KR101484259B1 - Primers for amplifying cyanobacteria gene, and detection method of cyanobacteria gene using the same - Google Patents

Abstract

The present invention relates to a primer for specifically amplifying various species of cyanobacteria and a method for detecting cyanobacteria using the same.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a primer for amplifying a genus of green algae and a method for detecting a cyanobacteria using the same.

More particularly, the present invention relates to a primer for amplifying a fragment of 16S rDNA of cyanobacteria, and a detection method and detection kit of cyanobacteria using the same. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a primer for amplifying cyanobacteria and a method for detecting cyanobacteria using the same.

In recent years, the spread of cyanobacteria along with global warming has become a big problem in summer and autumn. In Korea, especially in the rivers and rivers, especially in the Han River in 2012, the occurrence of green algae was serious and threatened to use drinking water. However, the study on cyanobacteria causing green algae is very scarce and especially in Korea, it is mostly analyzed through morphological classification. By analyzing the kinds of cyanobacterial species and toxins produced by the cyanobacteria that prosper in different time periods and regions using the next-generation sequencing analyzer, which has recently been developed and used in a wide range of biological fields, It will be possible to prepare various measures.

Cyanobacteria are strains of the genus Microcystis sp. Such as Microcystis aerugonosa; Anabaena sp. Strains such as A. circinalis, A. flos-aquae, A. lemmermanii, and A. solitaria; Aphanizomenon sp .; There is O. agardhii, O. agardhii. isothrix, and Osillatoria sp. strains such as O. formosa.

Genetic analysis of cyanobacteria is based on the use of primers for the amplification of 16S rRNA genes (Nubel et al., 1997, Appl Environ Microbiol. 63: 3327-3332; Matsunaga et al., 2001, Jour Appl Phycol 13 : 389-394.) However, in the case of cyanobacteria, the 16S rRNA gene is very similar to other bacteria, making it difficult to produce a cyanobacterial primer. Especially in the case of known primers (CYA106F, CYA359F, Nubel et al., 1997, Appl Environ Microbiol. 63: 3327-3332), certain cyanobacterial species can not obtain amplification products due to the presence of other regions in the cyanobacteria. As shown in Fig. 1, there are other sequences in the blue algae when comparing sequences of genes of cyanobacteria and other bacteria to Cya359F, a primer for gene amplification of known cyanobacteria. Especially, in case of EF600565 or EU3855890, there are many different parts. Cyanobacteria also have a problem in that they amplify the genes of other species other than cyanobacteria because they are similar in gene to other bacterial species.

Therefore, in order to provide a detection method for quickly and efficiently confirming the existence and identification of cyanobacteria, it is necessary not only to obtain PCR amplification products of various kinds of cyanobacteria capable of many kinds of cyanobacteria, but also to obtain amplification products of cyanobacteria A cyanobacterial gene specific primer that can obtain a relatively large amount and can exclude the amplification products of bacteria of other species other than cyanobacteria having similar sequences is required.

It is an object of the present invention to provide a nucleic acid molecule for a specific primer of a cyanobacterium gene which can amplify various species of cyanobacteria at a high amplification ratio and other bacterial genes other than cyanobacteria are not amplified or amplified at a relatively low rate will be.

It is still another object of the present invention to provide a detection method for quickly and efficiently confirming the presence or identification of cyanobacteria, including a forward primer and a reverse primer capable of amplifying various kinds of cyanobacteria at a high amplification ratio Lt; RTI ID = 0.0 > a < / RTI > cyanobacterial gene.

It is a further object of the present invention to amplify a gene of cyanobacteria using the above-described cyanobacterial-specific primer which selectively amplifies only a specific gene of cyanobacteria at a high amplification rate to enable selective amplification of cyanobacteria present in the sample, And a method for identifying the cyanobacterium by analyzing the product.

A further object of the present invention is to amplify a gene present in a sample using a primer that specifically amplifies a cyanobacterial gene and analyze the amplification product to determine the kind and content of the cyanobacterial species constituting the cyanobacterial community in the sample (Cyanobacteria population analysis) and an assay kit for analysis.

Hereinafter, the present invention will be described in detail.

In order to achieve the above object, one embodiment of the present invention is a method for amplifying cyanobacterial primer nucleic acid molecules, which selectively amplifies only specific genes of cyanobacteria at a high amplification rate to enable selective amplification of cyanobacteria present in a sample, To a primer set for amplification of a cyanobacterial gene.

Yet another embodiment of the present invention is a method for identifying a cyanobacterium using the primer or primer set, an identification kit, and an analysis of a cyanobacterial population analyzing the species and content of the cyanobacterial species constituting the cyanobacterial community in the sample A cyanobacter population analysis and an assay kit.

According to the present invention, the presence or absence of the cyanobacterium can be easily confirmed with a higher sensitivity and a detection method having a further improved detection limit can be obtained.

The term "primer" in the context of the present invention refers to a nucleic acid that is complementary to the 5 ' -terminal and 3 ' -terminal sequences of the target nucleic acid region amplified in the amplification reaction of the nucleic acid, (I. E., Means a single-stranded oligonucleotide capable of acting as a starting point for a polymerase reaction of a template-directed nucleic acid under four different nucleoside triphosphates and polymerase, depending on the temperature and the use of the primer Oligonucleotides, which typically contain 15 to 40 bases, with mutations. The short primer molecules generally require a lower temperature to form a sufficiently stable hybridization complex with the template. Hybridization or annealing at the site to form a double-stranded structure.

An embodiment of the present invention is characterized in that the primer nucleic acid molecule for DNA amplification for detection of cyanobacteria comprises 24 to 28 bases continuously containing the nucleotide sequence (referred to as CTA_imF) shown in SEQ ID NO: 1 below, It is preferably a forward primer for 16S rDNA amplification of cyanobacteria.

SEQ ID NO: 1: 5'-YDCAATGGGCGAAAGCCTGACGSA-3 '

Wherein S is G or C, Y is C or T, D is A, G or T, preferably S is G or C, Y is C and D is G.

The primer nucleic acid molecule for amplification of the present invention is designed as a target portion of variable region 3 and 4 of the blue-green alga 16S rRNA region, and a primer for amplifying 16S rDNA of cyanobacteria.

The primer nucleic acid molecule for amplification for detection of cyanobacterium of the present invention comprises a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 1 or a nucleic acid molecule represented by SEQ ID NO: 1, wherein the 5'- Terminus of the nucleic acid molecule may be a nucleic acid molecule containing up to 26 bases in which one or two bases are bonded, preferably at the 3 'terminus of the nucleic acid molecule represented by SEQ ID NO: 1 One or two base-linked nucleic acid molecules. An example of a preferred nucleic acid molecule may be a nucleic acid molecule having the nucleotide sequence of any of SEQ ID NOS: 2 to 8 shown in the following Table 1, and most preferably a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 2 (CTA_imF1).

Primer sequence (5 '-> 3') SEQ ID NO: CTA_imF YDCAATGGGCGAAAGCCTGACGSA One CTA_imF1 CGCAATGGGCGAAAGCCTGACGSA 2 CTA_imF2 CGCAATGGGCGAAAGCCTGACGSAG 3 CTA_imF3 CGCAATGGGCGAAAGCCTGACGSAGC 4 CTA_imF4 YGCAATGGGCGAAAGCCTGACGSA 5 CTA_imF5 YGCAATGGGCGAAAGCCTGACGSAGC 6 CTA_imF6 CDCAATGGGCGAAAGCCTGACGSA 7 CTA_imF7 CDCAATGGGCGAAAGCCTGACGSAGC 8

In the nucleotide sequence shown in Table 1, S is G or C, Y is C or T, and D is A, G or T.

A primer set for amplifying a cyanobacterial DNA according to the present invention is a primer for 16S rDNA amplification of cyanobacteria, comprising a forward primer nucleic acid molecule containing the nucleotide sequence of SEQ ID NO: 1 and a reverse primer nucleic acid molecule for amplifying the 16S rDNA of the cyanobacteria Primer set. The reverse primer nucleic acid molecule may be a conventional reverse primer used in the art as a reverse primer for 16S rDNA amplification of cyanobacteria, for example, CYA781R (Nubel et al., 1997) It does not.

 CYA781R (SEQ ID NO: 9): 5'-GACTACWGGGGTATCTAATCCCWTT-3 '

In the above sequence, W is A or T.

The primer according to the present invention can amplify the target gene of the cyanobacteria or a specific site thereof at a high amplification rate by including a sequence capable of increasing amplification specificity at the 5'-terminal and the 3'-terminal of (CYA_imF) , And various cyanobacteria can be amplified at the same time. For example, when a 454 GS FLX Titanium / Junior machine manufactured by Roche Corporation, which is a next-generation sequencing apparatus, is to be used, an adapter sequence, a key sequence, and a linker at the 5'-end or 3'-end of the primer nucleic acid molecule of the present invention Or may further include a barcode sequence between the key sequence and the link sequence, and such sequence may be used in conjunction with the Hur et al., 2011 Appl. Environ. Microbiol. 77; 7611-7619.

Another embodiment of the present invention relates to a method or detection or identification kit for detecting or identifying cyanobacteria present in a sample using the primer.

Specifically, a method for detecting or identifying the cyanobacteria present in the sample is obtained by obtaining the genomic DNA of the bacteria present in the sample, amplifying the genomic DNA as a template using a primer set according to the present invention by a polymerase chain reaction , And analyzing the base sequence of the amplification product to detect cyanobacteria present in the sample.

 As used herein, the term "polymerase chain reaction" (PCR) is a method for amplifying a nucleic acid molecule, particularly a specific DNA region, by a chain reaction of a nucleic acid polymerase, , HI (WO 89/06700) and Davey, C. et al. (EP 329,822), which is hereby incorporated by reference. Polymerase chain reaction is the best known nucleic acid amplification method, and many variations and applications thereof have been developed.

For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR) and multiplex PCR have been developed for specific applications. For more information on PCR see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000).

A variety of DNA polymerases can be used for PCR, including for example the "Klenow fragment" of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu) .

In the present invention, the polymerase chain reaction solution may contain a dNTP mixture (dATP, dCTP, dGTP, dTTP), a PCR buffer, and a DNA polymerase cofactor. The components may be used and are not particularly limited.

When conducting a polymerase chain reaction, it is desirable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction by the polymerase chain reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. It is desirable to provide the reaction mixture with such joins as Mg ^{2 +} , dATP, dCTP, dGTP and dTTP to such an extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reaction without changing the conditions such as the addition of reactants.

The product of the amplified DNA polynucleotide sequence obtained as a result of carrying out the PCR using the primer set of the present invention is analyzed by a suitable method. For example, amplified DNA products can be analyzed by gel electrophoresis of the amplification products described above, and observation and analysis of the resulting bands. Alternatively, the cyanobacteria present in the sample can be identified as a specific species by analyzing the base sequence of the amplification product and utilizing the gene database. It is also possible to identify the species and content of the species of the cyanobacterial community contained in the sample by identifying the various species of cyanobacteria contained in the sample as specific species, respectively. The analysis of the nucleotide sequence can be performed by a method known to a person skilled in the art and is not particularly limited. The gene amplification product can be confirmed by the electrophoresis or the like to determine whether the target strain exists in the sample in consideration of the presence or absence of a band having a specific size.

According to the present invention, there is provided a nucleic acid molecule and primer set for a cyanobacterial gene-specific primer capable of amplifying various kinds of cyanobacterial genes at a high amplification ratio, and a method for detecting a cyanobacteria and a detection kit using the same, In particular, the occurrence of large quantities of cyanobacteria has a great adverse effect on aquatic ecosystems, and if a water source is contaminated, the health of the people can be threatened. Therefore, the present invention can detect and predict large- It provides a useful tool for proper management.

Brief Description of the Drawings Fig. 1 is a diagram showing the results obtained by comparing sequences of Cya359F, a primer for gene amplification of a conventional blue-green algae, and sequences of genes of cyanobacteria and other bacteria.
FIG. 2 is a result of comparing PCR amplification results of cyanobacterial 16S rDNA using Cya359F, a primer for gene amplification of the prior art, and the primer according to the present invention.
3A to 3C are double plots obtained by amplifying a sample DNA using a primer pair according to an embodiment of the present invention and analyzing the base sequence.
4A to 4C are graphs showing the percentage of cyanobacteria in the total bacteria in the sample obtained by amplifying the sample DNA and analyzing the base sequence using primer pair, conventional primer pair, and bacterial universal primer pair according to an embodiment of the present invention The results are compared.
FIGS. 5A to 5D are diagrams showing the results of amplification of a sample DNA by using a primer pair, a conventional primer pair, and a bacterial universal primer pair according to an embodiment of the present invention, (species).

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Example 1: Design and production of cyanobacteria primer

For the preparation of the primer according to the present invention, the nucleotide sequence of the 16S rRNA gene of the cyanobacterium was obtained based on the NCBI database, and these nucleotide sequences were aligned. Sequence alignments were analyzed using the jPhydit program (Jeon et al., 2005). (Jeon et al., 2005, jPHYDIT: a JAVA-based integrated environment for molecular phylogeny of ribosomal RNA sequences. Bioinformatics 21: 3171-3173.) After sorting the cyanobacterial genes, Align together. After sorting the nucleotide sequences, we confirmed the degree of correspondence between the existing primer part and the other bacteria in contact with cyanobacteria.

As shown in Fig. 1, it was confirmed that existing primers have similar species (Bacillus edaphicus) and non-similar species (EF600565_s E5-10, EU385890_s MD2902-B72) I could confirm. This may make erroneous amplification and specific amplification impossible. In order to solve this problem and to increase the amplification of cyanobacteria, primers were prepared by locating a region containing a large amount of C and G at the front and back of the primer sequence. The primers prepared in the present invention are primers having the nucleotide sequences of SEQ ID NOS: 2 to 8 in Table 1 above.

The primers specifically prepared in this Example are primers having the nucleotide sequences shown in Table 2 below. (CTA_imF1-1) and SEQ ID NO: 12 (CTA_imF1-2) in Table 2, and the reverse primer is a sequence (CYA781R) having the above SEQ ID NO: 9, and the reverse primer is CTA_imF1 having SEQ ID NO: (CYA781R-1, CYA781R-2, CYA781R-3, CYA781R-4) having the nucleotide sequences of SEQ ID NOS: 13 to 16 shown in Table 3 below. Thus, specifically, a total of 8 primer pairs were prepared by the combination of the forward primers CTA_imF1-1 and CTA_imF1-2 and the reverse primers CYA781R-1, CYA781R-2, CYA781R-3 and CYA781R-4, Respectively.

Primer sequence (5 '-> 3') SEQ ID NO: CTA_imF1 CGCAATGGGCGAAAGCCTGACGSA 2 CTA_imF1-1 CGCAATGGGCGAAAGCCTGACGGA 11 CTA_imF1-2 CGCAATGGGCGAAAGCCTGACGCA 12 CYA781R 5'-GACTACWGGGGTATCTAATCCCWTT-3 ' 9 CYA781R-1 5'-GACTACAGGGGTATCTAATCCCATT-3 ' 13 CYA781R-2 5'-GACTACAGGGGTATCTAATCCCTTT-3 ' 14 CYA781R-3 5'-GACTACTGGGGTATCTAATCCCTTT-3 ' 15 CYA781R-4 5'-GACTACTGGGGTATCTAATCCCATT-3 ' 16

In Table 2, S is G or C, and W is A or T.

Example 2: Amplification of DNA using primers

2-1. Comparative example  For amplification primer  Set Manufacturing

The following primer pair known as a cyanobacterial 16s rDNA amplification primer was prepared (Nubel et al, 1997. PCR primers to amplify 16S rRNA genes from Cyanobacteria. Appl. Environ. Microbiol. 63: 3327-3332). Specifically, the forward primer of the comparative example is CYA359F having SEQ ID NO: 10, the specific nucleotide sequences are shown in SEQ ID NOs: 17 and 18 in Table 3, the reverse primer in the comparative example is the sequence having the SEQ ID NO: 9 (CYA781R) SEQ ID NOS: 13 to 16 in Table 3 below. Specifically, a total of 8 primer pairs were prepared by combining CYA359F-1 and CYA359F-2, which are forward primers, and CYA781R-1, CYA781R-2, CYA781R-3, and CYA781R-4, which are reverse primers, Respectively.

Primer sequence (5 '-> 3') SEQ ID NO: CYA359F 5'-GGGGAATYTTCCGCAATGGG-3 ' 10 CYA359F-1 5'-GGGGAATCTTCCGCAATGGG-3 ' 17 CYA359F-2 5'-GGGGAATTTTCCGCAATGGG-3 ' 18 CYA781R 5'-GACTACWGGGGTATCTAATCCCWTT-3 ' 9 CYA781R-1 5'-GACTACAGGGGTATCTAATCCCATT-3 ' 13 CYA781R-2 5'-GACTACAGGGGTATCTAATCCCTTT-3 ' 14 CYA781R-3 5'-GACTACTGGGGTATCTAATCCCTTT-3 ' 15 CYA781R-4 5'-GACTACTGGGGTATCTAATCCCATT-3 ' 16

In Table 3, Y is C or T, and W is A or T.

2-2. Convergence to use specific amplifiers primer  Produce

A primer set consisting of the forward primer (SEQ ID NO: 2) and the reverse primer (SEQ ID NO: 9) according to the present invention obtained in Example 1 and the primer set consisting of the conventional forward primer (SEQ ID NO: 10) and the reverse primer As a comparative example, a fusion primer was constructed and used for the next generation sequencing analysis device for the identification of cyanobacteria in a short time. Detailed information on how to make fusion primers can be found at http://oklbb.ezbiocloud.net/content/1001 (Hur et al., 2011). Specifically,

(5'-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGAC-3 ') of SEQ ID NO: 19 as an adhesion sequence of a forward primer is referred to as SEQ ID NO: 2 (specifically, CTA_imF1- 1 and CTA_imF1-2) to prepare a fusion primer. (5'-CCATCTCATCCCTGCGTGTCTCCGACTCAGAC-3 ') of SEQ ID NO: 20 as the attachment sequence of the reverse primer is referred to as SEQ ID NO: 9 (specifically, SEQ ID NO: 13 (CYA781R-1, CYA781R-2, CYA781R-3 and CYA781R-4) having the nucleotide sequences of SEQ ID NOs: The polynucleotide of SEQ. ID. NO. 19 as the attachment sequence of the forward primer and the polynucleotide of SEQ. ID. NO. 20 as the attachment sequence of the reverse primer can be obtained by inserting a barcode between the 5'-terminal to the 30th base and the 31st base, SEQ ID NO: 19 can be represented by 5'-CCTATCCCCTGTGTGCCTTGGCAGTC-TCAG-X-AC-3 'and SEQ ID NO: 20 can be represented by 5'-CCATCTCATCCCTGCGTGTCTCCGAC-TCAG-X-AC- .

SEQ ID NO: 19: 5'-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGAC-3 '

SEQ ID NO: 20: 5'-CCATCTCATCCCTGCGTGTCTCCGACTCAGAC-3 '

The known primer pairs of the above comparative examples were obtained by amplifying the polynucleotide of SEQ ID NO: 19 with SEQ ID NO: 10 (specifically, CYA359F-1 having SEQ ID NO: 17 and CYA359F-2 having SEQ ID NO: 18) as a fusion forward primer sequence, 10 < / RTI > nucleotide sequence to prepare a fusion primer. The sequence of the fusion primer for the reverse primer sequence having the SEQ ID NO: 9 was attached to the 5'-end of SEQ ID NO: 9 as the attachment sequence of the reverse primer to prepare the fusion primer.

2-3. sample DNA Amplification of

The amplification efficiency and the amplification result of the fusion primer set obtained in Example 2-2 and the fusion primer set of the comparative example were analyzed using the same DNA sample.

Specifically, the samples were collected from the Nakdong River in May by using a 0.22 μm pore size filter (Millipore, MA, USA) in surface water collected from a specimen After filtration, the thinly cut filter is used as whole DNA by extracting bacterial DNA with DNeasy plant mini kit (trade name, Qiagen, CA, USA). (SEQ ID NOS: 11 and 12) and a conventional primer pair (SEQ ID NO: 13 and SEQ ID NO: 13, respectively) according to one embodiment of the present invention as a primer prepared for use in a next- And 12) were subjected to PCR amplification to generate an amplicon library for microbial community analysis. A specific barcode for each sample is attached in the reverse direction (of the primer) (Hur et al. 2011). PCR was carried out under the same conditions as those used in the conventional PCR using the same pair of primers. Table 4 shows the composition of the master mix used in the PCR, and Table 5 shows the PCR amplification conditions.

Reagent Reagent 1 Tube (ml) Molecular Biology Grade Water 40.7 Buffer 10X + MgCl ₂ 10X 5 dNTPs 10 mM One Primer s (Forward / Reverse) 20 pmoles / ul 2 Taq Polymerase 5 U / ml 0.25 DNA (~ 100 ng) One Total 50

step Temperature (℃) Time (minutes) Number of cycles Initial denaturation 94 5:00 Denaturation 94 0:30
30
Annealing 55 0:30 Extension 72 0:30 Final extension 72 5:00 Hold 4 Oo

2-4. Electrophoretic analysis of amplification products

The amplification products were analyzed by electrophoresis, and the results are shown in FIG. Unlike the primer pairs according to the invention, the primer pairs of the comparative example were not amplified well under the conventional PCR conditions shown in Tables 4 and 5.

In the case of the primer set according to the comparative example, it was confirmed that the amplification was not performed well under the general amplification conditions by using ExTaq polymerase (Takara), which is the most used for the cluster analysis. On the other hand, it was confirmed that the primers of the present invention can be amplified well under normal amplification conditions. As a result, it can be seen that the efficiency of PCR amplification is lowered when the primer is used as a fusion primer for efficiently utilizing the next generation nucleotide sequence analyzing apparatus.

2-5. Analysis of sample clustering pattern

The amplified products were sequenced using a 454 Junior machine from Roche, a next-generation sequencing machine. The library used for the nucleotide sequence analysis was the method provided by Roche. The same sample DNA of Example 2-2 was separated from the amplified product using the primer pair of the comparative primer and the primer pair according to the present invention by a specific bar code, A quality index of less than 25 or a read length of less than 300 bp). In order to identify the nucleotide sequence of the obtained amplification product, each base sequence was subjected to blast (BLAST) irradiation using an EzTaxon-e database (http://eztaxon-e.ezbiocloud.net) (Kim et al. 2012) The microbial community analysis results are summarized and compared with each other in FIG.

Figures 3a-3c are double pie charts of the cyanobacterial population in the sample, wherein the inner pie represents the composition of phylum and the outer pie represents the composition of the genus within the community The name of the strain corresponding to each color was described under the double pie chart. The ratios shown in the above chart represent the percentage of the specific nucleotide sequence obtained from the next generation sequencing apparatus using the respective primers.

As shown in FIGS. 3A to 3C, when the same DNA sample was analyzed using two primer pairs, in the case of the primer pair of the comparative example, 85.5% of all the bacteria were detected as cyanobacteria, whereas in the case of Example 2 94.05% of primers were detected as cyanobacteria. Among the detected cyanobacteria, 12 genus and 24 species of cyanobacteria were detected in the existing primers and 32 genera and 45 species of cyanobacteria were detected in the improved primers. Therefore, when using the primer pair according to the present invention, it is possible to further detect various cyanobacteria that could not be detected by the existing primers. Twenty additional species and 21 additional species were analyzed.

FIG. 2 shows the amplification efficiency that can be used with the next-generation sequencing apparatus of the primer according to the present invention. FIG. 3 shows that the primer of the present invention (94.05% of the entire nucleotide sequence) To further demonstrate the presence of the cyanobacterial specificity of the primer. As a result of comparing the amplified results with the same samples, it was confirmed that the primers of the present invention amplified the cyanobacteria at a much higher rate than the conventional primers, and amplified more various cyanobacterial species.

< Example  3> Universal Primer and  comparison analysis

A pair of universal primers including the forward primer of SEQ ID NO: 21 and the reverse primer of SEQ ID NO: 22 were used together with the primer pairs of the present invention and the primer pairs of the present invention used in Example 2-2 (Lopez, I., F The universal primer pair is a pair of primers designed to amplify the bacterial 16s rDNA without specific species distinction (see, for example, Ruiz-Larrea, L. Cocolin et al., 2003. Appl. Environ Microbiol. 69: 6801-6807 Specifically, SEQ ID NO: 23 (Universal-F1) and SEQ ID NO: 24 (Universal-F2) corresponding to the forward primer of SEQ ID NO: 21 and SEQ ID NO: 25 (Universal-R1) corresponding to the reverse primer of SEQ ID NO: And SEQ ID NO: 26 (Universal-R2) were used.

As a result of comparative analysis of distribution patterns of cyanobacteria using universal primer used for bacterial population analysis, the ratio of cyanobacteria to total bacterial population was similar to that of existing primers. As shown in Fig. FIG. 4 shows a comparison result of the percentage of whole bacterium cyanobacteria when different primers were used. Using the universal primer, 543 samples had more than 542 and 545 cyanobacteria. Similar results were obtained with the improved primers, but the results of 543 and 545 cyanobacterial distribution patterns similar to those of 543 using existing primers . It can be seen that this is the result of erroneous amplification through existing primers.

Universal forward primer (SEQ ID NO: 21) 5'-GAGTTTGATCMTGGCTCAG-3 '

Universal backward primer (SEQ ID NO: 22) 5'-WTTACCGCGGCTGCTGG-3 '

M represents A or C, and W represents A or T.

Primer sequence (5 '-> 3') SEQ ID NO: Universal-F 5'-GAGTTTGATCMTGGCTCAG-3 ' 21 Universal-F1 5'-GAGTTTGATCATGGCTCAG-3 ' 23 Universal-F2 5'-GAGTTTGATCCTGGCTCAG-3 ' 24 Universal-R 5'-WTTACCGCGGCTGCTGG-3 ' 22 Universal-R1 5'-ATTACCGCGGCTGCTGG-3 ' 25 Universal-R2 5'-TTTACCGCGGCTGCTGG-3 ' 26

The profile for each genus was also compared with the result of amplification using known known comparative primers (SEQ ID NOs: 10 and 9), and the result of amplification using the primers (SEQ ID NOs: 2 and 9) 21 and 22) and compared with the product of the comparative example (SEQ ID NOS: 10 and 9), it was confirmed that certain fragments were excessively amplified and exhibited different patterns. Figs. 5A to 5D show the result of comparison of composition ratios using different primers.

Therefore, if improved primers are used, more efficient, diverse and accurate analysis of cyanobacterial clusters can be identified in a short time by utilizing a next generation nucleotide sequence analyzer.

<110> CHUNLAB, INC. <120> Primers for amplifying cyanobacteria gene, and detection method          of cyanobacteria gene using the same <130> DPP20120170KR <160> 26 <170> Kopatentin 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF primer <400> 1 ydcaatgggc gaaagcctga cgsa 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF1 primer <400> 2 cgcaatgggc gaaagcctga cgsa 24 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF2 primer <400> 3 cgcaatgggc gaaagcctga cgsag 25 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF3 primer <400> 4 cgcaatgggc gaaagcctga cgsagc 26 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF4 primer <400> 5 ygcaatgggc gaaagcctga cgsa 24 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF5 primer <400> 6 ygcaatgggc gaaagcctga cgsagc 26 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF6 primer <400> 7 cdcaatgggc gaaagcctga cgsa 24 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF7 primer <400> 8 cdcaatgggc gaaagcctga cgsagc 26 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CYA781R primer <400> 9 gactacwggg gtatctaatc ccwtt 25 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> CYA359F primer <400> 10 ccatctcatc cctgcgtgtc tccgactcag ac 32 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF1-1 primer <400> 11 cgcaatgggc gaaagcctga cgga 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CTA_imF1-2 primer <400> 12 cgcaatgggc gaaagcctga cgca 24 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CYA781R-1 primer <400> 13 gactacaggg gtatctaatc ccatt 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CYA781R-2 primer <400> 14 gactacaggg gtatctaatc ccttt 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CYA781R-3 primer <400> 15 gactactggg gtatctaatc ccttt 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CYA781R-4 primer <400> 16 gactactggg gtatctaatc ccatt 25 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CYA359F-1 primer <400> 17 ggggaatctt ccgcaatggg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CYA359F-2 primer <400> 18 ggggaatttt ccgcaatggg 20 <210> 19 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide for preparing the fusion primer of forward primer <400> 19 cctatcccct gtgtgccttg gcagtctcag ac 32 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide for preparing the fusion primer of reverse primer <400> 20 ccatctcatc cctgcgtgtc tccgactcag ac 32 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Universal-F primer <400> 21 gagtttgatc mtggctcag 19 <210> 22 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Universal-R primer <400> 22 wttaccgcgg ctgctgg 17 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Universal-F1 primer <400> 23 gagtttgatc atggctcag 19 <210> 24 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Universal-F2 primer <400> 24 gagtttgatc ctggctcag 19 <210> 25 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Universal-R1 primer <400> 25 attaccgcgg ctgctgg 17 <210> 26 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Universal-R2 primer <400> 26 tttaccgcgg ctgctgg 17

Claims (12)

A nucleic acid molecule comprising the nucleotide sequence represented by SEQ ID NO: 1, or
Which is a nucleic acid molecule comprising up to 26 bases in which one or two bases are bonded to at least one terminal selected from the group consisting of the 5'-terminal and the 3'-terminal of the nucleotide sequence shown in SEQ ID NO: 1,
Primer nucleic acid molecule for 16S rDNA amplification of Cyanobacter sp. The primer nucleic acid molecule according to claim 1, wherein the primer nucleic acid molecule is a nucleic acid molecule having one or two bases bound to the 3 'end of the nucleic acid molecule of SEQ ID NO: 1, molecule. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule comprises a base sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 2 to 8, and a primer nucleic acid molecule for amplifying 16S rDNA of Cyanobacter sp. A forward primer of a 16S rDNA amplification primer nucleic acid molecule of Cyanobacter sp. According to claim 1,
A primer set for 16S rDNA amplification of Cyanobacter sp. Containing a reverse primer for 16S rDNA amplification of Cyanobacter sp. 5. The primer set according to claim 4, wherein the forward primer comprises a base sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 2-8. 5. The primer set according to claim 4, wherein the reverse primer is a primer comprising the nucleotide sequence of SEQ ID NO: A primer according to any one of claims 1 to 3, or
A kit for PCR (PCR) for amplification of 16S rDNA of a cyanobacterial sp. (Cyanobacter sp.) Comprising a primer set according to any one of claims 4 to 6. 8. The kit according to claim 7, wherein the kit further comprises a dNTP mixture, a PCR buffer and a DNA polymerase cofactor. To obtain the genomic DNA of the bacteria present in the sample,
Amplifying the genomic DNA as a template by a polymerase chain reaction using a primer set according to any one of claims 4 to 6,
And analyzing the amplification product to detect cyanobacteria present in the sample. 10. The method according to claim 9, wherein the analysis of the amplification product is performed by electrophoresis or sequencing. 10. The method according to claim 9, wherein the amplification product is analyzed for the base sequence to identify the species of cyanobacteria present in the sample. 10. The method according to claim 9, wherein when two or more kinds of cyanobacteria are present in the sample, the nucleotide sequence of the amplification product is analyzed to identify the species of the cyanobacteria in the sample and analyze the paper percentage.

Images