KR101489994B1 - Preparation method for new tautomycetin analogue with Streptomyces sp. CK4412 strain - Google Patents

Abstract

The present invention relates to a novel method for preparing a tothomycetin derivative using the genus Streptomyces genus CK4412, which comprises deleting the tmcR gene from chromosomal DNA of Streptomyces sp. CK4412 strain CK4412 A process for the preparation of 5-deoxy tautomycetin is provided.

Description

Preparation method for new tautomycetin analogue with Streptomyces sp. CK4412 strain CK4412 strain}

The present invention relates to a novel method for preparing a tothomycetin derivative using Streptomyces sp. CK4412.

Tautomycetin (TMC) produced from Streptomyces sp. CK4412 has antifungal activity, immunosuppressive activity and anticancer activity (Proc Natl Acad Sci USA 99 (2002) 10617-10622; Mol Cancer Ther 5 (2006) 3222-3231; Mol Cancer Ther 9 (2010) 1482). Totomycetin is composed of a linear polyketide and anhydride (J Antibiot 42 (1989) 141-144), and in its natural state, tothomycetin is composed of a diacid form and anhydride ) Forms exist jointly (J Antibiot 42 (1989) 141-144). Totomycetin has inhibitory activity against protein phosphatase PP1 and PP2A, but it is known that the inhibitory activity against PP1 is about 40 times greater than the inhibitory activity against PP2A (Biochem. Biophys. Res Commun. 287 (2001) 328-331). In particular, tommycetin and anhydride moieties are identical and linear carbon chain moieties have other inhibitory activities against PP1 and PP2A, but other tautomycin (TTM) (Proc Natl Acad Sci USA 99 (2002) 10617-10622), the selectivity to PPl is poor (Transplant Proc. 35 (2003) 547; Chem Asian J 5 (2010) 410-420) . Recent studies have shown that the inhibition of the Src homology-2 domain containing protein tyrosine phosphatase-2 (SHP2), which is present in the T cell and contains the tyrosine phosphatase-2 protein, It has been found that due to the structural differences of the linear carbon chains, tothomycin has no immunosuppressive activity with inhibitory activity (Trends Biochem. Sci. 28 (2003) 284-293; ChemBiol 18 (2011) 101 -110). On the other hand, the present inventors have reported a genome that biosyntheses totomycetin from Streptomyces sp. CK4412 (Microbiology 153 (2007) 1095-1102).

Korean Patent No. 0312454 discloses a method for producing tothomycetin from a microorganism of the genus Streptomyces and an electric microorganism that produces tomomycetin useful as an immunosuppressant and an antibacterial agent. However, the mutant strain or the tote There is no mention of mycetin derivatives.

The object of the present invention is to provide a 5-deoxy tautomycetin of the following formula (1), which deletes the tmcR gene from the chromosomal DNA of Streptomyces sp. CK4412 strain And a method for manufacturing the same.

delete

In order to achieve the above object, the inventors of the present invention inactivated tmcR functioning as cytochrome P450 through target-specific gene disruption and found that the mutant ttomycetin derivative And the present invention has been completed.

The present invention relates to a method for producing 5-deoxy tautomycetin represented by the following formula (1), which deletes the tmcR gene from the chromosomal DNA of Streptomyces sp. CK4412 strain .

≪ Formula 1 >

The tmcR The gene is 1,350 bp in size and has 449 amino acid residues. It has similarity with cytochrome P450 hydroxylase (CYP) genes. tmcR The gene serves to attach oxygen to the 5th carbon position of the tautomycetin.

In detail, the method for deleting the tmcR gene comprises the steps of: (a) preparing the pTMC2290 tmcR plasmid of Fig. 2a in which the apramycin resistance gene ( aac (3) IV ) / oriT cassette is cloned; (b) introducing the prepared pTMC2290 ? tmcR plasmid into E. coli strain CK4412 ( Streptomyces sp. CK4412) through conjugation using E. coli ET12567 / pUZ8002; And (c) selecting a strain having apramycin resistance from among the conjugated strains. The present invention also provides a method for producing 5-deoxy tautomycetin.
The 5-deoxy tautomycetin may be a protein phosphatase 2A (PP2A) or a Src homology-2 domain containing protein tyrosine (SEQ ID NO: 2) including a tyrosine phosphatase- phosphatase-2 (SHP2) inhibitory activity, and 5-deoxy tautomycetin is characterized by decreasing cytotoxicity. More specifically, the cell is characterized by being a Vero cell.

delete

delete

delete

delete

delete

delete

delete

The present inventors prepared 5-deoxy tautomycetin by preparing a mutant strain of Streptomyces sp. CK4412 in which a tmcR gene functioning as cytochrome P450 is inactivated.

Figure 1 shows the modification step after polyketide biosynthesis (PKS) in the tothomycetin biosynthesis mechanism. The anhydride moiety is synthesized by TmcDEFGHPQ (purple arrow), and the linear polyketide is liberated from TmcB-TE after synthesis by TmcAB (brown arrow). The esterification between the anhydride moiety and the linear polyketide is facilitated by TmcC (yellow arrow). Tailoring steps such as dehydration, decarboxylation and oxidation are then facilitated by TmcM (green arrow), TmcJK (red arrow) and TmcR (blue arrow). The red box indicates the C5 oxidation mechanism by TmcR.
Figure 2 shows a construct for replacement and compensation of the tmcR gene. shows a schematic diagram of a resistance gene (apr ^R) / PCR of the target gene deletion replaced oriT (PCR-targeted gene replacement disruption) - (a) tmcR gene and Apra azithromycin. (b) a completed plasmid construct for the tmcR gene compensation experiment. (c) A gel photograph for confirmation of the completed tmcR mutation. Lanes: M, 1kb ladder; 1 and 4, Streptomyces genus CK4412 wild type genomic DNA; 2 and 3, Streptomyces genus CK4412-006 Genomic DNA. 1 and 2, PCR results using tmcR check F and R primers (CHtmcR-F and R); 3 and 4, ort and tmcR check R primers (CHtmcR-R).
Figure 3 shows the HPLC results for intermediate profiles produced from Streptomyces sp. CK4412 wild type and recombinant strains. (a), Streptomyces sp. CK4412 wild type; (b), CK4412-006; (c), CK4412-006 / tmcR .
Figure 4 shows the molecular weight of 5-deoxy tautomycetin analyzed by LC-MS. The diacid form of 1,5-deoxy tautomycetin.
Figure 5 shows the SDS-PAGE analysis of the expressed and isolated GST-binding SHP2. Lanes: 1, protein marker; 2, crude extracts; 2, GST-binding SHP2, which was dissolved from glutathione-Sepharose column.
6 is a photograph showing antifungal activity of TMC and TMC derivatives at a concentration of 1 mM. (I), methanol; (II), TMC; (III), 5-deoxy TMC; (IV) and (V), other TMC derivatives.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.

< Example  1> tmcR  fruition( disruption ) Mutant strains, Streptomyces sp.  CK4412-006 ( Streptomyces sp . CK4412 -006) Production

1. Strain and culture conditions

E. coli DH5α (Escherichia coli DH5 [alpha]) was used as a host for the production of recombinant plasmids. Escherichia coli ET12567 / pUZ8002 ( E. coli ET12567 / pUZ8002) was used as donor host in the conjugation experiment. All E. coli strains were cultured at 37 DEG C in Luria broth or Luria Broth agar supplemented with appropriate antibiotics if necessary. Streptomyces sp. CK4412 ( Streptomyces sp. CK4412) was used as a tothomycetin producing strain (Microbiology 153 (2007) 1095-1102). For production of tothomycetin and its derivatives, wild-type and mutant strains of Streptomyces sp. CK4412 were cultured in MS solid medium for 6 days (Microbiology 153 (2007) 1095-1102) .

2. tmcR gene disruption

The tmcR gene was inactivated using a PCR targeted gene disruption system (Proc Natl Acad Sci USA 100 (2003) 1541-1546). Briefly, the apramycin resistance gene ( aac (3) IV ) / oriT cassette was used to replace the internal region of the tmcR gene. The cassettes were introduced into E. coli BW25113 / pIJ790 containing pTMC2290 or pTMC2982 and pTMC2290 ? TmcR was prepared . Substitution of the tmcR gene was confirmed by PCR analysis of the mutated pTMC2290. The mutated cosmid pTMC2290 ? TmcR was transformed into E. coli Was introduced into Streptomyces sp. CK4412 ( Streptomyces sp. CK4412) by conjugation using ET12567 / pUZ8002. The germination genus Streptomyces CK4412 (Streptomyces sp. CK4412) spores [junction can booty (conjugation recipient)] of E. coli with pTMC2290 △ tmcR Were mixed with ET12567 / pUZ8002 (conjugation donor) and then spread on the modified ISP4 medium plate. After incubation at 28 ° C for 16 hours, each plate was overlaid with 1 ml of sterile water containing apramycin and nalidixic acid at a final concentration of 50 μl / ml and 25 μl / ml lt; / RTI &gt; Culturing was continued at 28 ° C until exconjugants appeared. We have isolated double cross-over mutants selected as apramycin resistant and kanamycin sensitive phenotype. It is a tmcR -deletion strain as Streptomyces sp. CK4412-006 ( Streptomyces sp. CK4412-006) and the genotype was confirmed by PCR analysis. The strains and plasmids used in the present invention are shown in Table 1.

Strain characteristic source Streptomyces sp. CK4412 Wild-type TMC-producing strain Choi et al . (2007) CK4412-006 tmcR -disrupted strain (replaced with apr ^R / oriT ) Invention CK4412-006 / tmcR Streptomyces sp. CK4412-006 ( tmcR -disruptant) containing pSETSPE tmcR Invention Plasmid pTMC2290 Cosmid vector including tmcR Choi et al . (2007) pTMC2290 ? tmcR pTMC2290 mutant cosmid vector containing tmcR disrupted with apr ^R / oriT Invention pSETSPE tmcR pSET152-based insertional vector which was replaced the selection marker spectinomycin-resistance (Spe R) gene including single copy of tmcR and constitutive promoter, ermE * Invention

3. Results

We previously used a tmcR of 1,350 bp size The authors reported that genes have tootamycetin-specific oxygenases and are similar to other bacterial cytochrome P450 hydroxylase (CYP) genes. As a result of computer-assisted gene sequencing, tmcR The gene has 449 amino acid residues and the amino acid sequence of CYP of Mycobacterium vanbaalenii is 44% identical. Genes related to tothomycetin biosynthesis and tmcR The function of the gene is shown in Fig. To verify the function of tmcR in actinomycetes, the tmcR gene was inactivated using a PCR-targeted gene disruption system. In the case of the pTMC2290 plasmid, it is a cosmid containing a part of the tothomycetin biosynthesis gene including the tmcR gene. PTMC2290 ? TmcR In the case of the plasmid, tmcR in the tothomycetin biosynthesis gene was replaced with an apramycin antibiotic resistance gene. These plasmids can be introduced into Streptomyces sp. CK4412 ( Streptomyces sp. CK4412) to specifically deactivate only tmcR among the tothomycetin biosynthesis genes (Fig. 2a). PCR was performed to confirm that the tmcR -inactivated mutant was successfully transgenic (Fig. 2C).

< Example  2> Functional compensation ( functional complementation ) Experiments and Streptoma This Seth genus CK4412 -006 ( Streptomyces sp . CK4412 -006) Totomycetin  Structure analysis of derivatives

1. Complementation of tmcR gene

△ tmcR For mutation complementation experiments, pTMC2290 was used as a template cosmid and PCR was performed to obtain complete tmcR The gene was amplified. The amplified PCR products were analyzed by electrophoresis on 1% (w / v) agarose gel, separated by DNA extraction kit, and ligated to pGEM ^® -T Easy vector. For confirmation, all linked vectors were sequenced (Macrogen, Korea). The tmcR fragment treated with Bgl II and Xba I was cloned into pSET152 (Microbiology 153 (2007) 1095-1102). To obtain pSETSPE tmcR , spectinomycin was added to the BamH I and Xba I restriction sites of pSET152. The resistance gene was cloned. Mutant strain introduced into the pSETSPE tmcR CK4412-006 through the junction (conjugation) has created a CK4412-006 / tmcR strain. This was compensated by the expression of the functioning tmcR at a constant level under the control of e rmE * promoter. The primers used in the present invention are shown in Table 2.

Primers The sequence (5'-3 ') Explanation PTtmcR-F ¹ TACGCGCACTACGAGACGATGCGCTCGGACCAGCCCTTCGTCGATTCCGGGGATCCGTCGACC (SEQ ID NO: 1) Forward primer for tmcR PTtmcR-R ¹ GAGGCAGTAGTGGATGCCAGTCGAGAACGCCAGGTGCTTGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 2) Reverse primer for tmcR CPtmcR-F ² AGATCTACTTTCCGATCTGGTGA (SEQ ID NO: 3) Forward primer for tmcR CPtmcR-R ² TCTAGAACGCCTCAGCGCACCGGCGT (SEQ ID NO: 4) Reverse primer for tmcR CHtmcR-F ³ TGACCGATCCGTCGGTAC (SEQ ID NO: 5) Forward primer for tmcR CHtmcR-R ³ TCGCCCTCCATCTTGGCC (SEQ ID NO: 6) Reverse primer for tmcR

¹ , use for PCR target system; ² , use for compensation experiments; ³ , Use for confirmation of construct

2. Strain Culture and Structural Analysis of Totomycetin Derivatives Produced from Each Mutation

For HPLC analysis of tothomycetin and tothomycetin derivatives, the strains CK4412, CK4412-006 and CK4412-006 / tmcR The strain was plated on MS solid medium and incubated for 6 days at 28 ° C. The MS solid medium was mixed with the same volume of distilled water (adjusted to pH 4.0 with 10 N HCl), centrifuged and extracted twice with the same volume of ethyl acetate. The combined ethyl acetate extracts were concentrated using a rotary evaporator, dissolved in MeOH, filtered through a 0.2 μm filter and used for HPLC analysis. Analytical HPLC used a Genesis C18 5 [mu] m column, flow rate was 1 ml / min and UV detection at 273 nm. Identification of the toxomycetin and tothomycetin derivatives produced by the wild-type streptomyces genus CK4412 and CK4412-006 was confirmed using LC-MS. For the separation of the tothomycetin and tothomycetin derivatives, semi-preparative HPLC was carried out using X-bridge C18 5 [mu] m column, flow rate 3 ml / min and monitoring UV detection at 273 nm .

3. Results

tmcR To confirm whether the gene is involved in tothomycetin biosynthesis, the present inventors compensated the tmcR gene using the normal expression promoter e rmE * in the Streptomyces genus CK4412-006 in which the tmcR gene was inactivated (Fig. 2B ). In order to perform gene compensation, the present inventors used tmcR The gene was cloned, resulting in pSETSPE tmcR . For compensation mutagenesis, the apramycin resistance gene of pSET152 was replaced with the spectinomycin resistance gene. As a result of HPLC measurement, pSETSPE tmcR In the case of Streptomyces sp. CK4412-006 in which the tmcR gene was compensated with the plasmid, it was confirmed that it was biosynthesized with tothomycetin (Fig. 3A).

For the production of tothomacetin derivative, cultivation of Streptomyces genus CK4412-006 inactivated tmcR gene showed that tomycethelin did not biosynthesize but showed a spectrum similar to tothomycetin. (Fig. 3B). As a result of LC-MS analysis, it was confirmed that the tothomycetin derivative was 5-deoxy tautomycetin (FIG. 4). Structure of the tote Mai paroxetine derivative in tmcR genus Streptomyces strain CK4412 Gene is a CYP enzyme specific for carbon 5 during the tothomycetin biosynthesis process.

< Example  3> Streptomyces sp. CK4412 Deoxytotomasetin (5- deoxy tautomycetin)  Biological activity

1. Expression and isolation of the GST-binding SHP2 catalytic domain

The catalytic domain of SHP2 (residues 246-547) was synthesized (Cosmogenetech, Korea). The synthesized SHP2 catalytic domain fragment was cloned into the same site of the BamH 1 and Xho 1, treated with, and pGEX-4T3 (Amersham Bioscience, Piscataway , NJ) bacterial expression vector. The structure of glutathione S-transferase (GST) -binding SHP2 was transformed into E. coli BL21 (DE3), and 1 mmol of isopropyl β-D-1-thiogalactopyranoside (isopropyl β- D-1-thiogalactopyranoside) at 20 &lt; 0 &gt; C for 16 hours. Cell pellets were suspended in 20ml PBS buffer (137mM NaCl, 2.7mM KCl, 10mM Na 2 HPO 4, 2mM KH 2 PO 4, pH 7.4). The suspension was briefly sonicated 10 times for 10 seconds, with a 30 second interval for cooling. Cell debris was removed by centrifugation at 15000 rpm for 20 minutes at 4 ° C. GST-conjugated SHP2 was separated on a glutathione-Sepharose column (GE healthcare). Finally, purity was confirmed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (FIG. 5).

2. Measurement of Protein Phosphatase Inhibitory Activity

Protein phosphatase inhibitory activity was measured in 96-well multiwall plates. The analysis included three groups including samples (TMC and TMC derivatives), positive control and negative control, each measurement being performed twice. The reaction solution is H ₂ O 30ul, 10ul PMP buffer (New England BioLabs), 10ul 1mM MnCl 2 and 4ul PP1 enzyme (per reaction 0.1U, cat. No. P0754S, New England BioLabs) , or PP2A enzyme (0.1U per reaction, cat. no. 14-111, Millipore) or GST-conjugated SHP2 (0.1 U per reaction expressed in E. coli BL21), which was added to a 96-well plate and prewarmed at 37 ° C for 10 minutes . 1 mM MnCl ₂ was used only in the PP1 and PP2A inhibition experiments, and enzyme storage buffer instead of enzyme was added to the negative control wells. Then 10ul of various concentrations of TMC and TMC derivatives diluted in methanol were added to each well. Positive control and negative control wells were supplemented with 10 ul methanol instead of inhibitor. The reaction was initiated by the addition of substrate (fluorescein diphosphate at a final concentration of 100 uM), which was prewarmed with the reaction mixture at 37 ° C. The reaction was carried out at the same temperature for 1 hour. Hydrolysis of FDP was measured by fluorescence detection at 492 nm using a microplate reader (TECAN, Switzerland). The inhibitory activity of the test samples was measured by the activity ratio of the sample and the control and expressed as a percentage (%). Correlation curves were plotted on the basis of the activity percentages of TMC and TMC derivatives with concentration. The concentration (IC ₅₀ ) required to inhibit 50% of the enzyme activity was calculated (Toxicon 37 (1999) 909-922).

3. Measurement of cytotoxicity and antifungal activity

Cell viability was measured using NCI-H1229 human lung cancer cell line and Vero cell lines. Each cell line was pre-cultured and then 4000 cells were placed in 96-well plates, respectively. Cells were then incubated at 37 ° C for 1 hour under 5% CO ₂ atmosphere to allow the cells to attach to the wells.

TMC and TMC derivatives were dissolved in DMSO and added to each well, and the cells were incubated for 2 days under the same conditions. (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide; MTT ) Solution was added to each well containing the cultured cells After incubation for 4 hours, lysis buffer was added to each well. Formazan was added at 540nm using a microplate reader. The disk (6 mm in diameter) was soaked with 15 ul of the extract dissolved in methanol and the suspension was incubated at 37 ° C for 1 h. , And Aspergillus niger . The plates were incubated for 48 hours at 30 ° C. The diameter of the inhibited area around the disc, which is indicated by the diffusion of the compound produced by the strain, Respectively.

4. Results

Streptomyces genus CK4412 and CK4412-006 were cultured in a medium optimized for tothomycetin biosynthesis, and the tothomycetin and tothomycetin derivatives were extracted from the culture with ethyl acetate, Antifungal activity was measured using 5-deoxy tautomycetin. Aspergillus niger ) fungus activity, 5-deoxy tautomycetin was found to have decreased antifungal activity compared to tothomycetin (Fig. 6).

In the case of tothomycetin, the inhibitory activity against PP1 is about 40 times higher than that of PP2A. In order to measure the physiological activity of 5-deoxy tautomycetin produced in Streptomyces sp. CK4412-006, PP1 inhibition ability was examined. The IC ₅₀ for PP1 of tothomycetin and 5-deoxy tautomycetin Values are 0.003 uM and 0.010 uM, respectively (Table 3). IC ₅₀ The value is the concentration of the inhibitor required to inhibit the activity of the target enzyme or the growth of the cells by 50%. In the case of 5-deoxy tautomycetin, the tothomycetin derivative, about 3.3-fold inhibition Activity decreased. On the other hand, the anticancer activity of NCI-H1229 human lung cancer cell line was found to be about 7 times lower than that of tootomycetin in the 5-deoxy tautomycetin derivative.

However, in the case of the SHP2 inhibitory activity, which is the most important indicator of immunosuppressive activity, the 5-deoxy tautomycetin derivative was found to be about 3.5 times more active than tothomycetin (Table 3) . In addition, the cytotoxicity of tomazocetin and 5-deoxy tautomycetin was about 3-fold lower than that of Vero cell (Table 3).

Protein phosphatase inhibitory activity and cytotoxicity measurement results TMC 5-deoxy TMC TMC / 5-deoxy TMC PP1 3.2 ± 0.3 × 10 ^-3 10.2 + - 0.4 x 10 ^-3 1: 3.18 PP2A 136.5 ± 0.8 × 10 ^-3 38.3 ± 0.5 × 10 ^-3 1: 0.28 SHP2 3.23 ± 0.03 0.9 ± 0.07 1: 0.27 NCI-H1299 4.04 0.06 28.7 ± 0.03 1: 7.10 Vero 0.68 ± 0.01 2.01 + 0.02 1: 2.95

<110> INHA-INDUSTRY PARTNERSHIP INSTITUTE <120> Preparation method for new tautomycetin analogue with          Streptomyces sp. Comprising CK4412 strain and immunosuppressant          tautomycetin analogue as active ingredient <130> DP-2012-0362 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 63 <212> DNA <213> Artificial Sequence <220> Forward primer for tmcR (PTtmcR-F1) <400> 1 tacgcgcact acgagacgat gcgctcggac cagcccttcg tcgattccgg ggatccgtcg 60 acc 63 <210> 2 <211> 59 <212> DNA <213> Artificial Sequence <220> Reverse primer for tmcR (PTtmcR-R1) <400> 2 gaggcagtag tggatgccag tcgagaacgc caggtgcttg tgtaggctgg agctgcttc 59 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for tmcR (CPtmcR-F2) <400> 3 agatctactt tccgatctgg tga 23 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> Reverse primer for tmcR (CPtmcR-R2) <400> 4 tctagaacgc ctcagcgcac cggcgt 26 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> Forward primer for tmcR (CHtmcR-F3) <400> 5 tgaccgatcc gtcggtac 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> Reverse primer for tmcR (CHtmcR-R3) <400> 6 tcgccctcca tcttggcc 18

Claims (9)

Characterized in that, in the chromosomal DNA of a strain of Streptomyces sp. CK4412 ( Streptomyces sp. CK4412), a tmcR gene functioning to oxygenate the 5th carbon position of tothomycetin in the tautomycetin biosynthesis gene is deleted A process for producing 5-deoxy tautomycetin represented by the following formula (1).

&Lt; Formula 1 >

delete 2. The method according to claim 1, wherein the deletion of the tmcR gene
(a) Apramycin resistance gene ( aac (3) IV ) / oriT The pTMC 2290 ? TmcR Producing a plasmid;
(b) Using conjugated E. coli ET12567 / pUZ8002, the above prepared pTMC2290 tmcR Introducing the plasmid into Streptomyces sp. CK4412 strain; And
(c) selecting a strain having apramycin resistance from among the conjugated strains. 5. A method for producing 5-deoxy tautomycetin, comprising the steps of: delete delete delete delete delete delete

Images