4 81.4 79.8 84.6 Sample M2 M2 M2 M2 Melt. Temp. 80.4 81.4 79.8 84.6 Sample MP MP MP MP Melt. Temp. None None None None Sample WP WP WP WP Melt. Temp. None None None None Sample PC PC PC PC Melt. Temp. None None None None Sample F1 F1 F1 F1 Melt. Temp. None None None None Sample F2 F2 F2 F2 Melt. Temp. None None None None Sample F3 F3 F3 F3 Melt. Temp. None None None 84.6

Hereinafter, an experimental procedure according to one aspect of the present invention will be described in detail. It should be understood, however, that the scope of the present invention is not limited to the following experimental procedures, but includes all ranges that can be derived by a person skilled in the art.

DNA extraction

DNA was extracted from mycelium grown on PDA (potato dextrose agar) medium for 7 days. In the same tube, 300 μl of extraction buffer (0.2 M Tris-HCl, 0.25 M NaCl, 25 mM EDTA, and 2% sodium dodecyl sulfate, pH 8.5) was added to the sterilized 1.5 ml microcentrifuge tube, Respectively. Without lid closure, it was heat treated at 95 ° C for 5 minutes and then cooled at room temperature. 200ul of phenol-chloroform mixture was added to the tube and vortex was added for 4 minutes. After centrifugation at 13,000 rpm for 5 minutes, the supernatant was placed in a fresh 1.5 ml microcentrifuge tube and the same volume of 100% ethanol was added to the DNA. DNA collection was centrifuged at 13,000 rpm for 5 minutes to lump to the bottom of the tube and the solution discarded. To the same tube, 700 ul of 70% ethanol was added, washed, and then sterilized at room temperature. Sterile distilled water and 1 ug of RNase A were added and reacted at 37 ° C for 2 hours. The concentration was then diluted to 20 ng / ul and used for PCR.

General PCR

For the general PCR reaction, the composition and concentration of the reaction solution were 40 ng (1 μl) of template DNA, 0.4 μM primer 1 and primer 2 primer, 0.6 u prime Taq DNA polymerase (Genetbio, Korea), 200 uM dNTPs, And sterilized tertiary distilled water to a total volume of 20 μl. The PCR amplification conditions were 1 minute at 98 ° C, 3 seconds at 98 ° C, 2 seconds at 70 ° C, 35 cycles at 72 ° C for 30 seconds, and 1 minute at 72 ° C. The PCR products were electrophoresed in 1.5% agarose gel at 150V for 1 hour and 30 minutes.

Real time PCR

Real time PCR reactions to the template DNA 40ng (1㎕), primer 1 and primer 2 primer (1.6㎕) of 0.4μM, 2 × SsoFast ^{TM EvaGreen?} upperix (Biorad, USA) was used to make a total volume of 20 μl of PCR mixture. The PCR amplification conditions were: extension at 98 ° C for 30 seconds, at 98 ° C for 3 seconds, at 70 ° C for 2 seconds, at 72 ° C for 3 seconds at 35 cycles, and at 72 ° C for 1 minute. Melting was set up to 70 ~ 90 ℃ by 0.2 ℃ every step for 5 seconds. At the same time, the degree of fluorescence at each step was measured.

Through the above process, a primer set according to an aspect of the present invention was selected.

<110> Republic of Korea <120> Specific primer set for diagnosing Monosporium cannonballus          resistance, and uses thereof &Lt; 130 > <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KMC105F (forward) <400> 1 cctgtagttg tggccttacc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KMC204F (forward) <400> 2 cggatctctt ggttctggca 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > KMC454R (reverse) <400> 3 attactgcgc ttggggtcac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > KMC356R (reverse) <400> 4 gagggttgaa atgacgctcg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > KMC314R (reverse) <400> 5 ctaatgggcg caatgtgcgt 20

Claims (6)

A primer set set forth in SEQ ID NOs: 1 and 5, a primer set set forth in SEQ ID NOs: 1 and 5, a primer set set forth in SEQ ID NOs: 2 and 3, a primer set set forth in SEQ ID NOs: A set of primers capable of diagnosing at least one black spot rot rot disease resistant object selected from the group consisting of a displayed primer set and a primer set represented by SEQ ID NOS: 2 and 5. The method according to claim 1,
Wherein the object is a melon or a watermelon. The method according to claim 1,
Wherein the primer set is suitable for real time-PCR. A composition for screening a black spot root rot disease resistant object, comprising the primer set according to claim 1. A primer set according to claims 1 or 2; And a reagent for carrying out an amplification reaction. 1) performing a polymerase chain reaction (PCR) using the genomic DNA of the individual as a template, using the primer set according to claim 1; And
2) detecting the PCR product. &Lt; Desc / Clms Page number 20 &gt;

Images