KR101483915B1 - Pharmaceutical composition for preventing or treating of inflammatory diseases comprising 4-isopropyl-2,6-bis(1-phenylethyl)aniline as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating inflammatory diseases or a health food which contain 4-isopropyl-2,6-bis(1-phenylethyl)aniline as an active ingredient. According to the present invention, 4-isopropyl-2,6-bis(1-phenylethyl)aniline can suppress nitric oxide (NO) generation, NF-kappa b activity, and active oxygen, and thus is expected to be useful as an active ingredient of a pharmaceutical composition or a health food composition for preventing, alleviating, or treating inflammatory diseases. In addition, since very few studies on effects of 4-isopropyl-2,6-bis(1-phenylethyl)aniline have been done until now, 4-isopropyl-2,6-bis(1-phenylethyl)aniline can be useful for new scientific studies about inflammatory diseases and the development of drugs and quasi-drugs for inflammatory diseases.

Description

TECHNICAL FIELD The present invention relates to a pharmaceutical composition for preventing or treating an inflammatory disease comprising 4-isopropyl-2,6-bis (1-phenylethyl) aniline as an active ingredient. -bis (1-phenylethyl) aniline as an active ingredient}

The present invention relates to a pharmaceutical composition for preventing or treating an inflammatory disease comprising 4-isopropyl-2,6-bis (1-phenylethyl) aniline as an active ingredient, or a health food composition containing the same.

Inflammation is a normal and protective in vivo defense manifestation that is localized to physical trauma, harmful chemicals, microbial infections, or tissue damage caused by stimuli in vivo metabolites. These inflammations are triggered by various chemical mediators produced from damaged tissues and migrating cells, and these chemical mediators are known to vary according to the type of inflammation process. In normal cases, the organism neutralizes or eliminates the cause of inflammation through the inflammation reaction, regenerates the upper tissue and regenerates the normal structure and function, but if not, the disease state such as chronic inflammation also proceeds. In addition, when the inflammation is improperly induced by an autoimmune reaction such as a harmless substance such as pollen, asthma or rheumatoid arthritis, the defense reaction itself rather damages the tissue, and therefore, a prophylactic or therapeutic agent for inflammatory diseases is required. Although most inflammatory diseases can be observed in almost all clinical diseases, some of these inflammatory diseases are bacterial diseases that can be cured by administration of antibiotics, but most of them are due to tissue damage due to autoimmune reaction, so there is no specific treatment It is known as an incurable disease.

The most common inflammatory disease preventive or therapeutic agents for treating such inflammatory diseases are largely divided into steroidal and nonsteroidal inflammatory disease preventive or therapeutic agents. Most of synthetic inflammatory disease preventive or therapeutic agents have various side effects In many cases. That is, drugs suitable for the prevention or treatment of non-steroidal inflammatory diseases (NSAIDs) suitable for the treatment of inflammatory diseases are used to alleviate inflammation, steroid agents are used if inflammation is severe or NSAIDs are not effective, Or surgery. In this case, the NSAIDs used in the present invention mainly inhibit cyclooxygenase (COX) and inhibit the production of prostaglandins involved in the inflammatory reaction, thereby exhibiting an action for preventing or treating inflammatory diseases. However, Kidney dysfunction, and the like, resulting in difficulty in long-term use.

Accordingly, the development of a therapeutic agent which is effective for treating an inflammatory disease and has a relatively low side effect has been a major subject and has been studied (Korean Patent Publication No. 10-2014-0003727), yet It is not enough.

DISCLOSURE OF THE INVENTION The present invention has been made in order to solve the problems of the prior art as described above, and the present inventors have made efforts to find out active compounds capable of preventing or treating inflammatory diseases. As a result, -Isopropyl-2,6-bis (1-phenylethyl) aniline) inhibits nitric oxide (NO) production and NF-κB activity The present invention has been completed on the basis thereof.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases comprising 4-isopropyl-2,6-bis (1-phenylethyl) aniline as an active ingredient, or a health food composition comprising the same. The purpose.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to accomplish the above object, the present invention provides a process for preparing 4-isopropyl-2,6-bis (1-phenylethyl) aniline, A pharmaceutically acceptable salt thereof as an active ingredient, or a health food composition containing the same.

In one embodiment, the inflammatory disease is selected from the group consisting of edema, dermatitis, allergy, atopy, asthma, conjunctivitis, periodontitis, rhinitis, otitis, sore throat, tonsillitis, pneumonia, hepatitis, esophagitis, gastric ulcer, gastritis, enteritis, pancreatitis, duodenal ulcer Inflammatory bowel disease, inflammatory bowel disease, inflammatory bowel disease, inflammatory bowel disease, inflammatory bowel disease, colitis, hemorrhoids, gout, sinus spondylitis, rheumatic fever, lupus, fibromyalgia, psoriatic arthritis, osteoarthritis, rheumatoid arthritis, ≪ / RTI > chronic inflammatory disease.

In another embodiment of the present invention, the composition may inhibit nitric oxide (NO) production.

In another embodiment of the present invention, the composition may inhibit NF-kB activity.

The present invention relates to a method of administering 4-isopropyl-2,6-bis (1-phenylethyl) aniline or a pharmaceutically acceptable salt thereof to a subject A method for the prophylaxis or treatment of an inflammatory disease.

The present invention relates to the use of 4-isopropyl-2,6-bis (1-phenylethyl) aniline or a pharmaceutically acceptable salt thereof for the prevention or treatment of inflammatory diseases It provides usages.

The present invention relates to the use of 4-isopropyl-2,6-bis (1-phenylethyl) aniline for the prevention, amelioration or treatment of inflammatory diseases which can inhibit nitric oxide (NO) production, NF- It is expected to be useful as an active ingredient of a pharmaceutical composition or a functional food composition.

In addition, since no research has been conducted on the effect on 4-isopropyl-2,6-bis (1-phenylethyl) aniline to date, 4-isopropyl- Can be used not only for the purpose of trying new scientific research on inflammatory diseases but also for the development of medicines and quasi drugs.

FIG. 1 shows the results of confirming the inhibitory effect of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) on nitric oxide formation.
FIG. 2 shows the results of confirming cytotoxicity of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1).
FIG. 3 shows the results of confirming the inhibitory effect of mRNA expression of TNF-α and iNOS, inflammation-related cytokines of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1).
FIG. 4 shows the results of confirming the migration behavior of the transcription factor in the nucleus by 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1).
FIG. 5 shows the results of confirming the effect of reducing 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) on NF-κB promoter activity.
FIG. 6 shows the results of confirming the reduction of phosphorylation of NF-kB signaling proteins IκBα and IKKα / β by 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1).
FIG. 7 shows the results of confirming the effect of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) on NF-κB signal transduction protein AKT, p85 and Src phosphorylation reduction.
FIG. 8 shows the results of confirming the effect of reducing the active oxygen of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1).
Figure 9 schematically illustrates the mechanism of action of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1).

Hereinafter, the present invention will be described in detail.

The present invention relates to a pharmaceutical composition containing 4-isopropyl-2,6-bis (1-phenylethyl) aniline or a pharmaceutically acceptable salt thereof as an active ingredient Or a pharmaceutically acceptable salt thereof.

As used herein, the term "prophylactic " means any action that inhibits or delays inflammatory diseases by administration of the pharmaceutical composition according to the present invention.

The term "treatment" as used in the present invention means any action that improves or alleviates symptoms caused by an inflammatory disease by the administration of the pharmaceutical composition according to the present invention.

In the present invention, the term "inflammatory disease" refers to chronic inflammation that has progressed to a disease state, an inflammatory reaction caused by a generally harmless substance such as pollen, an inflammatory reaction that is harmful to the human body such as an autoimmune reaction such as asthma or rheumatoid arthritis Inflammatory diseases such as inflammatory diseases such as edema, dermatitis, allergy, atopy, asthma, conjunctivitis, periodontitis, rhinitis, otitis, sore throat, tonsillitis, pneumonia, hepatitis, esophagitis, gastric ulcer, gastritis, enteritis, pancreatitis, duodenal ulcer, Rheumatoid arthritis, rheumatoid arthritis, shoulder pain, neuritis, menstrual cramps, nephritis, multiple sclerosis and acute or chronic inflammatory diseases, including but not limited to rheumatoid arthritis, rheumatoid arthritis, rheumatoid arthritis, fibromyalgia, psoriatic arthritis, , But is not limited thereto.

4-isopropyl-2,6-bis (1-phenylethyl) aniline, which is an active ingredient of the pharmaceutical composition of the present invention, . ≪ / RTI >

[Chemical Formula 1]

The 4-isopropyl-2,6-bis (1-phenylethyl) aniline of the present invention can be used in the form of a pharmaceutically acceptable salt. The salt may be formed by a pharmaceutically acceptable free acid Acidophosphate is useful. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates, Dioleate, aromatic acid, aliphatic and aromatic sulfonic acids. Such pharmaceutically innocuous salts include, but are not limited to, sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate chloride, bromide, Butyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, succinate, maleic anhydride, maleic anhydride, , Sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzene sulfonate, toluene sulfonate, chlorobenzene sulfide Propyl sulphonate, naphthalene-1-yne, xylenesulfonate, phenylsulfate, phenylbutyrate, citrate, lactate,? -Hydroxybutyrate, glycolate, maleate, Sulfonate, naphthalene-2-sulfonate or mandelate.

The acid addition salt according to the present invention can be prepared by dissolving 4-isopropyl-2,6-bis (1-phenylethyl) aniline in an excess amount of an acid aqueous solution, For example, methanol, ethanol, acetone or acetonitrile.

By heating the same amount of 4-isopropyl-2,6-bis (1-phenylethyl) aniline and an acid or alcohol in water, followed by evaporating the mixture and drying or by suction filtration of the precipitated salt .

In addition, bases can be used to make pharmaceutically acceptable metal salts. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or an alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is preferable for the metal salt to produce sodium, potassium or calcium salt. In addition, the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (e.g., silver nitrate).

The 4-isopropyl-2,6-bis (1-phenylethyl) aniline of the present invention can be used not only in the form of pharmaceutically acceptable salts, but also in all salts, hydrates and solvates .

The addition salt according to the present invention can be prepared by a conventional method, for example, by reacting 4-isopropyl-2,6-bis (1-phenylethyl) aniline with a water-miscible organic solvent such as acetone, methanol, ethanol , Or acetonitrile, etc., adding an excess amount of an organic acid, or adding an aqueous acid solution of an inorganic acid, followed by precipitation or crystallization. Subsequently, in this mixture, a solvent or an excess acid is evaporated and dried to obtain an additional salt, or the precipitated salt may be produced by suction filtration.

The 4-isopropyl-2,6-bis (1-phenylethyl) aniline of the present invention is preferably, but not limited to, inhibiting nitric oxide (NO) production and NF-κB activity to treat inflammatory diseases.

In a specific example of the present invention, NO production is suppressed when 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) is treated (see Example 2) and iNOS and TNF- (see Example 4), as well as a significant inhibition of NF-kB activity (see Example 6).

The pharmaceutical composition of the present invention may be formulated and administered in a variety of oral or parenteral dosage forms at the time of clinical administration, but is not limited thereto.

Examples of the formulations for oral administration include tablets, pills, light / soft capsules, liquids, suspensions, emulsions, syrups, granules and elixirs. These formulations may contain, in addition to the active ingredient, a diluent (e.g., lactose, dextrose, (E.g., silica, talc, stearic acid and magnesium or calcium salts thereof and / or polyethylene glycols), such as, for example, water, rosin, sucrose, mannitol, sorbitol, cellulose and / or glycine. The tablets may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine and may optionally contain additives such as starch, agar, alginic acid or its sodium salt A disintegrating or boiling mixture and / or an absorbent, a colorant, a flavoring agent, and a sweetening agent.

The pharmaceutical composition containing 4-isopropyl-2,6-bis (1-phenylethyl) aniline as an active ingredient can be administered parenterally, and parenteral administration can be carried out by subcutaneous injection, intravenous injection, intramuscular injection, It depends on the injection method.

At this time, 4-isopropyl-2,6-bis (1-phenylethyl) aniline or a pharmaceutically acceptable salt thereof is mixed with water together with a stabilizer or a buffer to formulate a formulation for parenteral administration, And can be prepared in an ampoule or vial unit dosage form. The composition may be sterilized or may contain other therapeutically useful substances such as preservatives, stabilizers, wettable or emulsifying accelerators, salts for controlling osmotic pressure and / or buffers, and other therapeutically useful substances, It can be formulated according to the coating method.

In addition, the pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type of disease, severity, , Sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including co-administered drugs, and other factors well known in the medical arts. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the pharmaceutical composition according to the present invention may vary depending on the age, sex, condition, body weight, absorbency, inactivation rate, excretion rate, type of disease, May be administered in an amount of 0.001 to 150 mg, preferably 0.01 to 100 mg, per 1 kg of body weight per day, every other day, or one to three times per day. However, the dosage may be varied depending on the route of administration, the severity of obesity, sex, weight, age, etc. Therefore, the dosage is not limited to the scope of the present invention by any means.

In another aspect of the present invention, the present invention provides a pharmaceutical composition comprising 4-isopropyl-2,6-bis (1-phenylethyl) aniline or a pharmaceutically acceptable salt thereof, And a method of preventing or treating an inflammatory disease comprising the step of administering to a subject a possible salt.

The term "individual" as used herein refers to a subject in need of treatment for a disease, and more specifically refers to a human or non-human primate, mouse, rat, dog, cat, It means mammals.

In another aspect of the present invention, the present invention provides a pharmaceutical composition comprising 4-isopropyl-2,6-bis (1-phenylethyl) aniline or a pharmaceutically acceptable salt thereof, A health food composition for preventing or ameliorating an inflammatory disease comprising a salt as an effective ingredient.

In the functional food composition of the present invention, the active ingredient may be directly added to the food or may be used together with other food or food ingredients, and may be suitably used according to a conventional method. The amount of the active ingredient to be mixed can be suitably determined according to the intended use (for prevention or improvement). In general, the composition of the present invention is added in an amount of not more than 15% by weight, preferably not more than 10% by weight based on the raw material, in the production of food or beverage. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range.

The functional food composition of the present invention has no particular limitation on the ingredients other than those containing the active ingredient as an essential ingredient in the indicated ratios and may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary drinks . Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavors (tau martin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavors (saccharin, aspartame, etc.) can be advantageously used as flavors other than those described above . The ratio of the above-mentioned natural carbohydrate can be appropriately determined by a person skilled in the art.

In addition to the above, the functional food composition of the present invention may contain flavoring agents such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants and heavies (cheese, chocolate etc.), pectic acid and its salts, And salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated drinks, and the like. These components may be used independently or in combination. The ratios of these additives can also be appropriately selected by those skilled in the art.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Cell culture

1-1. RAW264.7 cell culture

Murine macrophage cell line RAW264.7 cells were cultured in RPMI 1640 medium containing penicillin (100 IU / ml), streptomycin (100 μg / ml) and 10% FBS in a 100 mm cell culture dish at a density of 70-80% Lt; / RTI >

1-2. HEK293 cell culture

Human cell line HEK293 cells were cultured in 100 mm cell culture dishes at 70-80% density using DMEM media containing penicillin (100 IU / ml), streptomycin (100 μg / ml) and 10% FBS.

Example 2 Confirmation of Inhibitory Effect of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) on NO (nitric oxide) formation

In order to confirm the inhibitory effect of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) of the present invention on NO (nitric oxide) production, one of the indicators for the prevention or treatment of inflammatory diseases, Experiments were performed as well.

That is, mouse macrophage cell line RAW264.7 was adjusted to a concentration of 1 × 10 ⁶ cells / ml using RPMI 1640 medium containing penicillin (100 IU / ml), streptomycin (100 μg / ml) and 10% FBS The cells were inoculated into 96-well plates and preincubated for 18 hours at 37 ° C and 5% CO ₂ . Then, the medium was removed and 50 μl of LPS (final concentration 1 μg / ml) containing 50 μl of KTH13-AD1 (6.25, 12.5, 25, 50, 100, 150 and 200 μM each) And cultured. After 24 hours, 100 μl of the supernatant was transferred to another 96-well plate. The NO concentration was determined by measuring the absorbance at 540 nm using Griess solution (0.5% naphthylethylenediamine dihydrochloride, 5% sulfanilamide, 25% H ₃ PO ₄ ) The results are shown in Fig. At this time, a calibration curve was prepared using sodium nitrite (0 to 100 μM) as a reference material.

As shown in FIG. 1, KTH13-AD1 inhibited increased NO production by LPS treatment, and when treated with 150 [mu] M, NO production was reduced by about 50% or more compared with the control group without any treatment, It was confirmed that the NO content was continuously decreased and decreased by 80% or more when 200 μM was treated.

Example 3. Cytotoxicity measurement of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1)

1 × 10 ⁶ cells / ml of RAW 264.7 cells were plated on a 96-well plate and cultured at 37 ° C. for 18 hours in a CO ₂ incubator for the incubation time corresponding to each immunization condition. KTH13-AD1 6.25, 12.5, 25, 50, 100, 150, 200 [mu] M). The cytotoxicity was analyzed by using general MTT (3- [4,5-dimethylthiazol-2-yl] -2,5-diphinyltetrazolium bromide) assay.

That is, 10 μl of MTT solution (stock concentration: 5 mg / ml) was added and additional reaction was induced for 3 hours. 100 μl of MTT stopping solution (10% sodium dodecyl sulfate in 0.01M HCl) was added to each well for reaction termination and formazan crystal dissolution. The cell viability was calculated from the OD value obtained by measuring the absorbance at 570 nm of the amount of MTT reduced to formazan, and the result is shown in Fig.

As shown in FIG. 2, even when KTH13-AD1 was treated, the decrease in the survival rate of RAW264.7 cells treated with LPS was hardly observed and it was confirmed that there was no cytotoxicity.

Example  4. 4-Isopropyl-2,6- Bis (One- Phenylethyl ) Aniline (KTH13- AD1 ) Of the inflammatory cytokine of mRNA  Confirming expression suppression effect

In order to confirm whether inhibition of the production of nitrogen monoxide (NO) of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) occurs at the transcription level, iNOS and TNF-α mRNA levels were examined.

More specifically, RAW264.7 cells were preincubated for 18 hours, treated with KTH13-AD1 (100, 150 μM) and LPS (1 μg / ml), and then 6 hours later, total RNA was extracted using Trizol reagent. The extracted total RNA was amplified by PCR using first strand cDNA synthesis kit (Thermo scientific). The specific nucleotide sequences of sense and antisense primers of the target proteins used are shown in Table 1 below.

division primer The sequence (5 '- > 3') iNOS
Forward GGAGCCTTTAGACCTCAACAGA (SEQ ID NO: 1) Reverse TGAACGAGGAGGGTGGTG (SEQ ID NO: 2) TNF-a
Forward TGCCTATGTCTCAGCCTCTT (SEQ ID NO: 3) Reverse GAGGCCATTTGGGAACTTCT (SEQ ID NO: 4)

GAPDH was used as a control gene. PCR amplification was performed by using the Hipi PCR kit (Elpis biotech). The sense and antisense primers of each test group cDNA and the target proteins and the control GAPDH primers were added to 250 μM dNTP, 10 mM Tris-HCl (pH 8.3), KCl 50 mM, NgCl ₂ 1.5 mM Hipi PCR kit containing 20 μl. PCR was performed at 95 ° C for 45 seconds, annealing at 55 ° C for 45 seconds, and extension at 72 ° C for 1 minute. A total of 30 cycles were performed. The DNA amplified by PCR was electrophoresed on 1.5% agarose gel and the intensity of the fractionated DNA bands was measured. The results are shown in FIG.

As shown in FIG. 3, it was confirmed that the degree of mRNA expression of iNOS and TNF-α was significantly reduced by treatment with KTH13-AD1. From the above results, it was found that inhibition of the production of nitrogen monoxide (NO) by 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) occurred at the transcription level.

Example 5. Confirmation of migration pattern of transcription factor in nucleus by 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1)

Murine macrophage cell line RAW264.7 cells were cultured in RPMI 1640 medium containing penicillin (100 IU / ml), streptomycin (100 μg / ml) and 10% FBS, and cultured at a density of 90% Lt; / RTI > for 18 hours. Then, KTH13-AD1 (150 μM) was pretreated for 30 minutes, stimulated with stimuli (Lipopolysaccharide), washed with ice-cold PBS for a certain time after the drug, and homogenized in buffer A [20 mM Tris-HCl pH 8.0, Cells were harvested using 300 μl of EGTA, 2 mM EDTA, 2 mM DTT, 1 mM PMSF, 25 μg / ml Aprotinin, and 10 μg / ml Leupeptin. The cells were broken using Output 4 intensity sonicator and centrifuged at 8000 rpm for 15 min at 4 ° C to separate the supernatant (Cytosol fraction). Pellet (Nuclear fraction) was suspended in 300 μl of Homogenization buffer B (1% Triton X-100 in Homogenization buffer A), and then the cells were broken with an output of 4 using a sonicator. The obtained fractions were subjected to SDS-PAGE and western blotting , The level of migration of the transcription factor in the nucleus was evaluated. The results are shown in FIG.

As shown in FIG. 4, in the case of KTH13-AD1 treatment, the intracellular migration of p50, which is an NF-kB related protein, by LPS was reduced, whereas the effect of AP-1 related protein (c-Fos, c-Jun) Of the total population.

Example  6. 4-Isopropyl-2,6- Bis (One- Phenylethyl ) Aniline (KTH13- AD1 )of NF -KB activation inhibitory effect

6-1. Decrease of NF-κB promoter activity by KTH13-AD1

HEK 293 cells were plated in 24-well plates using Opti-MEM, pre-cultured in a 5% CO ₂ incubator at 37 ° C, and the cells were incubated at 50% density. NF-kappaB and AP-1 Luciferase DNA and beta-galactosidase DNA were co-transfected using PEI method. More specifically, in the PEI method, 1 μg of DNA and 3 μg of PEI were diluted in Opti-MEM, incubated at room temperature for 20 minutes, mixed with DNA dilution and PEI dilution, and incubated at room temperature for 20 minutes Respectively. After incubation, the mixture was placed in a 24-well plate, and after 6 hours, the cells were replaced with cell culture medium (10% FBS, 1% penicillin / streptomycin in DMEM) and cultured for 24 hours. KTH13- , 150, 200 [mu] M) for 30 minutes. The cells were treated with stimuli (100 nM PMA) to activate AP-1 DNA and incubated for 6-18 hours. Cells were lysed with lysis buffer and reacted with the substrate 1: 1. After the reaction, the absorbance was measured by a luminometer. The beta-galactosidase was reacted with X-gal at a ratio of 1: 1, followed by incubation at 37 ° C for 5 minutes. The absorbance at 405 nm was measured. .

As shown in Fig. 5, when KTH13-AD1 was treated, the activity of NF-kB was inhibited and the activity of luciferase induced by activation of NF-kB was markedly suppressed. On the other hand, it was confirmed that KTH13-AD1 treatment did not significantly affect AP-1 activation. From the above results, it was found that KTH13-AD1 affects the NF-kB signaling system rather than inhibiting AP-1 activity.

6-2. Identification of phosphorylation of IκBα, IKKα / β, AKT, p85 and Src by KTH13-AD1

Murine macrophage cell line RAW264.7 cells were cultured in RPMI 1640 medium containing penicillin (100 IU / ml), streptomycin (100 μg / ml) and 10% FBS at a concentration of 7 × 10 ⁶ cells / ml In a 60 mm dish for 18 hours. The cells were then stimulated with stimuli (Lipopolysaccharide) for 5, 15, 30, and 60 minutes, respectively, and KTH13-AD1 (150 μM) was pretreated for 1 hour. Cells were collected and western blots were obtained by waking the cells using a lysis buffer and a sonicator. Protein concentration of each sample was measured with BSA as a standard. SDS-PAGE was performed with each sample amount of the protein concentration based on the thus obtained value, and the protein was blotted on a PVDF membrane using a wet blotting method. The membrane was washed with 5% non-fat dried milk (Bio-rad) (P50, Lamin A / C, p-IκBα, p-ERK, ERK, p-JNK, JNK, p-Src, Src, p- Syk, Syk, p- p85, p85, IRAK1, IRAK4, and β-actin), and the second antibody solution was washed and washed. Then, ECL solution (Amersham, England) was evenly distributed on the membrane in a dark room and photographed with an X-ray film. The results are shown in FIG. 6 and FIG.

As shown in FIG. 6 and FIG. 7, it was confirmed that phosphorylation of IκBα, IKKα / β, AKT, p85 and Src was reduced by KTH13-AD1.

From the results of Examples 2 to 6, it can be seen that the 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) of the present invention is very effective for treating inflammatory diseases , And a specific mechanism for this is shown in Fig.

Example 7. Confirmation of the effect of reducing 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1)

One of the indicators of the prophylactic or therapeutic effect of 4-isopropyl-2,6-bis (1-phenylethyl) aniline (KTH13-AD1) of the present invention on inflammatory diseases was confirmed as a reduction effect of active oxygen.

More specifically, Murine macrophage cell line RAW264.7 cells penicillin (100 IU / ml) and streptomycin 1 × 10 ⁶ to (100 μg / ml) and 10% of a cell culture using RPMI 1640 medium containing FBS for cells / ml in a 12-well dish. After 18 hours, KTH13-AD1 was treated with concentration (100, 150 μM) for 30 minutes. DHT123 of yellow fluorescent substance (Rhodamine) was treated with 20 μM for 20 minutes to measure by flow cytometry. For this purpose, foil was used to prevent exposure to light, and 0.25 mM of sigma SNP, which artificially increases ROS, was treated for 20 minutes for a clear evaluation of ROS. Washed 5 times with 1 ml of PBS, suspended in 500 μl of PBS, and the amount of Rhodamine released was measured using flow cytometry. The results are shown in FIG.

As shown in Fig. 8, it was confirmed that KTH13-AD1 significantly suppressed ROS (active oxygen) increased by SNP treatment.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> RESEARCH & BUSINESS FOUNDATION SUNGKYUNKWAN UNIVERSITY <120> Pharmaceutical composition for preventing or treating of          inflammatory          4-isopropyl-2,6-bis (1-phenylethyl) aniline as an active ingredient <130> PB14-12230 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> iNOS forward primer <400> 1 ggagccttta gacctcaaca ga 22 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> iNOS reverse primer <400> 2 tgaacgagga gggtggtg 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-a forward primer <400> 3 tgcctatgtc tcagcctctt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-a reverse primer <400> 4 gaggccattt gggaacttct 20

Claims (8)

The present invention relates to an inflammatory disease comprising 4-isopropyl-2,6-bis (1-phenylethyl) aniline or a pharmaceutically acceptable salt thereof as an active ingredient A pharmaceutical composition for preventing or treating.
The method of claim 1, wherein the inflammatory disease is selected from the group consisting of edema, dermatitis, allergies, atopy, asthma, conjunctivitis, periodontitis, rhinitis, otitis, sore throat, tonsillitis, pneumonia, hepatitis, esophagitis, gastric ulcer, gastritis, enteritis, pancreatitis, duodenal ulcer, Rheumatoid arthritis, rheumatoid arthritis, tendinitis, tendinitis, hay fever, tendinitis, myositis, cystitis, nephritis, multiple sclerosis and acute or chronic inflammation &Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; disorder.
2. The composition of claim 1, wherein the composition inhibits NO (nitric oxide) production.
2. The composition of claim 1, wherein said composition inhibits NF-kB activity.
The present invention relates to an inflammatory disease comprising 4-isopropyl-2,6-bis (1-phenylethyl) aniline or a pharmaceutically acceptable salt thereof as an active ingredient &Lt; / RTI &gt;
6. The method of claim 5, wherein the inflammatory disease is selected from the group consisting of edema, dermatitis, allergy, atopy, asthma, conjunctivitis, periodontitis, rhinitis, otitis, sore throat, tonsillitis, pneumonia, hepatitis, esophagitis, gastric ulcer, gastritis, enteritis, pancreatitis, duodenal ulcer, Rheumatoid arthritis, rheumatoid arthritis, tendinitis, tendinitis, hay fever, tendinitis, myositis, cystitis, nephritis, multiple sclerosis and acute or chronic inflammation &Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; disorder.
6. The composition of claim 5, wherein the composition inhibits NO (nitric oxide) production.
6. The composition of claim 5, wherein the composition inhibits NF-kB activity.

Images