KR101491775B1 - Composition for the growth inhibiting of antibiotic resistant hazardous microbes - Google Patents

Abstract

The present invention relates to a composition for inhibiting the growth of antibiotic-resistant noxious bacteria.
The antibiotic-resistant composition for inhibiting the growth of harmful microorganisms of the present invention is characterized by containing bee venom as an active ingredient having inhibitory and antimicrobial activity against antibiotic-resistant harmful bacteria.
According to the present invention, there is provided a composition for inhibiting the growth of an antibiotic-resistant noxious insecticidal bacteria containing bee venom as an active ingredient, and in particular, a MRSA bacterium can be used for treatment of MRSA bacteria having existing antibiotic resistance .

Description

Technical Field [0001] The present invention relates to a composition for inhibiting the growth of an antibiotic-resistant noxious microorganism,

TECHNICAL FIELD The present invention relates to a composition for inhibiting the growth of antibiotic-resistant noxious bacteria, and more particularly, to a composition containing bee venom as an active ingredient having inhibitory and antimicrobial activity against antibiotic-resistant noxious bacteria.

Among the antibiotics developed so far, the world's most powerful antibiotic is vancomycin, which was developed in the 1950s by the spread of Staphylococcus aureus resistant to methicillin, an alternative to penicillin, to treat severe infections of Staphylococcus aureus I have used it.

However, due to the abuse of antibiotics, the ability to resist the pathogens themselves has become stronger, and resistance to certain antibiotics has become increasingly strong. As superb bacteria first appeared in Japan in 1996, the use of antibiotics A problem has occurred.

Bacteria can become natural mutants that can overcome antibiotics, and these resistant bacteria can transmit the resistance gene to other bacteria, and the spread of resistant bacteria can be done quickly.

Super bacteria are typically MRSA ( Methicillin - resistant Staphylococcus aureus ) and VRSA ( Vancomycin - resistant Staphylococcus aureus ) and VRE ( Vancomycin -resistant Enterococci ). Antibiotic-resistant bacteria are resistant to antibiotics and resistant to certain antibiotics. In the United States alone, approximately 19,000 people are resistant to superbacteria And the need for research on super bacteria such as those that are killed by antibiotic resistant bacteria is increasing.

Zyvox, which is a super-bacterial antibiotic, is currently on the market, but super-bacterial antibiotics such as Zyvox have side effects, and MRSA ( Methicillin- Resistant Staphylococcus aureus ) It is urgent to develop superbacterium antibiotics that have an effect on super bacteria such as vancomycin, penicillin and methicillin resistant strains.

As related prior art, Korean Patent Publication No. 10-2004-0090432 (published on October 25, 2004, name: composition for antimicrobial agent of methicillin-resistant Staphylococcus aureus containing berberine as an active ingredient) 10-1171871 (published on November 23, 2010, entitled " Antimicrobial composition against antibiotic resistant strains containing sulfolaphen as an active ingredient).

It is an object of the present invention to provide a composition for inhibiting the growth of antibiotic-resistant noxious bacteria which contains bee venom as an active ingredient having inhibitory and antimicrobial activity against antibiotic resistant pest.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not intended to limit the invention to the particular embodiments that are described. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not restrictive of the invention, There will be.

To achieve the above object, the present invention provides a composition for inhibiting the growth of an antibiotic-resistant noxious organism-resistant bacteria, which comprises bee venom as an active ingredient having inhibitory and antimicrobial activity against antibiotic resistant noxious bacteria.

The bee venom is derived from a beeswax of more than 15 days old of bees, and is characterized by being soluble in water by removing saccharides and volatile substances.

The bee venom is characterized by containing 10 ^-4 to 10% by weight based on the total weight of the bee venom.

The antibiotic resistant pest is characterized by methicillin-resistant Staphylococcus aureus.

The composition further comprises antibiotics, particularly penicillin, and preferably 1 to 50% by weight based on the total weight of the composition.

The composition may be any one selected from the group consisting of beverage, feed, food, medicine, and cosmetics.

The present invention provides a composition for inhibiting the growth of antibiotic resistant noxious bacteria resistant to bee venom containing bee venom as an active ingredient having bee venom inhibiting ability and antimicrobial activity against antibiotic resistant noxious bacteria, It is possible to treat by MRSA bacteria because of the killing effect.

FIG. 1 is a graph showing the results of protein electrophoresis on bees at the same ages.
Fig. 2 is a graph showing changes in the composition of bee venom isolated from beeswax of less than 15 days of western bees.
FIG. 3 is a graph showing the components contained in the beeswax isolated from beeswax at the age of 15 days of the beeswax of the present invention.
FIG. 4 is a photomicrograph of a bee venom refined through the purification method of the present invention after pre-purification and Western species bees 15 days old.
FIG. 5 is a graph showing the time required to kill MRSA CCARM 3366 for bee venom. FIG.
6 is a graph showing the time required for the death of MRSA CCARM 3708 strain of bee venom.
FIG. 7 is a diagram showing an MRSA fungicide killing mechanism of bee venom.

The terms, techniques, and the like described in this specification are used in the meaning commonly used in the technical field to which the present invention belongs, unless otherwise specified.

The present invention is characterized by providing a composition for inhibiting the growth of antibiotic-resistant noxious bacteria which contains bee venom as an active ingredient having inhibitory and antimicrobial activity against antibiotic-resistant noxious bacteria.

The bee venom, which is contained in the bee venom, is composed of about 40 substances and has been used for the treatment of diseases of the human body since BC.

Currently, studies on the action and mechanism of bee venom component, sensitivity and toxicity of bee venom, immunotherapy and treatment of diseases such as arthritis, herpes simplex, multiple sclerosis and tumor have been reported. Especially, It is known.

In the present invention, such bee venom is preferably separated from the bees first, followed by dissolving in water, centrifugal separation, and freeze-drying the supernatant liquid.

The present invention uses a bee of a Western species of 15 days or more as a kind of the above-mentioned bee.

If the description, type of bees is generally seoyangjong bees (Apis mellifera), 4 species known, such as oriental species of bee (Apis cerana, India's largest species (Apis dorsata), minimum longitudinal India (Apis florea). This is currently our country has But the bees of Oriental hybrids have been cultivated since the Goryeo period, and have been used in the private sector and in the oriental medicine. It has been introduced and raised in Korea around the year.

The bee venom shows differences in its components depending on the bees, and even in the same bee, there is a difference in composition depending on the age. Therefore, the bee venom used in the present invention is a western bees, and the sub species is a worker of an Italian system.

The bee venom of the present invention has antibacterial effect against antibiotic resistant pest bacteria, and in particular, has a cell inhibiting ability and a sterilizing effect against MRSA bacteria, and provides a composition for inhibiting the growth of pesticidal bacteria resistant to antibiotics.

The bee venom is preferably contained in an amount of 10 ^-4 to 10% by weight based on the total weight of the composition.

If the content of the bee venom is less than 10 ^-4 wt%, the cell-inhibiting ability and the sterilizing effect of the desired antibiotic-resistant harmful bacteria are deteriorated. If the bee venom is contained in an amount exceeding 10 wt% And it is manufactured in an unsuitable state for use as a product that is practically used, such as cosmetics, medicines, and foods.

In addition, when conventional antibiotics are used in combination with penicillin, a composition having an antibiotic-resistant antibiotic-resistant growth inhibiting ability is provided. In this case, the antibiotic is preferably contained in an amount of 1 to 50% by weight based on the total weight of the antibiotic.

As described above, the present invention can provide a composition for inhibiting the growth of an antibiotic-resistant harmful microorganism by including a bee venom that is safe to the human body as an effective ingredient because it has no toxicity and has a small side effect.

In addition, the composition may be used in any form, but may be in any form selected from the group consisting of beverage, feed, food, medicine, and cosmetics.

To prepare the composition for inhibiting the growth of the antibiotic-resistant noxious organism-resistant bacteria according to the present invention in the form of a beverage, the bee venom is added to the base of the liquid beacon which is granulated and then mixed to prepare a beverage. Water or milk, coffee, tea, etc. may be applied to the liquid base.

In addition to the beeswax particles, a liquid beverage may be added to the beverage. Examples of the beverage additives include sugars such as monosaccharides, disaccharides, polysaccharides and sugar alcohols and flavorings such as tau martin, stevia extract, saccharin and aspartame, nutrients, vitamins, flavorings, coloring agents, pH adjusting agents, A carbonating agent and the like may be added. Other drinks may contain flesh for the production of natural fruit juices and fruit juice drinks and vegetable drinks. These ingredients can be used independently or in combination

In order to prepare the composition for inhibiting the growth of the antibiotic-resistant noxious organism-resistant bacteria according to the present invention in the form of a feed, the bee venom bean granules in which the bee venom is granulated are mixed with the amino acid, inorganic salts, vitamins, antibiotics, antimicrobial substances, antioxidants, antifungal enzymes, Adjuvant components such as microbial agents and the like; Cereals, such as ground or shredded wheat, oats, barley, corn and rice; Vegetable protein feedstuffs, for example, based on rapeseed, soybeans and sunflower; Animal protein feeds such as blood, meat, bone meal and fish meal; A dry component consisting of sugar and dairy products such as various powdered milk and whey powder; Lipids such as animal fat and vegetable fat optionally arbitrarily liquefied by heating; Nutritional supplements, digestion and absorption enhancers, growth promoters, disease inhibitors, and the like.

In order to produce the composition for inhibiting the growth of the antibiotic-resistant noxious organism-resistant bacteria according to the present invention in the form of food, the bee venom granules obtained by granulating the bee venom and the beads are used as glue, rice, wheat flour, honey, crystalline cellulose, Starch, starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, sugar, arabic gum, starch, Starch glycol, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, dextrose, sorbitol, talc, and the like But are not limited thereto.

In order to prepare the composition for inhibiting the growth of an antibiotic resistant fungus growth inhibitor of the present invention in the form of a pharmaceutical preparation, the bee venom is made into granules by mixing the bee venom granules with a pharmaceutically acceptable carrier or excipient, Into a capacity container.

The formulations may be in the form of tablets, capsules, powders, granules, liquids or rings, and may additionally contain dispersing or stabilizing agents. That is, it can be selected without difficulty by those skilled in the art depending on the purpose of use, and the addition amount thereof can be selected within a range that does not impair the purpose and effect of the present invention.

Examples of the pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline Cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and also pharmaceutically acceptable excipients Include, but are not limited to, lubricants, wetting agents, sweeteners, flavoring agents, emulsifying agents, suspending agents, preservatives and the like.

In order to produce the composition for inhibiting the growth of the antibiotic-resistant noxious organism-resistant bacteria according to the present invention in the form of a cosmetic product, the bee venom which is beads granulated and the effect of the main effect of the present invention, For example, an additive such as a perfume, a dye, a bactericide, an antioxidant, an antiseptic, a moisturizer, an additive, an inorganic salt, an emulsifier, a synthetic polymer material or the like is further included And the addition amount of the additive is selected and used within a range not to impair the object and effect of the present invention.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples, but the scope of the present invention is not limited thereto.

≪ Example 1 > The bee venom isolation

1) Beholding

The bee venom was collected using a bee venom collecting device of the western bees ( Apis meliffera L.). Only the bee venom of the bees of more than 15 days old was collected.

Categories
(Class of Molecules) Component
(Component) Content in dry bee venom
(% of dry venom) Enzymes Phospolipase A2 10-12 Hyaluronidase 1-3 Acid phosphomonoesterase - Lysophopholipase - a-glucosidase - Other Proteins and Peptides Melittin 50 Apamine 1-3 Mast Cell Degranulating Peptide (MCD) 1-2 Secapin 0.5 to 2.0 Procamine 1-2 Adolapin - Protease inhibitor - Tertiapine * 0.1 Small peptides (with less than 5 amino acids) 13 ~ 15 Physiologically Active Amines Histamine 0.5 to 2.0 Dopamine 0.2 to 1.0 Noradrenaline 0.1 to 0.5 Amino Acids t -aminobutyric acid 0.5 a-amino acids 1.0 Sugars Glucose and fructose 2 Phospholipids 5 Volatile compounds 4 to 8

The bee venom constructed as shown in Table 1 was used in this experiment to have pure water-soluble bee venom composed of ingredients as shown in Table 2 by removing sugars and volatile compounds through a simple purification method of bee venom.

Categories
(Class of Molecules) Component
(Component) Content in dry bee venom
(% of dry venom) Enzymes Phospolipase A2 10-12 Hyaluronidase 1-3 Acid phosphomonoesterase - Lysophopholipase - a-glucosidase - Other Proteins and Peptides Melittin 45 ~ 65 Apamine 1-3 Mast Cell Degranulating Peptide (MCD) 1-2 Secapin 0.5 to 2.0 Procamine 1-2 Adolapin - Protease inhibitor - Tertiapine * 0.1 Small peptides (with less than 5 amino acids) 13 ~ 15 Physiologically Active Amines Histamine 0.5 to 2.0 Dopamine 0.2 to 1.0 Noradrenaline 0.1 to 0.5 Amino Acids t -aminobutyric acid 0.5 a-amino acids 1.0 Phospholipids 5

<Example 2> Production of beverages containing bee venom having the effect of inhibiting the growth of antibiotic resistant noxious bacteria of the present invention

A beverage was prepared by mixing 10% by weight of the beeswax dried product with 80% by weight of hot water.

<Example 3> Production of feed containing bee venom having the effect of inhibiting the growth of antibiotic-resistant noxious bacteria of the present invention

5% by weight of the total weight of the beeswax dried product was mixed with a conventional foundation feed (corn, molasses, soybean meal, fish meal, corn gluten, soybean oil, animal fat, salt, mannitol, limestone and vitamin mineral preparation) The feed was prepared.

Example 4 Production of food containing bee venom having the effect of inhibiting the growth of antibiotic resistant noxious bacteria of the present invention

The prepared bee venom-dried product was mixed with 3% by weight of the total weight of basic bean curd (composed of glutinous rice and wheat flour) to prepare food in the form of porridge instead of meal.

Example 5 Manufacture of a medicine containing bee venom having the effect of inhibiting the growth of the antibiotic resistant noxious bacteria of the present invention

The bee venom dried material thus prepared was mixed with ^10-1% by weight of the total weight and by filling them in gelatin capsules to prepare a pharmaceutical in capsule form the base material of the capsule type drugs (if crystalline cellulose, lactose sewage, magnesium stearate) .

Example 6: Cosmetic preparation containing bee venom having the effect of inhibiting the growth of antibiotic resistant noxious bacteria of the present invention

Cosmetics were prepared by mixing the beeswax dried product with a functional cosmetic material (casein, el-cysteine, corn oil, cellulose, vitamin mixture, mineral mixture, sucrose and corn starch) in an amount of 1 wt%.

<Experimental Example 1> Confirmation of the difference between the bees of the Western species and the bees of the oriental species

Protein electrophoresis (4 ~ 20 wt.%, Gradient gel tris) was performed to determine the difference in the toxic composition of the western and oriental bees.

Each of the poisons was diluted with distilled water to a concentration of 10 μg / ml, mixed with a loading buffer, and then injected into a gel. Electrophoresis was performed at 80 V for 2 hours. The gel was removed from the electrophoresis apparatus and fixed with silver stain.

As a result, as shown in Fig. 1, it was confirmed that the result of protein electrophoresis on bees at the same age shows the difference in toxic composition between the bees of Oriental and Oriental species.

&Lt; Experimental Example 2 > Analysis of composition change of bee venom over time

The bee venom isolated in Example 1 was analyzed by liquid chromatography for changes in the composition with time.

The bee venom isolated from the beeswax of less than 15 days old was used for comparison.

As a result, as shown in FIG. 2, it was confirmed that the bee venom isolated from the beeswax of less than 15 days of the Western species of bees was changed in the bee venom component as the age (age) passed.

On the other hand, as shown in FIG. 3, it was confirmed that the bee venom of Example 1 isolated after 15 days did not change in composition as the period elapsed. In other words, there was no significant difference in the composition of bee venom isolated at 15th or later age.

In other words, as shown in Table 3 below, the bee venom isolated from the worker bees less than 15 days showed 0.065 mg / animal within 1 hour, 0.166 mg within 5 days, 0.211 mg at 6-10 days, The bee venom of Example 1 of the present invention isolated from a 15-day old or older bees containing 0.294 mg did not show any change in the content even after the lapse of the time.

Compared to (15 days old) Invention Example 1 in 1 hour Within 5 days 6 to 10 days 15 days Poisoning (mg / grain) 0.065 0.166 0.211 0.294

As a result of the above experiment, since there is no change in the toxic component in the beeswax of 15 days old or more of the western species of bees, it is possible to accurately measure the content usable safely in the human body by using the bee venom (Example 1) , Cosmetics, medicines, functional foods, and the like.

In addition, as shown in FIG. 4, it can be seen that the bee venom purified by the purification method of the present invention after 15 days of pre-purification and the Western species of honey bee have different structures.

<Experimental Example 3> Determination of minimum inhibitory concentration and minimum bactericidal concentration of MRSA (methicillin-resistant Staphylococcus aureus) in bee venom

1. Experimental Method

The minimum inhibition concentration (MIC) was measured for the bee venom prepared in Example 1 above. Antimicrobial effects of bee venom against MRSA ( Methicillin - resistant Staphylococcus aureus ) CCARM 3366 and CCARM 3706 purchased from the antibiotic - resistant strains were measured.

The antimicrobial effect was determined by confirming the Minimun Inhibitory Concentration (MIC) by liquid medium dilution method.

Bee venom was diluted with sterilized distilled water, sterilized by filtration and diluted stepwise according to liquid medium dilution method.

BHI (Brain heart infusion broth) medium at 37 ° C for 18 hours.

Each inoculum was adjusted to 2 × 10 ⁶ CFU / well and cultured for 18 hours with various diluted bee venom samples, followed by visual and microscopic observation of bacterial growth.

The minimum inhibitory concentration was determined to be the same as the absorbance value of the pure culture solution by measuring the absorbance at 540 nm of the absorption wavelength. The minimum bactericidal concentration was determined by colony testing of the bee venom samples cultured in the BHI medium, . &Lt; / RTI &gt;

2. Experimental results

The results of the experiment are shown in Table 4 below.

Strain MIC ([mu] g / ml) MBC (占 퐂 / ml) MRSA (CCARM 3366) 0.085 0.106 MRSA (CCARM 3708) 0.11 0.14

As shown in Table 4, the minimum inhibitory concentration (MIC) of the bee venom was 0.085 ~ 0.11 g / ml and the minimum bactericidal concentration (MBC) of the bee venom was 0.106 ~ 0.14 ㎍ / MRSA bacteria showed growth inhibition and sterilization effect.

&Lt; Experimental Example 4 > Measurement of time required to kill MRSA of bee venom

1. Experimental Method

The stability of antimicrobial activity was confirmed by measuring the PAE (postantibiotic effect) of the bee venom through the strain used in Experimental Example 3.

MRSA ( Methicillin - resistant Staphylococcus aureus ) CCARM 3366, CCARM 3706 The above strains were cultured for 1 hour with the bee venom samples each having a MIC value of 2 × concentration adjusted to 2.5 × 10 ⁵ CFU / well and then subjected to centrifugation and culture dilution. Respectively.

Subsequently, the strain was incubated at 37 ° C in a fresh medium, and the strain was measured at intervals of 2 hours.

At this time, the larger the PAE value, the better the antimicrobial sustained effect, and the formula for obtaining PAE is as follows.

PAE = T - C

       T: Time to grow up to log 10 in the bee venom treated test area

C: Growth time from untreated to log 10

2. Experimental results

As shown in FIG. 5 and FIG. 6, bee venom showed killing effect at least one hour after MRSA infection, and it gradually showed a high killing effect over time.

<Experimental Example 5> Confirmation of Synergistic Effects of MRSA Antibiotic and Bee venom

1. Experimental Method

As in Experimental Example 4, synergistic effects of MRSA bacteria were measured after bee venom and conventional antibiotics were added alone or in combination. The synergy effect was determined by the method of Mates et al. (1982). The formula to obtain FICI is as follows.

FICI = (MIC _{drug A} combination effect / MIC _{drug A} single effect) + (MIC _{drug B} combination effect / MIC _{drug B} single effect)

FICI = 0.5 (synergistic)

0.5 <FICI <1.0 (with some effects)

FICI = 1.0 (does not affect)

1.0 <FICI <4.0 (no effect)

FICI = 4.0 (with antagonistic action)

2. Experimental results

The results of the above tests are shown in Table 5 below.

Strain Experimental group
Minimum growth inhibitory concentration
(MIC, 占 퐂 / ml) FIC
(占 퐂 / ml)
FICI
(占 퐂 / ml) Remarks single complex MRSA 3366 Ampicillin 435 1.06 0.002 1.002
No synergy
Beijing 0.085 0.085 1.00 penicillin 680 1.33 0.001 0.631
Has synergy Beijing 0.085 0.054 0.63 MRSA 3708 Ampicillin 540 1.33 0.002 1.002
No synergy
Beijing 0.11 0.11 1.00 penicillin 851 1.75 0.002 0.775
Has synergy
Beijing 0.11 0.085 0.77

FIC (fractional inhibitory concentration): a measure of synergy between antibiotics

0.5 < FIC < 1 (synergistic synergistic effect)

1 < FIC < 4 (no synergistic synergistic effect)

As shown in Table 5, synergistic effects were observed when bee venom and penicillin were used together.

<Experimental Example 6> Confirmation of the death mechanism of MRSA in bee venom

1. Experimental Method

RT-PCR was performed to determine whether bee venom was involved in the expression of the Atl gene involved in the production of autolytic enzymes (murein hydrolases) involved in cell division of MRSA strains.

After 10 ml of OD of 0.5 g of bacteria was prepared, MRSA bacteria were harvested by treatment with bee venom at various concentrations and incubated for 4 hours. Then, QIAGEN RNeasy Mini Kit and RNA protect bacterial reagent were used. RNA was isolated Respectively.

For cDNA synthesis, 1 μg of total RNA was reacted at 45 ° C. for 1 hour and at 95 ° C. for 5 minutes using an RT premix kit (RT Premix kit / Oligo dT primer) and stored at 4 ° C. or -20 ° C.

PCR was carried out with 10 pmol of Yqil and Atl primers (Table 6) using PCR Premix kit (iNtRON Biotechnology, Sungnam, Gyeonggi-do, Korea) Min, 72 ° C for 1 minute 30 seconds, and 95 ° C for 45 seconds. The synthesized PCR product was confirmed with 2% agarose gel.

target gene Direction sequence (5'-3 ') bp Yqil forward GACGTGCCAGCCTATGATTT 137 Yqil reverse ATTCGTGCTGGATTTTGTCC Atl forward AATCAAGGTGGCACACAACA 243 Atl reverse CTCGATGCTCATGATTGACG

2. Experimental results

As shown in FIG. 7, it was confirmed that the expression of Atl gene was increased below the bee venom concentration of 1 mg / ml, and the production of MRSA was inhibited.

Based on the above results, the present invention provides a composition for inhibiting the growth of an antibiotic resistant noxious microorganism resistant against bee venom having an antibacterial activity against antibiotic resistant noxious bacteria, and more particularly, , Which makes it possible to treat patients and livestock by MRSA bacteria.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. You can implement the examples. The scope of the present invention is defined by the appended claims, and all differences within the scope of the claims are to be construed as being included in the present invention.

Claims (13)

Which comprises as an active ingredient, a tablet bee venom having inhibitory and bactericidal activity against methicillin-resistant Staphylococci,
The purified bee venom is derived from a beeswax of Apis meliffera L., a Western species of bees 15 days old or more, and has water solubility by removing saccharides and volatile substances,
The tablet bee is included in an amount of 10 ^-4 to 10% by weight based on the total weight of the composition,
Wherein the composition is an antibiotic and further comprises penicillin in an amount of 1 to 50% by weight based on the total weight of the composition.
A pharmaceutical composition for inhibiting the growth of methicillin-resistant Staphylococcus aureus.
delete delete delete delete delete delete delete delete delete delete delete delete

Images