KR101467448B1 - The aqpA gene of Aspergillus nidulans and knock-out mutant thereof - Google Patents

Abstract

The present invention relates to aqpA gene of Aspergillus nidulans and its deletion mutant, and more particularly to aqpA gene of Aspergillus nidulans which encodes a protein having high homology with yeast or human aquaporin protein And an Aspergillus nidulans mutant strain in which the gene is deleted.
According to the present invention, by inhibiting the expression of the aqpA gene of Aspergillus nidulans , resistance to the antimicrobial agent and resistance to oxidative stress can be increased.
In the process of producing proteins or secondary metabolites using a strain, contamination of other microorganisms is a major obstacle when the strain is cultured. However, since the Aspergillus nidulans mutant strains prepared according to the present invention are highly resistant to antifungal agents such as fluconazole, they can be cultured with the antimicrobial agent when cultured, It is possible to inhibit the growth of other microorganisms, thereby solving the contamination problem.
For example, if an antifungal agent such as fluconazole is used to culture Aspergillus nidulans in the process for producing mannitol, the contamination of fungi other than Aspergillus nidulans can be prevented, and the production efficiency of mannitol is remarkably improved .

Description

The aqpA gene of Aspergillus nidulans and its deletion mutant strain {The aqpA gene of Aspergillus nidulans and knock-out mutant thereof}

The present invention relates to an aqpA gene of Aspergillus nidulans and a deletion mutant thereof, and more particularly to a mutant strain of Aspergillus nidulans which encodes a protein showing high homology with yeast or human aquaporin protein Lance < / RTI > aqpA gene and the Aspergillus nidulans mutant that deleted the gene.

Aquaporin is a water transport channel protein belonging to the Major Intrinsic Protein (MIP) family, and is known to be present in the cell membrane. It is found in the form of various isoforms ranging from single-celled bacteria to multi-celled higher organisms, and it is known that animals play an important role in maintaining water homeostasis in various organ systems including the brain, Is known to mediate the penetration and transport of water depending on the degree of water supply in the external environment.

Interestingly, a small cell size and a large surface area-to-volume ratio have also been found to be evolutionarily well conserved in microorganisms that do not require water transport-related proteins. In particular, about 67% of eukaryotic microorganisms that have completed genome analysis have an aquaporin gene. This fact suggests that aquaporin can play a role in water transport as well as other important cell biological functions in microorganisms. Until recently, however, some of the functions of AQY1 and AQY2 of Saccharomyces cerevisiae , which are Escherichia coli AqpZ and yeast, have been partially revealed in aquaporins in microorganisms, Its function and role were not clearly identified.

Aquaporin is largely divided into orthodox aquaporin and aquaglycero porin, with up to five different kinds of aquaporins found in yeast and mold. In the case of authentic aqua purin, it mainly plays an important role in controlling the osmotic pressure by participating in the inflow and transport of water into the cell. In the case of aquaglycerol, a small nonpolar molecule such as glycerol, polyol, urea, And it is known to play a role of nutrient intake and indirect regulation of osmotic pressure.

Although it has been shown that aquaporin is involved in the regulation of osmotic pressure in Saccharomyces cerevisiae, it is known whether or not aquaporins are involved in osmotic control through any interaction with other osmotic signaling systems such as the HOG pathway It is not. Aqy1, an aquaporin protein in Saccharomyces cerevisiae, was selectively expressed at the early stage of spore formation and was involved in the water discharge in spores, thus indicating that it participates in the maturation process of oily or spore spores. In addition, AQY1 or AQY2 deletion mutants were found to be less viable than wild type strains in the acute freezing condition, whereas overexpression of AQY1 or AQY2 genes showed more viability than wild type strains.

On the other hand, a model filamentous fungus and homothallic ascomycetes, Aspergillus ( Aspergillus) nidulans ) (teleomorph = Emericella nidulans ) have a life history of silent differentiation and oily eruption, and they have a good physiological and genetic studies because they have a good growth and relatively easy growth in a relatively rapid growth and simple synthetic medium. Unlike yeast cells, which are multicellular organisms, cell-to-cell interactions, sexual and asexual differentiation processes, and their genetic control relationships are various Has been studied. In addition, recent studies have shown that Aspergillus nidulans has three carbonic anhydrases, which are known to detect carbon dioxide (CO ₂ ), and carbon dioxide becomes a bicarbonate In order to be able to interact with the water transport protein aquaporin, water is needed.

Accordingly, the present inventor has searched for genes that are likely to encode aquaporin in Aspergillus nidulans, an important microorganism as a model of saturable fungi, and studied the functions of these genes. As a result, a gene encoding a protein having high homology with yeast and human aquaporin protein was identified in Aspergillus nidulans, and a mutant strain lacking this gene was constructed and analyzed for its function. As a result, Although it is not clearly understood how the effect of osmotic pressure is related to the function of general aquaporin, it is confirmed that the resistance to the antimicrobial agent and the resistance to oxidative stress increase in the defect, and the present invention is completed.

Accordingly, a primary object of the present invention is to provide a method for increasing the resistance of Aspergillus nidulans to antimicrobial agents and resistance to oxidative stress.

It is another object of the present invention to provide an Aspergillus nidulans mutant strain in which the resistance of the gene to the antimicrobial agent and the resistance to oxidative stress are increased.

According to one aspect of the present invention, the present invention provides a method for inhibiting the expression of an aquaporin gene represented by the nucleotide sequence of SEQ ID NO: 1, thereby increasing the resistance of Aspergillus nidulans to antimicrobial agents and resistance to oxidative stress .

According to another aspect of the present invention, there is provided an Aspergillus nidulans mutant strain in which the expression of an aquaporin gene represented by the nucleotide sequence of SEQ ID NO: 1 is inhibited and resistance to an antimicrobial agent and resistance to oxidative stress is increased, Lt; / RTI >

The aquaporin gene represented by the nucleotide sequence of SEQ ID NO: 1, that is, the aqpA gene is located on chromosome 4 of Aspergillus nidulans, the open reading frame (ORF) has 1141 nucleotides, (intron) and has 341 amino acids. The nucleotide sequence of the exon excluding the intron is represented by SEQ ID NO: 2.

A method for inhibiting the expression of the gene is in the form of a recombinant vector does not indicate a aqpA inherent activity the aqpA is inserted marker gene such as a gene, or be made, the expression of aqpA gene even if the expression is achieved in Aspergillus nidul Fragrance Can be introduced by transformation and induction of double cross-linking between the recombinant vector and chromosomal DNA of Aspergillus nidulans, resulting in a mutant strain having a chromosome in a state in which the aqpA gene is not expressed .

Also, by transforming a recombinant vector capable of producing RNA of a sequence complementary to the mRNA sequence of the aqpA gene, even if mRNA is produced by transcription of aqpA , it is possible to bind to a complementary sequence RNA, However, the present invention is not limited to the above-mentioned method.

As a result of analyzing the function of the aqpA gene represented by the nucleotide sequence of SEQ ID NO: 1 in Aspergillus nidulans using the mutant strain deficient in the gene, It is based on the fact that the resistance to fluconazole and the resistance to hydrogen peroxide (H ₂ O ₂ ) increase compared to that of snildulans.

Based on information on known aquaporin genes and proteins in other organisms, we have identified five genes that are likely to be aquaporin genes in the Aspergillus nidulans genome. As a result, we were able to select five genes, aqpA , aqpB , aqpC , aqpD , aqpE .

Among transformed, aqpA and includes the neighboring region's aqpA the production of recombinant vector of the substituted form AfpyrG, and this recombinant vector Aspergillus nidul lance in order to verify the functionality of aqpA indicating the characteristics of authentic aquaporin gene And then double cross-linking was induced to produce aqpA -deficient mutant strain.

The mutant strain and the wild type Aspergillus nudulans were cultured under osmotic stress conditions or under oxidative stress culture conditions. As a result, the wild type strain did not grow under the oxidative stress condition, The mutant was found to grow. Indicating that the resistance to oxidative stress was increased by deficiency of aqpA .

As a result of investigating the resistance or sensitivity of fluconazole, which is an antifungal agent, to the mutant strains and wild type Aspergillus nidulans, the minimum inhibitory concentration (MIC) of the wild type strains was about 32 μg / ml, while the mutant strain MIC Was about 128 占 퐂 / ml. This indicates that resistance to fluconazole, an antifungal agent, was increased by deficiency of aqpA .

The aqpA gene dealt with in the present invention has a very high homology with other aquaporins. That is, it is highly likely to play a role in the transport of water, a known function of aquaporin, and it can be predicted that aqpA is involved in intracellular delivery of substances such as fluconazole. Therefore, considering this point, it can be predicted that deficiency of aqpA will increase the resistance to fluconazole as well as other kinds of antimicrobial agents.

According to the present invention, by inhibiting the expression of the aqpA gene of Aspergillus nidulans , resistance to the antimicrobial agent and resistance to oxidative stress can be increased.

In the process of producing proteins or secondary metabolites using a strain, contamination of other microorganisms is a major obstacle when the strain is cultured.

However, since the Aspergillus nidulans mutant strains prepared according to the present invention are highly resistant to antifungal agents such as fluconazole, they can be cultured with the antimicrobial agent when cultured, It is possible to inhibit the growth of other microorganisms, thereby solving the contamination problem.

For example, if an antifungal agent such as fluconazole is used to culture Aspergillus nidulans in the process for producing mannitol, the contamination of fungi other than Aspergillus nidulans can be prevented, and the production efficiency of mannitol is remarkably improved .

Fig. 1 shows the structure of the aqpA (a), aqpB (b), aqpC (C), aqpD (D) and aqpE (E) genes. Box represents the ORF. Arrows represent the intron- Structure.
Figure 2 shows the phylogenic tree (A) of the aquaporin found in A. nidulans and the multiple alignment analysis result (B) of the aqpA gene. Scaqy1 and Scaqy2 represent Aqy1 (GI: 45270022) and Aqy2 (GI: 259147940) of S. cerevisiae , AnaqpA to E are AqpA to E of A. nidulans , AfaqpA to C are AqpA to C of A. fumigates , Hsaqp1 Aqp1 of H. sapiens (GI: 297307116), respectively. (B), the black boxes represent conserved amino acids, while the boxes of other colors represent identical or similar amino acids.
Figure 3 shows the constitution and phenotype of aqpA deficient mutation. (A) through the aqpA deficient mutants schematic and aqpA defect Southern blot analysis double cross-homologous recombination (double homologous recombination) to to confirm the gene for the production of a aqpA gene of A. nidulans A. fumigates indicates that the pyrG gene is replaced by (selective marker), the 5'-adjacent region of aqpA gene was used as a probe for Southern blot. (B) shows the results of inoculation of wild type strain and aqpA deficient mutant strain in MM and CM solid medium and then culturing under standard conditions.
Figure 4 shows the aqpA deficient mutant phenotype in the presence of various salts and osmotic stress, with the same colony size and morphology of aqpA deficient mutant (? AqpA ), wild type (WT) and negative control (NKU3.1) . The left side shows the osmotic agent and concentration used.
Figure 5 shows the sensitivity to fluconazole, an antifungal agent for aqpA deficient mutants (Δ aqpA ) and wild-type (WT) strains, through E-test.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

Example  One.

1-1. Materials and methods

1-1-1. Strain and medium, culture conditions

A. We used to receive pre-sale FGSC A4 in Fungal Genetics Stock Center (FGSC) as the wild-type strain of nidulans gene defect experimental transgenic strain A. nidulans NKU3 (pyrG89; argB2; pyroA4; Δ nkuA :: argB +; riboB2) (Han et al., 2010). In addition, when the control transfection analysis after transformation is to transform the A. fumigatus pyrG NKU3 obtained ^{NKU3.1 (pyrG89, AfpyrG +; riboB2} argB2; pyroA4;; Δ n k uA :: argB +) was used as a strain.

A. nidulans was cultured at 37 ° C and the minimal medium MM medium supplemented with 1% of CM medium and glucose (Han et al., 2001) was used as a complete medium. In the case of MM medium, pyridoxine HCl (0.5 μg / ml), p-aminobenzoate (1 μg / ml), uracil, uridine 1.2g / ℓ), potassium chloride (44.7g / ℓ), and agar powder was added to 2% in case of solid medium. Transformation of A. nidulans was performed by Han et al. (2001).

1-1-2. DNA  Extraction and manipulation

Genomic DNA extraction to perform polymerase chain reaction (PCR) or Southern analysis from A. nidulans transformants was carried out by placing 20 to 60 mg of dried mycelial flour in a microtube and adding 400 μl of a lysis buffer [50 mM Tris- (PH 8.0), 50 mM EDTA (pH 8.0), 3% SDS, 1% 2-mercaptoethanol], and the tube was reacted at 65 ° C for 1 hour. The same amount of phenol / It was extracted with chloroform and precipitated with ethanol.

Double-joint PCR (Yu et al., 2004) was performed for knock-out deletion. First, to remove the aqpA gene, a 5'-flanking region with aqpA 5 'For and aqpA 5' Rev primers (see Table 1) and aqpA 3 'For and aqpA 3' Rev primers PCR was performed to amplify the 3'-flanking region and the first PCR product was obtained by performing PCR with pyrG Forward and pyrG Reverse primers (see Table 1) in A. fumigatus pryG gene. For the second PCR, PCR was performed using the three types of fragments obtained in the first step. As a final step, the annealed PCR mixture was used as a template and aqpA 5 'nest and aqpA 3' nest primers (see Table 1) ) To prepare a PCR final product for the removal of aqpA gene, which was used to transform host strain NKU3.

Primer name The base sequence (5 '- > 3') pyrG Forward GCCTCAAACAATGCTCTTCACC pyrG Reverse ATTCTGTCTGAGAGGAGGCACT aqpA 5 'For GTGAGCATGTTGTCGTAGAAGA aqpA 5 ' Rev (pyrG tail) GGTGAAGAGCATTGTTTGAGGCGTGAGCGTTGAGACCGTGGATA aqpA 3 'For (pyrG tail) AGTGCCTCCTCTCAGACAGAATCGCTTGTGAATGCTTGCTGTGG aqpA 3 'Rev GCCCGACGGTGAAGATGAGGAT aqPA 5 'nest TGGCCTTGATGAGCTGGATTTG aqpA 3 'nest CGAAGAGCGCAGCAATAGC

1-1-3. Southern Hybridization

The genomic DNA of A. nidulans wild type and aqpA deficient mutant was extracted and digested with restriction enzyme PstI, subjected to restriction enzyme digestion in 0.7% TAE agarose gel, and subjected to Southern hybridization.

1-1-4. Phenotype observation

In the minimal medium, point inoculation of A. nidulans wild type and aqpA deficient transformant was carried out for 4 days at 37 ° C for 4 days under the conditions of no induction of silent or osteogenic differentiation, And compared them. Unspiked spores of A. nidulans wild type and aqpA- deficient transformants were harvested with 0.01% Tween 80, inoculated to a concentration of 1.0 × 10 ⁶ cells / ml in a liquid medium of 1% glucose and cultured for 24 hours at 37 ° C. Respectively.

In order to measure the osmotic stress response, wild type and mutant strains were added to CM and MM in 0.5, 1.0, and 1.5M KCl, 0.5, 1.0, 1.5M NaCl, or 1 and 2M sorbitol, And incubated at 37 ° C for 2 or 3 days.

The E-test was performed by inoculating the wild-type and mutant strains to the solid CM and MM mediums uniformly throughout the medium. The E-test strips were placed in the center of the medium, And then observed. E-test strips were used to examine the MIC for fluconazole, an antifungal agent.

For the Oxidative Stress Response Test, 3, 4, and 5 mM hydrogen peroxide (H ₂ O ₂ ) were added to CM and MM medium, respectively. Wild type and mutant strains were cultured at 10 ² to 10 ⁶ / And cultured at 37 ° C for 24 hours and 48 hours.

1-2. result

1-2-1. A. nidulans in Aquaporin  Isolation of genes

BLAST analysis is performed using the nucleotide sequence and amino acid sequence of the aquaporin genes AQY1 and AQY2 of yeast through the genome database of A. nidulans (http://www.broadinstitute.org/annotation/genome/aspergillus_group/FeatureSearch.html) The genomes of A. nidulans showed that one genetic aquaporin gene (ANID_10902.1) and four aqua glycerophorin genes (ANID_02822.1, ANID_07618.1, ANID_03915.1, ANID_00830.1). The inventors have named was named aqpA authentic aquaporin gene ANID_10902.1 Aqua glyceryl Foreign gene ANID_02822.1, ANID_07618.1, ANID_03915.1, each ANID_00830.1 aqpB, aqpC, aqpD, aqpE .

As a result of analysis using a genome database of A. nidulans , it was confirmed that aqpA is located on chromosome 4 and the ORF has 1141 nucleotides, which has two introns and encodes 341 amino acids (Fig. 1 A). In addition, the aqpB , aqpC , aqpD and aqpE genes are located on chromosome 6, 4, 2 and 8, respectively. The ORF of these genes encodes 463, 625, 336 and 286 amino acids, respectively (See B, C, D, and E in Fig. 1).

A. To investigate the relationship between the aquaporin protein with a protein aquaporin found in nidulans found in other fungi and eukaryotic organisms of the S. cerevisiae Aqy1, Aqy2, human (Homo of sapiens) Aqp1, and A. was examined for homology (homology), and association of the three aquaporin protein (named respectively AfaqpA, AfaqpB, AfaqpC) identified in the genome information of fumigatus (see Fig. 2).

Phylogenetic tree analysis showed that the authentic aquaporin AqpA protein of A. nidulans showed a higher homology with the Aqy1, Aqy2 and Aqp1 of yeast than the aquaglycerolone proteins and the aqua glycerophorin proteins It belongs to the same group as the aqua glycerophorin proteins found on the A. fumigatus genome (see A in FIG. 2). In addition, multiple alignment analysis showed that the water-transport-related domains were generally well preserved at the protein level in A. nidulans ' authentic aquaporin AqpA, S. cerevisiae Aqy1, Aqy2, and human Aqp1 (See Fig. 2B).

1-2-2. Gene Deficient mutant  detach

To investigate the function of aqpA, an authentic aquaporin gene, which is highly homologous to yeast and human aquaporin proteins among the aquaporin genes isolated from A. nidulans , the aqpA gene was subjected to double crossing-over homology The deletion mutants were prepared by artificially removing them by homologous recombination (see A in FIG. 3).

First, to remove the aqpA gene, NKU3 , a transgenic pyrG -host, was transformed using the PCR final product obtained by double-joint PCR using chromosomal DNA of A. nidulans as a template. The resulting pyrG ⁺ transformant was isolated and confirmed to be deficient in the aquaporin gene by PCR and Southern blotting (see A in FIG. 3). Since there are two PstI cleavage sites upstream of the wild-type aqpA gene 5 'and one PstI cleavage site within the pyrG gene used as a selection marker, the 5' the aqpA deletion mutants (knock-out mutant) substituted DNA fragment of 2,504bp was observed, but in the ORF aqpA pyrG is verified by that represented by 1,820bp (see a in Fig. 3).

1-2-3. aqpA Deficient mutant  Osmosis and Oxidative stress  Characterization under

In order to observe the phenotypic character of the aqpA deletion mutant aqpA obtained, spot inoculation was performed under minimal medium and complete medium conditions and compared with wild type strains A4 and NKU3.1 (see Fig. 3B). Mycelial growth was observed in MM and CM media to investigate the effect of aquaporin gene on mycelial growth of A. nidulans . Colony size, shape and growth rate of wild type and Δ aqpA strains were similar in normal growth condition. This suggests that the function of the aquaporin gene does not play a major role in growth during normal growth.

Since aquaporin is known as a water channel for transporting water, it is presumed that osmotic stress containing high salt concentration will require more functions than growth under normal conditions. In addition, since AQY1, AQY2, etc. of S. cerevisiae are known to be involved in osmotic pressure regulation, we examined whether aqpA gene is affected by osmotic stress in A. nidulans (see FIG. 4). However, unlike anticipated, the Δ aqpA mutant strain did not show any significant difference from the wild type in the osmotic stress or salt stress environment in which various salts were added (see FIG. 4). These results suggest that the HOG pathway plays a major role in osmotic stress-related signal transduction in A. nidulans (Han and Prade, 2002). Even though the aqpA gene is deficient, other aquaporin genes in the cell cause its function Suggesting that it may have been complemented.

In addition, hydrogen peroxide (H ₂ O ₂ ) is a type of reactive oxygen species (ROS) that acts as an intracellular oxidant, causing various intracellular toxicities and adverse reactions. In the size and electrochemical properties of the compound, water (Bienert et al., 2006). It has been reported that aquaporins are capable of being transported by aquaporins, as shown in Fig. Therefore, in order to investigate whether aquaporin is involved in the detection and delivery of hydrogen peroxide in A. nidulans , hydrogen peroxide was added at concentrations of 0, 3, and 5 mM, respectively, to investigate susceptibility to oxidative stress. As a result, when 5 mM of hydrogen peroxide was added to the minimal medium, the wild type did not grow, but the aqpA strain showed slight growth.

1-2-4. Deficient mutant  Antifungal susceptibility analysis

Since aquaporin is a MIP, it is likely that it can respond to water and other substances with a low molecular weight as well as a variety of antibiotics from the outside. To investigate this possibility, resistance to antifungal agents was tested using defective mutant Δ aqpA strains. Interestingly, the susceptibility to fluconazole was measured using a commercially available E-test kit. Interestingly, resistance to the antimicrobial agent was increased in the ΔaqpA strain compared to the wild type. The MIC of wild type was about 32 μg / Ml, whereas the aqpA mutant strain showed a MIC of 128 μg / ml (see FIG. 5). This suggests that aquaporin can simultaneously function not only as a water channel but also to detect some antifungal agents. And this is still an unknown function in other fungal aquaporins.

<110> WOOSUK UNIVERSITY <120> The aqpA gene of Aspergillus nidulans and knock-out mutant          the <130> PA120327-C01 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 1141 <212> DNA <213> Aspergillus nidulans <400> 1 atgcgctccc gcatcccaaa catcctcaag ccctggggaa ggcaggagac ccagggcgat 60 acgcccgtcg tgcggcgcaa ccgaaaccag ctgccgatgc tgcatctcgc cgatacgacg 120 cgcaacaatt taatcgctat gaccggcgag ttcgtcggca cgtttctgtt cctgttcttc 180 tcgtttgccg gcacccaagt cgcgaatacg ccgaaaccgg tcgagggggc gccgccgaat 240 accgatgcac tgctgtactc ggcgctggcg tttggtttct cgcttatggt gaacatctgg 300 gcgttttacc gggtgacggg gctgctgttc aatcccgctg tacgcttgcc gtctactggg 360 tgaaggggtc ggcggtgcta acgaccagat cgcgtccagg taaccctagc cctctgtctc 420 gttgggggga tgcccgccta ccgcgggctg ttcgtctttg ccgctcagat cgtcgggggc 480 attgcggcgg ccggcgtagt cagcgccttg ttcccggggg atctcaatgt ctcgacgaga 540 ctgggaggag gcgcatccat atcgcagggt ttgttcatcg aaatgttcct gaccgcgcag 600 ctcgtctttg tcatcatcat gctggcggtc gtcaagcaca aagggacctt tcttgcaccg 660 gttgctatcg gaatcgcttt cttcgtgacg gagatgatcg gtacgcttcc ccctgatacc 720 gttctcggtg catcttggac taatgcgttc ggcaggcgac tactacaccg ggggctcgct 780 gaaccccgcg cggtctctcg gaccggacgt gatcaaccgc agcttcccgg gttatcattg 840 gatttactgg gtcggcccgc tactcggatc gctgctggcc tgtggtttct attacttcct 900 gccttcttc tcgtatgaga gcgtcaaccc gggccaggac ttcaatgagt gggaggcgaa 960 atggggtccg ggaccgacct cgtgggattc gtccatgcgc cagcattcgc actcggatac 1020 gaccacgctg aatcgcggga tgtcgccacg agacagtcgg gccgctagaa acgggaatgg 1080 ggattggaac ggtgcccatg gtgcgcacgt tcctccgccg ccgggagaag agcaggtgta 1140 g 1141 <210> 2 <211> 1026 <212> DNA <213> Aspergillus nidulans <400> 2 atgcgctccc gcatcccaaa catcctcaag ccctggggaa ggcaggagac ccagggcgat 60 acgcccgtcg tgcggcgcaa ccgaaaccag ctgccgatgc tgcatctcgc cgatacgacg 120 cgcaacaatt taatcgctat gaccggcgag ttcgtcggca cgtttctgtt cctgttcttc 180 tcgtttgccg gcacccaagt cgcgaatacg ccgaaaccgg tcgagggggc gccgccgaat 240 accgatgcac tgctgtactc ggcgctggcg tttggtttct cgcttatggt gaacatctgg 300 gcgttttacc gggtgacggg gctgctgttc aatcccgctg taaccctagc cctctgtctc 360 gttgggggga tgcccgccta ccgcgggctg ttcgtctttg ccgctcagat cgtcgggggc 420 attgcggcgg ccggcgtagt cagcgccttg ttcccggggg atctcaatgt ctcgacgaga 480 ctgggaggag gcgcatccat atcgcagggt ttgttcatcg aaatgttcct gaccgcgcag 540 ctcgtctttg tcatcatcat gctggcggtc gtcaagcaca aagggacctt tcttgcaccg 600 gttgctatcg gaatcgcttt cttcgtgacg gagatgatcg gcgactacta caccgggggc 660 tcgctgaacc ccgcgcggtc tctcggaccg gacgtgatca accgcagctt cccgggttat 720 cattggattt actgggtcgg cccgctactc ggatcgctgc tggcctgtgg tttctattac 780 ttcctgacct tcttctcgta tgagagcgtc aacccgggcc aggacttcaa tgagtgggag 840 gcgaaatggg gtccgggacc gacctcgtgg gattcgtcca tgcgccagca ttcgcactcg 900 gatacgacca cgctgaatcg cgggatgtcg ccacgagaca gtcgggccgc tagaaacggg 960 aatggggatt ggaacggtgc ccatggtgcg cacgttcctc cgccgccggg agaagagcag 1020 gtgtag 1026

Claims (4)

A method for inhibiting the expression of an aquaporin gene represented by the nucleotide sequence of SEQ ID NO: 1 to increase the resistance of Aspergillus nidulans to antimicrobial agents and resistance to oxidative stress. The method according to claim 1,
Wherein the antimicrobial agent is fluconazole, and the oxidative stress is stress caused by hydrogen peroxide (H ₂ O ₂ ). Of the aquaporin gene represented by the base sequence of SEQ ID NO: 1 expression is suppressed, the resistance to oxidative stress resistance and for the antimicrobial agent increases Aspergillus nidul lance (Aspergillus nidulans) mutants. The method of claim 3,
The antimicrobial agent is fluconazole (fluconazole) is, the oxidative stress is Aspergillus nidul lance (Aspergillus nidulans) mutant which is characterized in that the stress caused by hydrogen peroxide (H ₂ O _2).

Images