KR101488949B1 - Composition for preventing and treating osteoporosis - Google Patents

Abstract

The present invention provides a composition for the prevention and treatment of osteoporosis, which comprises, as an active ingredient, a placenta hydrolyzate extract containing no estrogen, in order to provide osteoporosis treatment and prevention effect.

Description

[0001] The present invention relates to a composition for preventing and treating osteoporosis,

The present invention relates to a pharmaceutical composition, and more particularly, to a composition for preventing and treating osteoporosis.

It is known that osteoporosis occurring after menopause is caused by osteoblast-mediated bone resorption and overall bone loss due to imbalance between osteogenesis. Bone mineral density (BMD), which is a major factor in determining osteoporosis, is the highest in the twenties, then declines slowly after menopause. Hormone replacement therapy has been studied to treat such osteoporosis. Hormone replacement therapy using estrogen or progesterone is known to be effective in treating osteoporosis by increasing bone density, but carcinogenic side effects such as breast cancer are present.

Therapeutic methods using an estrogen component or a similar component thereof have been studied, and a method of using a placenta as a pharmacological agent has been known as a typical example. Studies on the treatment effect of osteoporosis by medicinal materials such as these degrading agents use only water-soluble components of the placenta by acid extraction with hot water and hydrochloric acid, and the therapeutic effect of osteoporosis by the water- it is known that due to the decrease bone loss according to absorption inhibitory effect (HT Hong et al, Journal of Ethnopharmacology, 79 (2):.. 143-148, 2002; UH Jin et al, Journal of Ethnopharmacology, 106 (3): 333-343, 2006).

The placenta, which is composed of the blood chorion, plays an important role in eliminating the oxygen and nutrient supply required by the fetus and the wastes produced by the fetus while maintaining contact between the fetus and maternal tissues. The placenta contains various nutrients and hormones necessary for the growth of the fetus. The placenta (eg, the fetus, the donan placenta, and the placenta) is widely used not only for the fetus but also for adults especially for the purpose of alleviating menopausal symptoms and beauty. (Pal et al., Int. J. Dermatol. , 34, 61-66, 1995; Jung et al., Int Immuno pharmacol , 11, 976-984, 2011; Lui et al , Biol. Pharm. Bull , 21, 44-49, 1998).

The present invention relates to a composition for preventing and treating osteoporosis, which contains the ingredient contained in the donepez-pasted hydrolyzate as an active ingredient, and a composition for preventing and treating osteoporosis containing the placenta hydrolyzate having no estrogen and female hormone And a method for preventing and treating osteoporosis. However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention, there is provided a composition for the prevention and treatment of osteoporosis, which contains, as an active ingredient, a placenta hydrolyzate extract containing no estrogen.

In the composition, the placenta hydrolyzed extract may be prepared by hydrolyzing a protein hydrolyzate and then removing the estrogen using an adsorbent.

In the composition, the adsorbent may be hydroxyapatite, diatomaceous earth or activated carbon. For example, the donan placenta extract according to an embodiment of the present invention may be prepared by hydrolyzing a donut placenta with a protein hydrolyzing enzyme, adding calcium carbonate dissolved in an acidic solution to a donut placenta hydrolyzate, adding a phosphate solution thereto, To 7.0 +/- 0.2, thereby forming a hydroxyapatite on the sol, and then removing the hydroxyapatite. At this time, the estrogen can be adsorbed on the hydroxapaapatite on the sol, and the residual estrogen can be removed by addition of diatomite and activated carbon to the estrous placenta crude extract.

In the composition, the placenta hydrolyzate extract may not contain progesterone. The progesterone may be removed together with estrogen removal.

In the composition, the proteinase may be a papain, a bromelain, a protease, and / or an alkaline protease.

At this time, the composition according to an embodiment of the present invention may preferably contain 0.1 to 50% by weight of the placenta hydrolyzate containing no estrogen, based on the total weight of the composition. In addition, it may further contain one or more kinds of active ingredients which exhibit the same or similar function as the donut placenta hydrolyzate, but it is preferable that the content does not exceed the content of the active ingredient.

The composition can be administered orally or parenterally at the time of clinical administration and can be administered orally or parenterally in the case of parenteral administration by intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine injection, intracerebral injection, And may be used in the form of a general pharmaceutical preparation.

Compositions in accordance with one embodiment of the present invention further comprise an inert ingredient, including a pharmaceutically acceptable carrier. As used herein, the term " pharmaceutically acceptable carrier "refers to a composition, specifically a component other than the active ingredient of a pharmaceutical composition. Examples of pharmaceutically acceptable carriers include binders, disintegrants, diluents, fillers, lubricants, solubilizers or emulsifiers and salts.

In practical use, the composition according to one embodiment of the present invention may be combined with a pharmaceutical carrier according to conventional pharmaceutical formulation techniques. The carrier may take a wide variety of forms depending upon the preparation desired, for example, for oral or parenteral administration (including intravenous administration).

In addition, the composition according to one embodiment of the present invention may be administered at a dose of 0.1 mg / kg to 1 g / kg, more preferably 0.1 mg / kg to 500 mg / kg. On the other hand, the dose can be appropriately adjusted according to the age, sex and condition of the patient.

According to another aspect of the present invention, there is provided a health food for prevention and improvement of osteoporosis, which comprises an extract of a placenta hydrolyzate of a donepezite containing no estrogen as an active ingredient.

The health functional food refers to a food which can be prepared in the form of tablets, capsules, powders, granules, liquids, and circles by using raw materials and ingredients having useful functions in the human body as defined in Article 3 of the Health Functional Food Act Examples of foods which can contain the placenta hydrolysates according to the present invention include various capsules, tablets, granules, drinks, tea, drinks, vitamin complexes, food additives, supplements, and functional foods. May be suitably determined according to its intended use (prophylactic, symptomatic, or therapeutic adjuvant treatment).

The health functional food of the present invention may contain 0.01 to 95% by weight, preferably 1 to 80% by weight, of a placenta hydrolyzate containing no estrogen and female hormone, relative to the total weight of the food for the purpose of prevention and improvement of osteoporosis have. There is no particular limitation on the production of the functional food of the present invention, and any conventional food manufacturing method or the like can be applied as it is or modified appropriately.

According to another aspect of the present invention, there is provided a method of preventing and treating osteoporosis, comprising administering to a subject a placenta hydrolyzed extract which does not contain a pharmaceutically effective amount of estrogen.

According to one embodiment of the present invention as described above, a composition for preventing and treating osteoporosis, which contains estrogen-free placenta hydrolyzate as an active ingredient, may be provided to provide osteoporosis prevention and therapeutic effect. Of course, the scope of the present invention is not limited by these effects.

FIG. 1 is a graph showing bone mineral density changes in the femur and vertebra after administering the placenta hydrolyzate (NPPH, WPPH) according to an embodiment of the present invention to ovariectomized OVX rats.
FIG. 2 is a graph showing the results of immunohistochemical staining for the Wnt signaling-related genes (LRP5, β-catenin, DKK1) and cytokines (RANKL) expression using real-time PCR.

Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples. It should be understood, however, that the invention is not limited to the disclosed embodiments and examples, but may be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, It is provided to fully inform the owner of the scope of the invention.

Example 1: Preparation of donut placenta hydrolyzate

The preparation process of the placenta hydrolyzate of the donkey is 1) pre-treatment of the porcine placenta 2) protein hydrolysis 3) filtration and inactivation of the enzyme 4) lipid removal 5) pH control 6) (NPPH) was prepared by removing estrogen from the placenta hydrolyzate.

Specifically, the placenta hydrolyzate produced by Cod Biotech was used. The placenta was melted using a defroster, washed with saline at 16 ° C, and blood and cord were removed. And hydrolyzed for 2 to 48 hours at 40 to 80 ± 0.1 ° C and pH 4.5 to 6.0 using papain, bromelain, pronase and alkaline. Thereafter, the proteolytic enzymes were inactivated at 80-100 占 0.1 占 폚 for 20-240 minutes. Thereafter, calcium carbonate dissolved in an acidic solution was added to the placenta hydrolyzate, and the pH was adjusted to 7.0 +/- 0.2 by adding a phosphate solution thereto to form a hydroxyapatite on the sol. Then, hydroxyapatite was removed Respectively. At this time, estrogen was adsorbed on the formed hydroxyapatite and removed, and residual estrogen was removed by addition of diatomite and activated carbon to the estrus placenta extract.

The content of 17-β-estradiol and progesterone in the hydrolyzate prepared above was measured using an ELISA kit (Abcam, Cambridge, Mass., USA).

Example 2: Animal breeding

The animals used in this study were 11 weeks old and 227 ± 17 g female Sprague Dawley rats (Central animal, Korea) were purchased, and the temperature of the breeding room was adjusted to 23 ° C. and the light period was adjusted to 12 hours Lt; / RTI > All procedures and procedures were performed in accordance with the Hoseo University Animal Ethics Committee guidelines (2011-12). The animals were free to take water and calcium deficient diets. Since bone formation and bone resorption progress slowly, the experiment needs to be performed for at least 12 weeks and calcium deficient diets were supplied to promote bone deficiency symptoms.

The calcium-deficient diet was prepared using a semi-purified method using modified AIN-93 formulations for experimental animals (P. G. Reeves, Journal of Nutrition, 127 (5): 838S-841S, 1997). The diet consists of 40 En% (energy percent) carbohydrate, 20 En% protein, 40 En% fat and 1.7 g calcium / kg diet, and the amount of calcium is 1/3 of that of AIN-93 formulation. The major carbohydrates, proteins and fats were derived from starch + sugar, casein (milk protein), and lard (CJ Co., Koera), respectively.

Example 3: Preparation of an osteoporosis animal model

The animal of Example 2 was adapted to a new breeding environment for one week after purchase and anesthetized by injecting a mixture of ketamine and xylazine (100 mg / kg, 10 mg / kg, respectively) into the muscle, Ovaries of SD rats were extracted. The ovariectomized rats (OVX) were then randomly divided into 4 experimental groups and stabilized for 1 week, and the experiment was performed for 12 weeks according to each experimental group: 1) Estrogen (NPPH), 3) estrogen replacement group (EST), and 4) dextrose (dextrose) group. In addition, the placenta hydrolyzate group (WPPH) ) Was administered (OVX-CON). In addition, the sham control group was classified into the OVX-CON group. In the experimental groups 1), 2) and 4), WPPH, NPPH and dextrose were administered for 12 weeks at a dose of 1,000 mg / kg / day to the oral cavity. Gated estrogen (Dalim Biotech, Korea) was administered for 12 weeks (see Table 1).

The feed and water intakes and weights of the animal models were measured at 10:00 every Tuesday and urine samples were obtained 1 day prior to sacrifice of the animal models, after which the animals were placed into metabolic cages one by one. After 12 weeks of dosing, the animal model was injected intramuscularly with a mixture of ketamine and xylazine (100 mg / kg, 10 mg / kg, respectively) and peri-uterine and The weight of retroperitoneal fat and uterus was measured. The uterus index was calculated as the ratio of uterine weight to body weight. Blood samples for serum separation were obtained via abdominal cardiac puncture. Urine and serum samples were stored at -70 ° C until biochemical analysis.

OVX-CONT Ovariectomized rat control OVX-WPPH After ovariectomy, the placenta hydrolyzate containing estrogen was administered for 12 weeks OVX-NPPH After ovariectomy, estrogen-free donor placenta hydrolyzate was administered for 12 weeks OVX-EST After ovariectomy, estrogen-treated group Sham-CONT Controls for OVX-CONT with open surgery only

Experimental Example 1: Analysis of components of the placenta hydrolyzate (WPPH, NPPH)

The WPPH and NPPH donut placenta hydrolysates prepared through one embodiment of the present invention were mixed with AccQFluor buffer and AccFluor reagent (Waters Corporation, Milford, Mass., USA) and each mixture was heated at 80 ° C. A aliquot of the sample was filtered using a 0.45-μm filter and injected into the chromatography system. The chromatographic separation was performed on an AccQ-Tag column (150 x 2.1 mm, 3-μm particle size; Waters Corporation) in an HPLC instrument. A gradient gradient mixture of AccQ-Tag eluent (A) and acetonitrile (B) was used as mobile phase at 30 ° C at a flow rate of 1 ml / min. The mobile phase configuration started at 100% A and linearly decreased to 67% for 33 minutes. Thereafter, the solution was exchanged with 100% B solution for 3 minutes and again with 100% solution for 26 minutes. Amino acids were identified using a fluorescence detector at excitation 250 nm and emission 395 nm. Standard solutions were prepared using 0.1 M HCl as a standard solution containing 22 amino acids at a concentration of 0.25 to 10 mg / ml. The six-point calibration curve was derived using the concentration of each amino acid in the peak area of the graph.

As a result, as shown in Table 2 below, the total placenta hydrolyzate NPPH in which the estrogen hormone component was removed according to one embodiment of the present invention had a lower total amino acid level than the placenta hydrolyzate WPPH containing estrogen hormone, The percentage of essential amino acids was higher. That is, some of the amino acids may be present in a modified form, such as hydroxyproline and hydroxy lysine (see Table 2).

WPPH NPPH Estrogen (ng / g) 7.24 ± 0.79 0.006 0.001 ^*** Progesterone (ng / g) 74.3 ± 7.52 0.071 ± 0.001 ^*** Aspartate 0.115 + 0.011 0.082 0.012 ^* Threonine 0.136 + 0.014 0.109 0.022 Serine 0.184 + 0.020 0.133 0.012 ^* Glutamate 0.295 + 0.022 0.207 0.021 ^* Glycine 0.274 + 0.032 0.131 0.018 ^* Alanine 0.284 + 0.018 0.186 0.019 ^* Valine 0.205 + 0.028 0.203 + 0.029 Cysteine 0.062 0.005 0.033 0.001 ^** Methionine 0.087 ± 0.092 0.126 + 0.138 ^* Isoleucine 0.154 + 0.018 0.189 0.024 ^* Leucine 0.187 + 0.020 0.168 + 0.015 Tyrosine 0.173 + 0.017 0. 098 ± 0.013 ^* Phenylalanine 0.121 + 0.018 0.161 0.021 ^* Lysine 0.224 + 0.031 0.339 + 0.037 ^** Histidine 0.031 ± 0.008 0.063 0.077 ^* Arginine 0.087 0.018 0.181 ± 0.018 ^** Proline 0.031 0.003 0.087 ± 0.021 ^** Total amino acids 2.630 + 0.255 2.476 + 0.267 Essential amino acids 1.155 + 0.121 1.358 + 0.144 ^* % Essential amino acids 43.9 ± 0.45 55.9 ± 0.58 ^**

In Table 2, the amino acid content unit is mg / mL.

Experimental Example 2: Measurement of weight change and body organ weight by administration of NPPH

After 12 weeks of dosing and after 12 weeks of dosing, the animal model was injected intramuscularly with a mixture of ketamine and xylazine (100 mg / kg, 10 mg / kg, respectively) Animal models were sacrificed and the weight, peri-uterine and retroperitoneal fat weights of each experimental group were measured.

As a result, as shown in Table 3, the OVX-NPPH group had lower weight gain than the OVX group, but the increase inhibition was lower than that of the OVX-EST group. In addition, OVX-CONT significantly decreased uterine tissue (P <0.01) compared to sham-CONT, and OVX-NPPH increased absolute and relative uterine weight. This increase in uterine weight was also observed in OVX-EST. In addition, serum 17β-estradiol levels were significantly decreased in OVX-CONT, and no changes were observed in the OVX-NPPH or OVX-WPPH groups. However, in the OVX-EST group, serum 17β-estradiol levels were increased compared to the sham-CONT group.

The values in Table 3 below are expressed as mean ± SD, and the superscript * indicates a statistically significant difference between OVX-WPPH, OVX-NHPPH and OVX-EST treated groups (P <0.05 ). In addition, a, b, and c in the superscript indicate that there is a statistically significant difference between the OVX-CONT, OVX-WPPH, OVX-NHPPH, and OVX-EST groups by the Tukey test (P <0.05). In addition, superscript † indicates a significant difference between OVX-CONT and Sham-CONT (P <0.05), †† means P <0.01, and ††† means P <0.001 (See Table 3).

OVX-CONT
(n = 10) OVX-WPPH
(n = 10) OVX-NPPH
(n = 10) OVX-EST
(n = 10) Sham-CONT
(n = 10) Weight (g) 329 ± 25 ^a 313 ± 24 ^ab 297 ± 23 ^b 274 ± 25 ^{c *} 271 ± 23 ^† Peritumoral fat (g) 6.4 ± 0.8 ^a 5.8 ± 0.7 ^ab 5.2 ± 0.7 ^b 4.3 ± 0.5 ^{c *} 3.9 ± 0.5 ^†† Post-peritoneal fat (g) 8.8 ± 1.0 ^a 8.1 ± 0.9 ^ab 7.2 ± 0.8 ^b 6.1 ± 0.7 ^{c *} 5.4 ± 0.7 ^†† Uterine weight (g) 1.3 ± 0.2 ^b 1.4 + - 0.2 ^ab 1.6 ± 0.3 ^a 1.8 ± 0.3 ^{a *} 1.9 ± 0.3 ^† Uterus index (mg / g) 4.0 ± 0.5 ^b 4.5 ± 0.6 ^ab 5.5 ± 0.8 ^b 6.5 ± 0.9 ^{c *} 7.0 ± 0.9 ^†† Serum 17-estradiol (pg / mL) 9.6 ± 1.1 9.8 ± 1.0 10.8 ± 1.3 24.8 ± 3.9 ^{a *} 20.3 ± 3.2 ^†††

Experimental Example 3: Measurement of bone mineral density by administration of NPPH

After anesthesia with a mixture of ketamine and xylazine (100 mg / kg, 10 mg / kg, respectively), the bone mineral density (BMD) of the right femur and vertebrae was doubled Ray absorption apparatus (dual-energy X-ray Absorptiometer, Norland pDEXA Saber, Norland Medical Systems Inc., USA). The device is equipped with software to measure the bone density of small animals.

As a result, as shown in FIG. 1, the bone mineral density of the right iliac and vertebrae in OVX-CONT decreased to 18.6% and 15.8%, respectively, as compared with sham-CONT. In the NPPH group, bone mineral density increased in 18.7% of the iliac bone and 17.9% in the spine, compared with the OVX-CONT group. WPPH also increased bone mineral density, but this increase was lower than in the estrogen group. OVX-EST improved the level of right iliac and vertebral bone densities, which were reduced by ovariectomy, to the level of sham control. That is, the OVX-NPPH treatment inhibited the decrease of bone density, and the serum estrogen levels were almost similar to the OVX-NPPH and OVX-CONT groups. As a result, estrogen- Means that the effect of increasing bone density was due to components other than estrogen (see FIG. 1).

Experimental Example 4: Confirmation of change of serum and urine composition by administration of NPPH

Serum calcium and phosphorus are known to play important roles in the release of PTH (parathyroid hormone) from calcitonin hormones and thyroid or parathyroid glands, respectively, which regulate blood calcium levels (RD Bukoski and D. Kremer, American Journal of Clinical Nutrition , 54 (1): 220S-226S, 1991). These PTH hormones regulate serum calcium levels to be within normal ranges by regulating calcium accumulation in bone, reabsorption of kidney tubules, and absorption of intestines (RD Bukoski and D. Kremer, American Journal of Clinical Nutrition , 54 (1): 220S-226S, 1991; LA Austin and H. Heath, New England Journal of Medicine , 304 (5) 269-278, 1981). OVX rats are known to have significantly increased levels of serum phosphorus, urinary Ca and urinary P as bone resorption increases (AS Das, M. Mukherjee, and C. Mitra, Asia Pacific Journal of Clinical Nutrition, 13 (2): 210-216, 2004; P. Srikanta et al., Zhong Xi Yi Jie He Xue Bao , vol. Thus, the effect of treatment with osteoporosis was confirmed by measuring changes in calcium and phosphorus contents of serum and urine by administering NPPH, a plant free extract of placenta, which does not contain estrogen, according to an embodiment of the present invention.

The levels of serum calcium (Ca), serum phosphorus (P), urine Ca, urine P and urine creatinine were measured using a colorimetric method kit (Asan, Seoul, Republic of Korea ).

As a result, as shown in Table 4 below, the OVX-CONT rats were increased in comparison with the sham control group of serum phosphorus and calcium iodine iodine, and the OVX-NPPH group was increased in calcium The levels of urine and phosphorus decreased and were similar to those of the OVX-EST group. However, serum calcium levels were not significantly different in OVX-CONT, OVX-NPPH, or OVX-EST (see Table 4). These results indicate that the reduction of calcium urine and phosphorus by NPPH, which is a non-estrogen-containing donut placenta hydrolyzate according to an embodiment of the present invention, can suppress the effect of reducing bone mineral density by self-weight extraction.

The values in Table 4 below are expressed as mean ± SD, and the superscript * indicates a statistically significant difference between OVX-WPPH, OVX-NHPPH and OVX-EST (P <0.05). In addition, a, b, and c in the superscript indicate that there is a statistically significant difference between the OVX-CONT, OVX-WPPH, OVX-NHPPH, and OVX-EST groups by the Tukey test (P <0.05). In addition, the superscript † indicates a significant difference between OVX-CONT and Sham-CONT (P <0.05).

OVX-CONT
(n = 10) OVX-WPPH
(n = 10) OVX-NPPH
(n = 10) OVX-EST
(n = 10) Sham-CONT
(n = 10) Serum calcium
(mg / dL) 10.9 ± 1.3 10.6 ± 1.4 10.2 ± 1.1 10.1 ± 1.2 10.1 ± 1.3 Serum phosphorus
(mg / dL) 8.18 ± 1.02 ^a 7.65 ± 0.92 ^ab 7.07 ± 0.91 ^b 6.97 + - 0.93 ^{b *} 6.94 ± 1.12 ^† Urinary calcium
(mg / g creatinine) 1.32 ± 0.27 ^a 1.12 ± 0.21 ^b 0.91 + 0.18 ^c 0.81 ± 0.16 ^{c *} 0.86 ± 0.14 ^† Urinary phosphorus
(mg / g creatinine) 3.87 ± 0.71 ^a 3.18 ± 0.64 ^ab 2.84 ± 0.45 ^c 2.62 + - 0.46 ^{c *} 2.25 ± 0.38 ^†

Experimental Example 5: Confirmation of change of the turnover marker by administration of NPPH

Alkaline phosphatase (ALP), bone-specific alkaline phosphatase (BSALP), urinary deoxypyridinoline (DPD), and osteocalcin Serum levels are used as a turnover marker. It is known that osteoclassin and BSALP are released during bone remodeling, and DPD is known to be released upon bone cell loss. Thus, the present inventors confirmed the therapeutic effect of osteoporosis by measuring the change of plasma BSALP, osteoclassin, and urinary DPD by administering NPPH, which is an extract of the placenta hydrolysis, which does not contain estrogen, according to an embodiment of the present invention .

Specifically, the level of ALP was measured using a colorimetric method kit (Asan, Seoul, Republic of Korea). Serum osteocalcin was measured using an osteocalin-EIA kit (Biomedical Technology Inc., USA), bone-specific alkaline phosphatase (BSALP) and urine dioxypyridine Deoxypyridinoline (DPD) was measured using a METRATM BAP EIA kit (Quidel Corp., USA).

As shown in Table 5, serum osteocalcin, ALP and BSALP were significantly higher in the OVX group (OVX-CONT, OVX-WPPH, OVX-NPPH, and OVX-EST) 44.3%, 38.7% and 24.5%, respectively. On the other hand, OVX-WPPH group showed no significant difference in osteocalcin, ALP and BSALP levels compared to OVX-CON group, but OVX-NPPH group showed significant difference (see Table 5). However, these reductions were lower than in the OVX-EST group. These results indicate that bone regeneration is promoted by the estrogen-free NPPH donor placenta hydrolyzate according to an embodiment of the present invention, and that bone loss is suppressed, which demonstrates the therapeutic effect of NPPH on osteoporosis.

The values in Table 5 below are expressed as mean ± SD, and the superscript * indicates a statistically significant difference between OVX-WPPH, OVX-NHPPH and OVX-EST treated groups (P <0.05 ). In addition, a, b, and c in the superscript indicate that there is a statistically significant difference between the OVX-CONT, OVX-WPPH, OVX-NHPPH, and OVX-EST groups by the Tukey test (P <0.05). In addition, superscript † indicates a significant difference between OVX-CONT and Sham-CONT (P <0.05), †† means P <0.01, and ††† means P <0.001 do.

OVX-CONT
(n = 10) OVX-WPPH
(n = 10) OVX-NPPH
(n = 10) OVX-EST
(n = 10) Sham-CONT
(n = 10) Serum osteocalcin (ng / mL) 8.8 ± 1.1 ^a 7.9 ± 1.0 ^ab 7.2 ± 0.9 ^b 6.3 ± 0.8 ^{c *} 6.1 ± 0.6 ^† Serum ALP
(IU / L) 197 ± 27.8 ^a 174 ± 28.4 ^ab 153 ± 26.7 ^b 135 ± 18.9 ^{c *} 142 ± 17.5 ^† Serum BSALP
(IU / L) 19.3 ± 2.6 ^a 18.0 ± 2.3 ^ab 16.8 ± 2.0 ^b 15.7 ± 1.9 ^{b *} 15.5 ± 2.1 ^† Urinary DPD
(nmol / mmol creatinine) 38.7 ± 4.2 ^a 33.7 ± 4.1 ^ab 29.2 ± 3.8 ^b 23.4 ± 3.1 ^{c *} 24.7 ± 3.5 ^††

EXPERIMENTAL EXAMPLE 6 Measurement of Wnt Signal Transduction Related Gene Expression by Administration of NPPH

It has been reported that conventional therapies such as yomi jiulhanghang and safflower extract containing conventional placenta hydrolysates inhibit the secretion of cytokines such as IL-1β, TNF-α and IL-6, to reduce bone resorption (bone resorption) by inflammation suppressed, and known to inhibit the overall bone loss (HT Hong et al, Journal of Ethnopharmacology, 79 (2):. 143-148, 2002; UH Jin et al , Journal of Ethnopharmacology , 106 (3): 333-343, 2006). The inventors of the present invention have found that the effect of treatment of osteoporosis on the placenta hydrolyzate with the estrogen removed according to an embodiment of the present invention is due to inhibition of secretion of cytokines, receptor activator of nuclear factor-κB ligand. In addition, by measuring changes in gene expression related to the Wnt signaling mechanism involved in the proliferation and differentiation of osteoblast cells, the signaling mechanism of estrogen-depleted NPPH donor placenta hydrolysates according to one embodiment of the present invention was confirmed Respectively.

The iliac bone of the animal model was sacrificed after the animal model was terminated after the 12-week administration period. Each iliac region was pulverized using a mortar and pestle, and RNA was extracted using Trizol reagent (Gibco-BRL, USA). The same amount of cDNA was synthesized using superscript III reverse transcriptase and PCR was performed using Taq DNA polymerase. The same amount of cDNA was then added to the SYBR Green mix (Bio-Rad, Richmond, Calif.) And performed using a real-time PCR instrument (Bio-rad, USA). Expression levels of each gene were adjusted based on beta-actin levels. The expression levels of LRP5, DKK1 (dickkopf-related protein 1), β-catenin and RANKL were measured using the following primers to measure the expression of Wnt signaling related genes: And PCR was repeated four times for each group (see Table 6).

order SEQ ID NO: LRP5 forward primer GGCTCGGATGAAGCTAACTG One LRP5 reverse primer CAGGATGATGCCAATGACAG 2 DKK1 forward primer GCTGCATGAGGCACGCTAT 3 DKK1 reverse primer GGGCATGCATATTCCGTTT 4 -catenin forward primer GGAAAGCAAGCTCATCATTCT 5 -catenin reverse primer AGTGCCTGCATCCCACCA 6 RANKL forward primer GCTCGAAAGTACAGGAACAGA 7 RANKL reverse primer GCCGAGGAAGGGAGAGAACGAT 8 -actin forward primer AGCGTGGCTACAGCTTCACC 9 -actin reverse primer AAGTCTAGGGCAACATAGCACAGC 10

As a result, as shown in FIG. 2, levels of LRP5, β-catenin and DKK1 mRNA were increased in OVX-CON group compared with Sham-CON, but the level of RANKL mRNA was not different in Sham-CON and OVX groups. The levels of LFP5 and β-catenin mRNA were significantly higher in the OVX-EST group than in the OVX-NPPH group, but were highest in the OVX-EST group. However, DKK1 expression was decreased in the OVX-NPPH and OVX-EST groups, while RANKL expression was not changed in the OVX-WPPH, OVX-NPPH and OVX-EST groups.

That is, the above results suggest that the treatment effect of osteoporosis of the NPPH donor placenta hydrolyzate with estrogen removed according to an embodiment of the present invention was not related to the anti-inflammatory response by inhibiting cytokine secretion. In addition, it is suggested that the Wnt signaling mechanism is effective in the treatment of osteoporosis by increasing the expression of LRP5 and β-catenin related to Wnt signaling and decreasing the expression of DKK1, a Wnt signal transduction inhibitor.

While the present invention has been described with reference to exemplary embodiments, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the invention. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

&Lt; 110 > Codebio Co., Ltd.          Hoseo University Academic Cooperation Foundation <120> Composition for preventing and treating osteoporosis <130> PD12-0609 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LRP5 forward primer <400> 1 ggctcggatg aagctaactg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LRP5 reverse primer <400> 2 caggatgatg ccaatgacag 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DKK1 forward primer <400> 3 gctgcatgag gcacgctat 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DKK1 reverse primer <400> 4 gggcatgcat attccgttt 19 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-catenin forward primer <400> 5 ggaaagcaag ctcatcattc t 21 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> beta-catenin reverse primer <400> 6 agtgcctgca tcccacca 18 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RANKL forward primer <400> 7 gctcgaaagt acaggaacag a 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RANKL reverse primer <400> 8 gccgaggaag ggagagaacg at 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forward primer <400> 9 agcgtggcta cagcttcacc 20 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 10 aagtctaggg caacatagca cagc 24

Claims (7)

A composition for the prevention and treatment of osteoporosis, which comprises as an active ingredient a hydrolyzed placenta of the doneparte, which is obtained by hydrolyzing the placenta with a protein hydrolyzing enzyme and then removing estrogen by using an adsorbent and containing no estrogen. delete The method according to claim 1,
The composition for preventing and treating osteoporosis, wherein the placenta hydrolyzate extract does not contain progesterone. The method according to claim 1,
Wherein the adsorbent is hydroxyapatite, diatomaceous earth or activated carbon. The method according to claim 1,
Wherein the protein hydrolyzing enzyme is papain, bromelain, proanase or alkalase, a composition for preventing and treating osteoporosis. A health food for prevention and improvement of osteoporosis, which comprises hydrolyzed placenta as a protein hydrolytic enzyme, and estrogen-free estrogen-free placenta hydrolyzate obtained by using an adsorbent as an active ingredient. Comprising the step of hydrolyzing a pharmaceutically effective amount of a placenta of the donor into a protein hydrolyzing enzyme and then administering to the mammal a non-human placenta hydrolyzed extract containing no estrogen with estrogens removed using an adsorbent. Methods for the prevention and treatment of osteoporosis in mammals other than humans.

Images