KR101463183B1 - Novel Therapeutic Target and Bio-marker for Cancer Based on Cancer Stem Cell Characteristics - Google Patents

Abstract

The present invention provides a method for screening a substance for cancer prevention or treatment using a novel molecular marker for cancer stem cells and cancer. The present invention provides a method for screening a substance for cancer prevention or treatment using a novel molecular marker for cancer stem cells and cancer. The cancer or pancreatic cancer therapeutic target of the present invention is very useful for screening candidates for therapeutic agents specifically acting on cancer stem cells or pancreatic cancer stem cells. Further, the present invention can accurately analyze the diagnosis and prognosis of cancer or pancreatic cancer.

Description

[0001] The present invention relates to novel therapeutic targets and biomarkers for cancers based on cancer stem cell characteristics,

The present invention relates to a novel therapeutic target of cancer based on cancer stem cell characteristics and a biomarker for cancer stem cells.

Pancreatic cancer is a fatal disease that has not been recognized until the onset of the disease, and the recent westernization of lifestyle has increased the pancreatic cancer and the 5-year survival rate is very poor (7.6%). In pancreatic cancer, only 10-20% of patients will undergo curative resection and over 70% will receive chemotherapy or radiotherapy. However, since pancreatic cancer is found late, it is classified as a typical anti-cancer drug or radiation-resistant tumor and is being developed as a new anti-cancer drug. Efforts have been made to identify molecular features for targeted treatment and diagnosis of pancreatic cancer, but it is difficult to clearly identify molecular features as cancer cells grow into heterogeneity. Based on the previous studies, novel therapeutic targeting agents targeting small molecules and new antigens have been developed and introduced into the pancreatic cancer market. However, the main primary goal of these new drugs is limited to the response rate in the determination of anticancer effects, The development of a statistically significant anticancer or anticancer combination regimen for life extension of the actual patient is still a problem. Furthermore, in cancerous cancers, such as pancreatic cancer, which are easily resistant to anticancer drugs, development of a new level of anticancer drugs is urgently required.

Although the response rate of existing drugs is high, ultimately, the reason for not contributing significantly to the patient's life is the fact that the response to the anticancer drug itself has an anti-cancer effect in most of the cancer cells constituting the tumor, But it is thought that it is due to the fact that cancer stem cells which survive this chemotherapy and ultimately, cancer cells resistant to cancer stem cells derived from cancer stem cells can not be targeted.

Recently, cancer stem cells, which have stem cell characteristics of self renewal, differentiation, and proliferation, have been developed in cancer cells, This is a new theory that mutations accumulate in stem cells or progenitor cells to form cancer stem cells and tumors. It has been reported that this is thought to be involved in the initial onset of cancer, and it has been reported to have a profound effect on cancer recurrence, metastasis and induction of resistance to chemotherapy by participating in the regeneration of cancer cells reduced after cancer treatment (BB Zhou et al. Nature Reviews Drug Discovery , 8: 806-823 (2009)). Therefore, in order to fundamentally diagnose and treat cancer, it is necessary to focus on cancer stem cells, which occupy only a small part of cancer tissues and play a key role in the development, maintenance and recurrence of cancer, It will also help develop diagnostic markers for diagnosis. If the previously studied method is applied to the cancer stem cells considered to be the start of the tumor and the characteristics of cancer stem cells are identified, it will be easy to approach the root treatment of cancer and cancer stem cells.

Reported cancer stem cell-specific markers Cancer type CSC marker references leukemia CD34 + / CD38- Dick JE. Nat Med . 3 (7): 730 (1997) Breast cancer CD24- / CD44 + / Lin- Clarke MF. PNAS . 100 (7): 3983 (2003) Brain tumor CD133 + Dirks PB. Nature . 432 (7015): 396 (2004) Prostate cancer CD133 + / ITG? 2? 1 Collins AT. J Cell Sci . 117 (Pt 16): 3539 (2004) Melanoma CD20 + Fang D. Cancer Res . 65 (20): 9328 (2005) Hepatocellular carcinoma CD133 + Moriwaki H. BBRC . 351 (4): 820 (2006) Colon cancer CD133 + De Maria R. Nature . 445 (7123): 111 (2007) Pancreatic cancer CD24 + / CD44 + / ESA + Simeone DM. Cancer Res . 67 (3): 1030 (2007) CD133 + / CXCR4 + Hermann PC. Cell stem cell . 1: 313 (2007)

As shown in Table 1, various organizations and centers conducting stem cell research around the world are making efforts to identify cancer stem cells. Therefore, the development of cancer stem cell-specific markers through the identification of cancer stem cells will become an indispensable element in research and market development of therapeutic fields such as development of new therapies through the development of monoclonal antibodies in the future.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have tried to find new biomarkers for cancer therapeutic targets and cancer stem cells based on cancer stem cell characteristics. As a result, the present inventors have found that a protein specifically expressed in cancer stem cells can be a molecular target for cancer treatment. In addition, the present inventors have found that the biomarkers discovered can be used as markers capable of diagnosing cancer, particularly early diagnosis, prognosis and future therapeutic targets based on cancer stem cell biological characteristics, Thereby completing the invention.

Accordingly, it is an object of the present invention to provide a screening method of a substance for preventing or treating cancer.

It is another object of the present invention to provide a method for screening a substance for preventing or treating pancreatic cancer.

It is still another object of the present invention to provide a kit for detecting cancer stem cell-specific biomarkers.

It is still another object of the present invention to provide a kit for detecting pancreatic cancer stem cell-specific biomarkers.

It is still another object of the present invention to provide a kit for the diagnosis or prognosis of cancer.

It is still another object of the present invention to provide a kit for diagnosing or prognosing pancreatic cancer.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention and claims.

According to one aspect of the present invention, the present invention provides a method for screening a substance for preventing or treating cancer comprising the steps of:

(a) contacting a cell or tissue comprising the polynucleotide of the first sequence or the polynucleotide of the second sequence of the sequence listing with a sample to be analyzed; And

(b) measuring the expression level of the protein or polynucleotide in the step (a), wherein when the sample decreases the expression of the protein or polynucleotide, the sample is a substance for preventing or treating cancer .

The present inventors have intensively studied to find new biomarkers for cancer therapeutic targets and cancer stem cells based on the characteristics of cancer stem cells. As a result, it has been found that proteins specifically expressed in cancer stem cells can be used as target molecules for cancer therapy . In addition, the present inventors have found that the biomarkers uncovered are diagnostic markers capable of diagnosing cancer, particularly early diagnosis, and determining prognosis.

The present invention can be used as a therapeutic target of a cancer protein specifically expressed from cancer stem cells isolated from a cancer cell line, and the cancer can be diagnosed very early and the prognosis can be accurately analyzed.

The marker of the present invention is specifically expressed in cancer stem cells. Furthermore, the marker is a marker showing an expression pattern that is highly expressed in cancer stem cells as compared with cancer cells, that is, the ability to distinguish cancer cells from cancer stem cells.

In the present invention, the expression " cell or tissue " used for the screening of a substance for preventing or treating cancer is cancer stem cell or cancer tissue, preferably pancreatic cancer stem cell or pancreatic cancer tissue.

The present inventors have found that the expression of the protein or the polynucleotide encoding the same is significantly increased in cancer stem cells, unlike common cancer cells. Unlike normal cancer cells, the expression of a target protein or a polynucleotide encoding the same only in cancer stem cells specifically indicates that it is an essential element in the survival of cancer stem cells, and the substance that blocks its expression is cancer Stem cell growth inhibition and death by inducing the fundamental treatment of cancer, which helps the substance, that is, cancer treatment is judged.

The sample used in step (a) is a single compound or a mixture of compounds (e.g., a natural extract or a cell or tissue culture). The test substance can be obtained from a library of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co., Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA) ) And MycoSearch (USA). Samples can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, , The " 1-bead 1-compound " library method, and the synthetic library method using affinity chromatography screening. Methods for synthesis of molecular libraries are described in DeWitt et al., Proc . Natl . Acad . Sci . USA 90, 6909, 1993; Erb et al. Proc . Natl . Acad . Sci . USA 91, 11422, 1994; Zuckermann et al., J. Med . Chem . 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew . Chem. Int . Ed . Engl . 33,2059,1994; Carell et al., Angew . Chem . Int . Ed . Engl . 33, 2061; Gallop et al., J. Med . Chem . 37, 1233, 1994, and the like.

According to another aspect of the present invention, the present invention provides a method for screening a substance for preventing or treating cancer comprising the steps of:

(a) preparing a protein of the first sequence;

(b) contacting the test substance with the protein; And

(c) analyzing whether the test substance binds to the protein or whether the test substance inhibits the function of the protein; When the test substance binds to the protein or inhibits the function of the protein, it is judged to be a substance for preventing or treating cancer.

According to the screening method of the present invention, the test substance is contacted with the protein of the first sequence listing.

The protein used in the present invention may be in the form displayed on a cell surface, in an isolated form or in a purified form displayed on the surface of a virus (for example, a bacteriophage).

When proteins displayed on the cell surface or virus surface are used, it is preferable that the cells or viruses are immobilized on a solid substrate in order to speed up or automate screening. It is also desirable to immobilize the isolated or purified form of the protein on a solid substrate. Available as substrates are any of those conventionally used in the art, including, but not limited to, hydrocarbon polymers such as polystyrene and polypropylene, glass, metals and gels. Solid phase substrates can be provided in the form of dip sticks, microtiter plates, particles (e.g., beads), affinity columns and immunoblot membranes (e.g., polyvinylidene fluoride membranes) (see U.S. Patent No. 5,143,825 No. 5,374,530, 4,908,305, and 5,498,551). Most preferably, the solid substrate is a microtiter plate.

The screening method of the present invention can be carried out in various ways, and can be carried out in a high throughput manner according to various binding assays known in the art.

In the screening method of the present invention, the test substance or the protein may be labeled with a detectable label. For example, the detectable label may be a chemical label (e.g., biotin), an enzyme label (e.g., horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase, Let dehydratase and β- glucosidase), a radiolabel (e.g., ¹⁴ C, ¹²⁵ I, ³² P And S ³⁵ ), fluorescent labels such as coumarin, fluorescein isothiocyanate, rhodamine 6G, rhodamine B, TAMRA (6-carboxy-tetramethyl-rhodamine), Cy 3, Cy-5, Texas Red, Alexa Fluor, DAPI (4,6-diamidino-2-phenylindole), HEX, TET, Dabsyl and FAM], luminescent, chemiluminescent, FRET transfer labels or metal labels (e.g., gold and silver).

If a detectable label is labeled or a test substance is used, the occurrence of a bond between the protein and the test substance can be detected by analyzing the signal from the label. For example, when alkaline phosphatase is used as a label, it is possible to use bromochloroindoleyl phosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate ) And enhanced chemifluorescence (ECF). When horseradish peroxidase is used as a label, it is preferable to use chlorinaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorpine benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazone), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD), and naphthol / pyronin.

Alternatively, the binding of the test substance to the protein may be assayed without labeling of the interactants. For example, a microphysiometer can be used to analyze whether a test substance binds to QP-C. The microphysiometer is an analytical tool that uses a light-addressable potentiometric sensor (LAPS) to measure the rate at which a cell acidifies its environment. Changes in the rate of acidification can be used as an indicator of the binding between the test substance and QP-C (McConnell et al., Science 257: 19061912 (1992)).

Binding capacity of the protein and the test substance can be analyzed with the real-time bimolecular interaction analysis (BIA) (Sjolander & Urbaniczky, Anal Chem 63:.... 23382345 (1991), and Szabo et al, Curr Opin. Struct. Biol . 5: 699705 (1995)). BIA is a technique for analyzing specific interactions in real time, and can be performed without labeling of interactants (e.g., BIAcore ™). Changes in surface plasmon resonance (SPR) can be used as indicators for real-time reactions between molecules.

The screening method of the present invention can be carried out according to a two-hybrid analysis or a three-hybrid analysis method (US Pat. No. 5,283,317; Zervos et al., Cell 72, 223232, 1993; Madura et al., J. Biol . Chem . 268, 1204612054, 1993; Bartel et al., BioTechniques 14, 920924,1993; Iwabuchi et al., Oncogene 8, 16931696, 1993; And WO 94/10300). In this case, the protein may be used as a bait protein. According to this method, substances binding to the protein, particularly proteins, can be screened. To-hybrid system is based on the modular nature of the transcription factor consisting of segmentable DNA-binding and activation domains. Briefly, this analysis method uses two DNA constructs. For example, in one construct, a polynucleotide of the second sequence of the sequence listing is fused to a DNA binding domain-coding polynucleotide of a known transcription factor (e.g., GAL-4). In another construct, a DNA sequence encoding a protein of interest ("prey" or "sample") is fused to a polynucleotide encoding the activation domain of the known transcription factor. If bait and prey interact to form a complex in vivo, the DNA-binding and activation domains of the transcription factor become adjacent, which triggers transcription of the reporter gene (e.g., LacZ). The expression of the reporter gene can be detected. This indicates that the protein to be analyzed can bind to the protein, and consequently it can be used as a substance for preventing or treating cancer.

Examples of the sample used in the present invention include peptides, antibodies, peptide aptamers, AdNectin, affibody (US Pat. No. 5,831,012), Avimer, Silverman, J. et al, Nature Biotechnology 23 (12): 1556 (2005)) or the Kunitz domain (Arnoux B et al., Acta Crystallogr . D Biol . Crystallogr . 58 (Pt 7): 12524 (2002)), and Nixon, AE, Current opinion in drug discovery & development 9 (2): 2618 (2006)).

 According to another aspect of the invention, the present invention provides a method for screening a substance for the prevention or treatment of pancreatic cancer comprising the steps of:

(a) contacting a cell or tissue comprising the polynucleotide of the first sequence or the polynucleotide of the second sequence of the sequence listing with a sample to be analyzed; And

(b) measuring the expression level of the protein or polynucleotide in step (a), wherein when the sample reduces the expression of the protein or polynucleotide, the sample is a substance for preventing or treating pancreatic cancer .

In the present invention, the expression cells or tissues used for screening substances for the prevention or treatment of pancreatic cancer are cancer stem cells or cancer tissues, preferably pancreatic cancer stem cells or pancreatic cancer tissues.

As used herein, the term " biliary duct cancer " refers to a mass consisting of cancer cells on the pancreas. Pancreatic cancer is less common than other cancers, but early diagnosis is difficult, and the prognosis is poor on average because of good metastasis to surrounding organs or lymph nodes. Pancreatic cancer accounts for 3% of total gastrointestinal cancer and is rare in western countries, but East Asia including Korea is an area of pancreatic cancer. According to the type of pancreatic cancer, extra pancreatic cancer is decreasing worldwide, but intrahepatic pancreatic cancer is increasing. Pancreatic cancer develops at the age of 50-70 and develops better in men. In addition, most of the tumors that develop in the pancreas are malignant and are often diagnosed because of jaundice due to pancreatic obstruction. The cause of the disease is still unclear, but it is reported that the carcinogenic substance in the bile is stimulated by the pancreas.

According to another aspect of the present invention, the present invention provides a method for screening a substance for preventing or treating pancreatic cancer comprising the steps of:

(a) preparing a protein of the first sequence;

(b) contacting the test substance with the protein; And

(c) analyzing whether the test substance binds to the protein or whether the test substance inhibits the function of the protein; When the test substance binds to the protein or inhibits the function of the protein, it is judged to be a substance for preventing or treating pancreatic cancer.

The cancer treatment agent identified by the screening method of the present invention does not only target ordinary cancer cells that occupy the majority of cancer tissues but also treat cancer or cancer that plays a key role in the onset and maintenance or recurrence of cancer, It targets stem cells, thus enabling fundamental treatment of cancer.

According to another aspect of the present invention, the present invention provides a method for producing a stem cell comprising a binding agent that specifically binds to the protein of the first sequence of the sequence listing or a primer or a probe that specifically binds to the polynucleotide of the second sequence of the sequence listing, A kit for detection is provided.

In the present invention, the binding agent that specifically binds to a protein includes, for example, an oligopeptide, a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a ligand, a peptide nucleic acid (PNA) to be.

According to another aspect of the present invention, the present invention provides a method for diagnosing or diagnosing cancer, comprising a binding agent that specifically binds to the protein of the first sequence of the sequence listing or a primer or probe that specifically binds to the polynucleotide of the second sequence of the sequence listing And provides an assay kit.

In particular, the kit for cancer diagnosis or prognosis analysis of the present invention is a kit for diagnosis or prognosis of pancreatic cancer derived from cancer stem cells.

The expression " kit for cancer diagnosis or prognosis analysis " as used herein means a kit containing a composition for cancer diagnosis or prognosis analysis. Therefore, the above expression " kit for cancer diagnosis or prognosis analysis " can be used interchangeably or in combination with " composition for cancer diagnosis or prognosis analysis ".

The term " diagnosing " herein is used to determine the susceptibility of an object to a particular disease or disorder, to determine whether an object currently has a particular disease or disorder, Determining the prognosis of an object (e.g., identifying a pre-metastatic or metastatic cancerous condition, determining a stage of a cancer, or determining a cancer's response to treatment), or determining therametrics (e.g., And monitoring the status of the object to provide information).

The inventors of the present invention confirmed that the use of the marker of the present invention can provide high sensitivity and reliability for the incidence of cancer from an individual.

Expression protein expression analysis used in the diagnosis of cancer in the present invention is a process for confirming the presence and the expression level of a protein expressed from the genes in a biological sample and is preferably a process for specifically binding to the protein This means confirming the amount of protein using an antibody. Methods for this analysis include Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter (FACS), and Protein Chip are examples of immunoprecipitation, protein immunoassay, immunohistochemical staining, The method of analysis of the invention is not limited.

In the present invention, the binding agent that specifically binds to a protein includes, for example, an oligopeptide, a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a ligand, a peptide nucleic acid (PNA) to be.

"Antibody" in the present invention means a specific protein molecule directed against an antigenic site. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker protein, and includes both polyclonal antibodies, monoclonal antibodies, and recombinant antibodies.

Since the novel cancer marker proteins have been identified as described above, the production of antibodies using the novel cancer marker proteins can be easily carried out by using techniques well known in the art.

Polyclonal antibodies can be produced by methods well known in the art for obtaining sera containing antibodies by injection of the above-described cancer marker protein antigens into animals and blood collection from animals. Such polyclonal antibodies can be prepared from any animal species host, such as goats, rabbits, sheep, monkeys, horses, pigs, small dogs, and the like.

Monoclonal antibodies can be prepared using the hybridoma method (Kohler and Milstein (1976) European Journal of Immunology 6: 511-519), or a phage antibody library (Clackson et al, Nature , 352: 624-628, 1991; Marks et al, J. Mol . Biol . , 222: 58, . ≪ / RTI > The antibody prepared by the above method can be isolated and purified by gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography, and the like.

The antibodies of the present invention also include functional fragments of antibody molecules as well as complete forms with two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

In the present invention, the aptamer that binds to the active form of the enzyme is an oligonucleotide or peptide molecule, and the general contents of the aptamer are described in Bock LC et al., Nature 355 (6360): 5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med . 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA . 95 (24): 142727 (1998).

According to a preferred embodiment of the present invention, the present invention relates to an oligopeptide, a monoclonal antibody, a polyclonal antibody, a chimeric antibody, Antibody or ligand, a peptide nucleic acid (PNA) or an aptamer, more preferably an oligopeptide, a monoclonal antibody, a polyclonal antibody or a chimeric antibody, more preferably a monoclonal antibody, Antibody or polyclonal antibody, most preferably a monoclonal antibody.

In the present invention, the antibody is preferably a conjugated antibody conjugated with microparticles. The fine particles are preferably colored latex or colloidal gold particles. In the present invention, the antibody may be any antibody capable of measuring the expression level of a protein encoded by a known mRNA gene for the marker described above. Preferably, the kit is used for immunoassay Kit, and most preferably the kit is a Luminex assay kit, a protein microarray kit or an ELISA kit.

The Luminex assay, protein microarray kit and ELISA kit comprise a polyclonal antibody and a monoclonal antibody to the protein, and a polyclonal antibody to which the labeling substance is bound and a secondary antibody to the monoclonal antibody .

Examples of the kit in the present invention include an immunochromatography strip kit, a lumenex assay kit, a protein microarray kit, an ELISA kit, or an immunological dot kit. The kind is not limited.

The kit may additionally include essential elements necessary for performing ELISA. ELISA kits contain antibodies specific for the marker protein. Antibodies are monoclonal antibodies, polyclonal antibodies or recombinant antibodies with high specificity and affinity for the marker protein and little cross-reactivity to other proteins. The ELISA kit may also include antibodies specific for the control protein. Other ELISA kits can be used to detect antibodies that can bind a reagent capable of detecting the bound antibody, such as a labeled secondary antibody, chromophores, an enzyme (e. G., Conjugated to an antibody) Other materials, and the like.

In addition, the kit may additionally include essential elements necessary for performing a protein microarray to simultaneously analyze complex markers. Microarray kits contain antibodies specific for the marker protein bound to the solid phase. Antibodies are monoclonal antibodies, polyclonal antibodies or recombinant antibodies with high specificity and affinity for the marker protein and little cross-reactivity to other proteins. The protein microarray kit may also include antibodies specific for the control protein. Other protein microarray kits can be used to detect a bound antibody, such as a labeled secondary antibody, a chromophore, an enzyme (e.g., fused with an antibody), and a substrate or other substance capable of binding to the antibody And the like. A method of analyzing a sample using a protein microarray is a method of separating a protein from a sample, hybridizing the separated protein with a protein chip to form an antigen-antibody complex, reading the protein, , And can provide information necessary for cancer diagnosis.

Luminex Assay is a high-throughput quantitative assay that can simultaneously measure up to 100 different analyte without pretreatment small (10-20 μl) patient samples Is an analytical method capable of replacing existing ELISA or ELISPOT with high sensitivity (in pg) and rapid quantification (3-4 hours). The Luminex Assay is a multiplexed fluorescent microplate assay capable of analyzing more than 100 biological samples simultaneously in each well in a 96-well plate. And more than 100 different color groups of polystyrene beads are discriminated and quantified by carrying out signal transmission in real time using a laser detector of the present invention. The 100 beads are configured to be distinguished in the following manner. On one side, the red fluorescence bead is divided into more than ten stages. On the other side, the orange fluorescence bead is divided into ten stages to show the intensity difference and the bead between them. Are mixed in different ratios of red and orange to form a total of 100 color-coded bead sets. In addition, each bead has an antibody of the protein to be analyzed, so that it is possible to quantify the protein by the immunoassay using the antibody. The sample is analyzed using two lasers, one laser detects the bead's unique number and the other laser reacts with the antibody attached to the bead The protein in the sample is detected. Thus, 100 in vivo protein analysis is possible simultaneously in one well. This assay has the advantage of being detectable with as little as 15 μl of sample.

Luminex kits capable of carrying out the Luminex assays of the present invention include antibodies specific for marker proteins. Antibodies are monoclonal antibodies, polyclonal antibodies or recombinant antibodies with high specificity and affinity for the marker protein and little cross-reactivity to other proteins. The lumenex kit may also include antibodies specific for the control protein. Other luminex kits may also include reagents capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes (e.g., conjugated to antibodies) and other substrates capable of binding to the substrate or antibody . ≪ / RTI > The antibody may be a conjugated antibody conjugated with microparticles, and the microparticles may be colored latex or colloidal gold particles.

In the kit for cancer diagnosis or prognosis analysis of the present invention, the cancer diagnostic kit including the immunochromatographic strip for cancer diagnosis includes essential elements for performing a rapid test in which the analysis result can be obtained within 5 minutes The diagnostic kit may be a diagnostic kit. The immunochromatographic strip comprises (a) a sample pad on which a sample is absorbed; (b) a conjugate pad that binds to the protein of the gene in the sample; (c) a test membrane in which a test line and a control line containing a monoclonal antibody against the protein of the gene are treated; (d) an absorption pad on which a residual amount of the sample is absorbed; And (e) a support. Also, a rapid test kit containing an immunochromatographic strip contains antibodies specific for the marker protein. The antibody is a monoclonal antibody, polyclonal antibody or recombinant antibody, which has high specificity and affinity for the marker protein and little cross-reactivity to other proteins. The rapid test kit may also include an antibody specific for the control protein. Other rapid test kits include reagents capable of detecting conjugated antibodies, for example, a nitrocellulose membrane with a specific antibody and a secondary antibody immobilized thereon, a membrane bound to an antibody-bound bead, an absorbent pad and a sample pad Other substances necessary for diagnosis, and the like.

The measurement of the level of protein expression by the immunodet assay in the present invention includes (a) dotting a biological sample on the membrane; (b) reacting an antibody specific for the protein of the gene to the dormant membrane; And (c) a step of adding a secondary antibody conjugated with a label to the membrane to be subjected to the reaction, followed by color development, wherein the ELISA assay comprises the steps of: (a) contacting the protein of the gene having the nucleotide sequence with the marker Adsorbing a specific antibody 1 on a solid body; (b) contacting an antibody 1 adsorbed on the solid body with a biological sample of a suspected cancer patient to form an antigen-antibody complex; (c) treating antibody 2 specific for the protein encoded by the gene having the nucleotide sequence for the marker to which the marker substance is bound, to bind to the complex; And (d) measuring the concentration of the protein by detecting the labeling substance, wherein the protein microarray assay comprises (a) a polyclonal antibody specific to the protein of the marker gene, Immobilizing the antibody on the chip; (b) contacting the immobilized polyclonal antibody 1 with a biological sample of a patient suspected of having cancer to form an antigen-antibody complex; (c) treating the monoclonal antibody specific to the protein encoded by the gene having the nucleotide sequence for the marker to which the marker substance is bound, to bind to the complex; And (d) measuring the concentration of the protein by detecting the labeled substance.

Through the above analysis methods, it is possible to compare the amount of the antigen-antibody complex formed in the normal control group with the amount of the antigen-antibody complex formed in the suspected cancer patient, and whether the expression level of the cancer marker gene is significantly increased Thus, it is possible to diagnose the actual cancer incidence in a patient suspected of cancer.

In the present invention, the term antigen-antibody complex refers to a combination of a cancer marker protein and an antibody specific thereto, and the amount of the antigen-antibody complex formed can be quantitatively measured through a signal label of a detection label.

Such detection labels may be selected from the group consisting of enzymes, chromophores, ligands, emitters, microparticles, redox molecules, and radioisotopes, but are not necessarily limited thereto. When an enzyme is used as the detection label, available enzymes include? -Glucuronidase,? -D-glucosidase,? -D-galactosidase, urease, peroxidase or alkaline phosphatase, acetylcholine Glucoamylase, terazo, glucose oxidase, hexokinase and GDPase, RNase, glucose oxidase and luciferase, phosphofructokutase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphoenolpyruvate decar ≪ / RTI > beta-lactamase, and the like. The minerals include, but are not limited to, fluorescein, isothiocyanate, rhodamine, picoeriterine, picocyanin, allophycocyanin, o-phthaldehyde, fluororescamine and the like. Ligands include, but are not limited to, biotin derivatives. Emitters include, but are not limited to, acridinium esters, luciferin, luciferase, and the like. Fine particles include, but are not limited to, colloidal gold, colored latex, and the like. Examples of the redox molecules include ferrocene, ruthenium complex, viologen, quinone, Ti ion, Cs ion, diimide, 1,4-benzoquinone, hydroquinone, K4 W (CN) 8, [Os (bpy) [RU (bpy) 3] 2+, [MO (CN) 8] 4-, and the like. Radiation isotopes include, but are not limited to, 3H, 14C, 32P, 35S, 36Cl, 51Cr, 57Co, 58Co, 59Fe, 90Y, 125I, 131I, 186Re.

Measurement of protein expression levels is preferably performed using an ELISA method. ELISAs include direct ELISA using labeled antibodies that recognize the antigen attached to the solid support, indirect ELISA using labeled antibodies that recognize the capture antibody in a complex of antibodies recognizing the antigen attached to the solid support, A direct sandwich ELISA using another labeled antibody that recognizes an antigen in the complex of antibody and antigen, a method of reacting with another antibody recognizing an antigen in a complex of an antibody and an antigen attached to a solid support, Indirect sandwich ELISA using a secondary antibody, and various ELISA methods. More preferably, the antibody is attached to a solid support, the sample is reacted, and the labeled antibody recognizing the antigen of the antigen-antibody complex is adhered to produce an enzyme, or an antibody that recognizes the antigen of the antigen-antibody complex Is detected by a sandwich ELISA method in which a labeled secondary antibody is attached and the enzyme is developed. The degree of complex formation between the cancer marker protein and the antibody can be confirmed to confirm the onset of cancer.

Further, preferably, Western blotting using one or more antibodies against the cancer marker is used. The whole protein is separated from the sample, and the protein is separated according to size by electrophoresis, and then transferred to the nitrocellulose membrane to react with the antibody. The amount of the protein produced by expression of the gene can be confirmed by confirming the amount of the produced antigen-antibody complex using the labeled antibody, and it is possible to confirm whether or not the cancer has occurred. The detection method comprises a method of examining the expression level of a marker gene in a control group and the expression level of a marker gene in a cancer-causing cell. The level of mRNA or protein may be expressed as the absolute (e.g., [mu] g / ml) or relative (e.g., the relative intensity of the signal) difference of the marker protein.

In addition, preferably, immunostaining is performed using one or more antibodies against the cancer marker. Normal tissues and suspected cancerous tissues are collected and fixed, and paraffin-embedded blocks are prepared by methods well known in the art. These are cut into pieces of several μm thick and attached to a glass slide, and then reacted with a selected one of the above antibodies by a known method. Thereafter, the unreacted antibody is washed and labeled with one of the above-mentioned detection labels, and the labeling of the antibody is read on a microscope.

In addition, preferably, a protein chip in which at least one antibody against the cancer marker is arranged at a predetermined position on a substrate and immobilized at a high density is used. A method of analyzing a sample using a protein chip is a method of separating a protein from a sample, hybridizing the separated protein with a protein chip to form an antigen-antibody complex, reading the protein, It is possible to confirm whether or not the disease has occurred.

The biological sample in the present invention means tissue, cell, blood, serum, plasma, saliva, cerebrospinal fluid or urine, preferably blood or serum, and most preferably serum.

Expression polynucleotide measurement used to diagnose cancer in the present invention means measurement of the amount of polynucleotide in the biological sample by confirming the presence and the degree of expression of the polynucleotide encoding the protein marker of the present invention. RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection (RPA), and reverse transcriptase-polymerase chain reaction assay, Northern blotting, DNA chip, and the like.

The nucleotide sequence encoding the protein used as a marker in the present invention may include a nucleotide sequence having homology with this sequence.

Preferably, the polynucleotide in the present invention means a fragment of DNA or mRNA.

The probe or primer used in the diagnostic kit of the present invention has a sequence complementary to a polynucleotide sequence and a polynucleotide sequence encoding the protein.

The term "primer " of the present invention means a short nucleic acid sequence capable of forming a base pair with a complementary template with a short free 3-terminal hydroxyl group and functioning as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. The primer of the present invention is a sense and antisense nucleic acid having 7 to 50 nucleotide sequences for each marker gene-specific primer. Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with one or more homologues, and modification between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, (E.g., dodecanedioic acid, dodecanedioic acid, dodecanedioic acid, tartaric acid, tartaric acid, tartaric acid, The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. The nucleic acid sequences of the present invention may also be modified using a label capable of directly or indirectly providing a detectable signal. Examples of labels include radioactive isotopes, fluorescent molecules, biotin, and the like.

As used herein, the term " probe " refers to a linear oligomer of natural or modified monomer or linkages and includes deoxyribonucleotides and ribonucleotides and can specifically hybridize to a target nucleotide sequence, Present or artificially synthesized. The probe of the present invention is preferably a single strand, and is an oligodioxyribonucleotide.

When a probe is used, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. The detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning , A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization , Springer-Verlag New York Inc .; NY (1999). For example, high stringency conditions were hybridized at 65 ° C in 0.5 M NaHPO ₄ , 7% SDS (sodium dodecyl sulfate) and 1 mM EDTA, followed by addition of 0.1 x SSC / 0.1% SDS Lt; RTI ID = 0.0 > 68 C < / RTI > Alternatively, high stringency conditions means washing at < RTI ID = 0.0 > 48 C < / RTI > in 6 x SSC / 0.05% sodium pyrophosphate. Low stringency conditions mean, for example, washing in 0.2 x SSC / 0.1% SDS at 42 ° C.

According to another aspect of the present invention, the present invention provides a method for detecting pancreatic cancer stem cells comprising a binding agent that specifically binds to the protein of the first sequence listing sequence or a primer or probe that specifically binds to the polynucleotide of the second sequence listing For example.

According to another aspect of the present invention, the present invention provides a method for diagnosing or prognosing a pancreatic cancer, comprising a binding agent that specifically binds to the protein of the first sequence of the sequence listing or a primer or probe that specifically binds to the polynucleotide of the second sequence of the sequence listing And provides an assay kit.

The features and advantages of the present invention are summarized as follows:

(I) The present invention provides a method for screening a substance for preventing or treating cancer using a novel molecular marker for cancer stem cells and cancer.

(Ii) The present invention provides a method for screening a substance for preventing or treating pancreatic cancer using a novel molecular marker for pancreatic cancer stem cells and pancreatic cancer.

(Iii) The cancer or pancreatic cancer therapeutic target of the present invention is very useful for screening candidate therapeutic agents that specifically act on cancer stem cells or pancreatic cancer stem cells.

(Iv) Using the present invention, the diagnosis and prognosis of cancer or pancreatic cancer can be accurately analyzed.

FIG. 1 is a photograph showing a culture of a human pancreatic cancer cell line isolated from a spear cell having the characteristics of cancer stem cells.
FIG. 2 is a graph showing the expression of cancer stem cell-associated genes in human pancreatic adenocarcinoma (HPAC) spear cells by RT-PCR. RT-PCR data were normalized to the mRNA level of the beta actin gene.
FIG. 3 is a graph showing the results of flow cytometric analysis of the expression of cancer stem cell markers in human pancreatic cancer HPAC spear cells.
FIG. 4 is a drawing showing the result of spear formation after treating a human cell pancreatic cancer cell with a stem cell signal blocking drug.
(a) Sphere formation results for each condition, (b) Sphere diameter and number.
FIG. 5 is a photograph showing HPAC spleen cells subcutaneously injected into nude mice and histopathologic morphology by tumor size and H & E staining.
(a) tissue anatomy, (b) H & E staining results, and (c) tumor volume.
FIG. 6 is a graph showing the results of RT-PCR analysis of the expression of new marker genes in HPAC-adhered cells and spear cells. RT-PCR data were normalized to the mRNA level of the beta actin gene.
HPAC-attached cells: HA, HPAC Spear cells: HS, Capanl-adherent cells: CA, Capan1 Spear cells: HS
FIG. 7 is a graph showing the results of western blot analysis of protein expression of new markers in HPAC-adherent cells and spear cells. Western blot data were normalized to the expression level of GAPDH.
FIG. 8 is a graph showing the results of flow cytometry analysis of the expression of cell membrane proteins in HPAC-adhered cells and spear cells.
FIG. 9 is a graph showing inhibition of cancer stem cell formation ability by treating SDCBP2 antibody against HPAC cells. FIG.
FIG. 10 is a graph showing the ability of SDCBP2 to separate cells according to their expression and their ability to form clones. FIG.
(a) classification of positive and negative cells of SDCBP2 using a flow cytometer, (b) colony formation by each condition, and (c) colony count.
FIG. 11 is a photograph showing the radiation resistance and the radiation resistance after separating cells using an SDCBP2 antibody. FIG.
(a) showing the formation of colonies by each condition, and (b) showing the number of colonies.
FIG. 12 is a graph showing the results of immunostaining for the expression of pancreatic cancer stem cell-associated markers in human pancreatic cancer tissues.
(a) and (b) staining with anti-CDBP2 antibody on TMA (tissue microarray) slides of pancreatic cancer patients, and (c) staining with anti-CDBP2 antibody on whole slide of pancreatic cancer patient.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Methods

Isolation and Culture of Human Pancreatic Cancer Cell Lines with Characteristics of Cancer Stem Cells

(HPAC, Capan-1, Capan-2, CFPAC-1, AsPC-1, BxPC-3 and MIA PaCa-2, PANC- And cell lines were cultured in growth medium by the protocol provided by ATCC. AsPC-1 and BxPC-3 cells were cultured in RPMI1640 (Invitrogen Gibco, Grand Island, NY) containing 10% fetal bovine serum (FBS; Hyclone, Logan, Ut.) And Capan-1 and CFPAC- Were cultured in IMDM (Invitrogen Gibco) containing 10% FBS. Capan-2 cells were cultured in McCoy 5a (Invitrogen Gibco) containing 10% FBS and MIA PaCa-2 cells in DMEM (Invitrogen Gibco) containing 10% FBS and 2.5% HPAC cells were cultured in DMEM / Ham F12 (D / F12; Invitrogen Gibco) containing 10% FBS, and PANC-1 cells in DMEM containing 10% FBS.

(10 ng / ml, R & D Systems Inc., Minneapolis, Minn.), BFGF (10 ng / ml, R & D Systems Inc.), 1 ITS (insulin transferring selenium, Gibco), and pancreatic cancer cell lines for Sphere cell culture Well microtiter plate (DMEM / F12) supplemented with 0.5% FBS at a rate of 1,000 cells / ml for 7-10 days after inoculation into a 6-well ultra low cluster plate (Corning Inc., Corning NY). Cells grown in the same culture medium (adherent to Nalgene Nunc Int., Rochester, NY) were used as a control.

Expression of Cancer Stem Cell Related Gene in Spear Cells

Total RNA of HPAC-adherent cells and spear cells was extracted using RNAeasy Mini kit (QIAGEN, Valencia, Calif.). 2 μg of each RNA extracted at 42 ° C for one hour was subjected to reverse transcription reaction through the reaction of Superscript II (Gibco BRL, Grand Island, NY). Expression of cancer stem cell-associated genes in spear cells was analyzed by PCR using primers of cancer stem cell-related genes and Taq polymerase, and the expression of β-actin gene was used as a control. The primer sequences of the cancer stem cell-related genes, the PCR reaction temperature and the number of cycles are shown in Table 2 below.

gene Forward primer base sequence
(5'-3 ') Reverse primer sequence
(5'-3 ') Tm / cycle Jagged 1 CTCAATTACTGTGGGACTCATCA GAACACTCACACTCAAAGCCC 52 ° C / 30 Notch3 ATGGTGGGAACTAAACACAGCT ATGACCCTGGAGGAAGCACA 55 ° C / 35 Hes1 GTGCTGTCTGGATGCGGAGT GAACACTCACACTCAAAGCCC 55 ° C / 35 Ihh CCTGAACTCGCTGGCTATCT AATACACCCAGTCAAAGCCG 56 ° C / 35 PTCH GCAGTGGTGAGAGAAAAGGA CTCGGATTGGTGACCATAAG 59 ° C / 30 Gli1 AGAGTCCAGGGGGTTACATA AGAGTCCAGGGGGTTACATA 57 ℃ / 35 Wnt4 CTCCTCGTCTTCGCCGTCTT TACTGGCACTCCTCAATGGA 62 ° C / 40 Dvl2 GGTTGGGGAGACGAAGGTGATT ATCTGAGGACACCAGCCAGGATAC 58 ° C / 30 Lef1 CGAAGAGGAAGGCGATTTAG GGATGGGTGGAGAAAGAGAT 62 ° C / 40 Oct4 GTGGAGGAAGCTGACAACAA AGCAGCCTCAAAATCCTCTC 62 ° C / 27 Nanog ACTGTCTCTCCTCTTCCTTCCT AGAGTAAAGGCTGGGGTAGGTA 61 ° C / 30 Stat3 GTCTGGCTGGACAATATCAT TTGGGAATGTCAGGATAGAG 56 ° C / 30 ABCG2 TATGAGTGGCTTATCCTGCT CACTGATCCTTCCATCTTGT 56 ° C / 30 PTEN GGACGAACTGGTGTAATGAT CAGACCACAAACTGAGGATT 56 ° C / 30 beta -actin GGCATCCTCACCCTGAAGTA GGGGTGTTGAAGGTCTCAAA 55 ° C / 25

Expression analysis of cancer stem cell markers by flow cytometry in spear cells

Adherent cells and spear cells were cultured from HPAC cells and then treated with Accutase (Sigma-Aldrich, St. Louis, Mo.) to prepare the same number of single cell suspensions. Then, adherent cells and spear cells were stained with cancer stem cell marker antibodies and stained with FITC-CD44 (BD Biosciences PharMingen, San Diego, CA), PE-PROM2 (BD Biosciences PharMingen, San Diego, Calif.), PE- (BD Biosciences PharMingen, San Diego, Calif.), PE-CD130 (BD Biosciences PharMingen, San Diego, Calif.), PE-CD271 ), PE-CD133 (BD Biosciences PharMingen, San Diego, Calif.) And PE-CD117 (BD Biosciences PharMingen, San Diego, CA) were used as the respective marker antibodies. Flow cytometry was performed using BD LSR II (BD Biosciences, Franklin Lakes, NJ) and analyzed using BD FACSDiva software.

Suppression of spear formation by stem cell signaling drugs and new marker antibodies

(Sigma-Aldrich, Inc., St. Louis, Mo.), Cyclopamine-KAAD (Calbiochem, San Diego, Calif., USA) (Sigma-Aldrich, Inc., St. Louis, Mo.) and a new marker antibody SDCBP2 (santacruz biotechnology Inc, santacruz, CA) were added to the culture medium To cultivate spear cells. After 7 days, spear formation inhibition was confirmed.

HPAC Spear  Cell Darkening ability  Confirm

Adherent cells and spear cells cultured from human pancreatic cancer cell line HPAC were treated with 0.25% trypsin EDTA (Gibco BRL, Grand Island, NY) to produce the same number of single cell suspensions. The tumor formation ability between adherent cells and spear cells was then observed by in situ implantation directly into the pancreas of a NOD-SCID immunoregulatory mouse (Charles River, Japan).

cDNA Microarray  Candidates for new markers of pancreatic cancer stem cells

Total RNA was extracted according to manufacturer's instructions using RNAeasy Mini kit (QIAGEN, Valencia, Calif.). Total RNA was quantitated using ND-1000 nano drop spectrometer (NanoDrop Technologies, Inc., DE) and RNA 6000 nanochip (Agilent Technologies) was used by Agilent 2100 bioassay (Agilent Technologies, Santa Clare, CA) Respectively. The microarray experiment procedure was performed according to the manufacturer's protocol. CDNA microarray analysis was performed in Digital Genomics (Korea). Briefly, double-stranded cDNA was prepared using 6 쨉 g of each total RNA and amplified by biotin-labeling (IVT labeling kit; Affymetrix). The labeled cDNA was digested and hybridized to Affymetrix Gene Chip human genome U133 plus 2.0 high concentration oligonucleotide array (Affymatrix, Santa Clara, Calif.). The microarrays were then washed with Genechip Fluidics Station 450 (Affymetrix) and scanned using a Genechip array scanner 3000 7G (Affymetrix). Expression data was generated using the Affymetrix expression console software version 1.1, which standardized the MAS5 algorithm. The intensity data in the raw .cel file was standardized by the MAS5 algorithm to reduce noise. In more than 50% of samples in at least one sample group, the probe set was filtered out, not the precess call, by the MAS5 detection call. In order to determine the differentially expressed genes between the two groups, a pairwise t-test was performed on the MASS expression value and a gene with a difference of more than 1.5-fold was considered. All individual chip analyzes were performed twice for independent total RNA samples.

Spear  Expression Analysis of New Marker Candidate Gene in Cells

Total RNA of HPAC-adherent cells and spear cells was extracted using RNAeasy Mini kit (QIAGEN, Valencia, Calif.). 2 μg of each RNA extracted at 42 ° C for one hour was subjected to reverse transcription reaction through the reaction of Superscript II (Gibco BRL, Grand Island, NY). Expression of cancer stem cell related genes in spear cells was analyzed by PCR using primers and Taq polymerase of cancer stem cell genes, and expression of beta actin gene was used as a control. The primer sequence, PCR reaction temperature and cycle number of cancer stem cell-related genes are shown in Table 3 below.

gene Forward primer base sequence
(5'-3 ') Reverse primer sequence
(5'-3 ') Tm / cycle SDCBP2 GTGACTGTGCTGGGTGGAG TTGTCCTTCAGCCCGATAAC 55 ° C / 30 beta -actin GGCATCCTCACCCTGAAGTA GGGGTGTTGAAGGTCTCAAA 55 ° C / 25

Spear  In a cell Western Blot  Expression of Pancreatic Cancer Stem Cell-Related Proteins

To confirm the expression of proteins, adherent cells and spear cells of HPAC and Capan-1 were cultured to obtain cells. Cell membranes were removed using a dissolution buffer, and total proteins were collected and loaded on a 10% SDS-polyacrylamide gel in an amount of 25 μg by protein quantification, followed by electrophoresis. Proteins fractionated by size by electrophoresis were transferred to a PVDF membrane (Millipore corporation, Billerica, USA) and then washed with TBS-T (5%) to which 5% non-fat milk was added Tris-buffered saline / 0.05% Tween-20) for 1 hour. Each membrane was then reacted with the primary antibody overnight at 4 ° C. Rabbit polyclonal SDCBP2 (santa cruz biotechnology Inc, Santa Cruz, CA) was used as a primary antibody and mouse monoclonal GAPDH (Santa Cruz Biotechnology Inc, Santa Cruz, Calif.) Was used as a control. Each of the membranes reacted with the primary antibody was washed in TBS-T buffer and reacted with HRP (horseradish peroxidase) -conjugated secondary antibody (santa cruz biotechnology Inc, CA) for 1 hour. Each protein was detected using ECL (PIERCE, Rockford, IL).

Spear  In a cell Flow cell  Cancer stem cells through analysis Marker  Expression analysis

Adherent cells and spear cells were cultured from HPAC cells and then treated with Accutase (Sigma-Aldrich, St. Louis, Mo.) to prepare the same number of single cell suspensions. Adherent cells and spear cells were then primary stained with the cancer stem cell marker antibody SDCBP2 (Santa Cruz Biotechnology Inc, Santa Cruz, CA) and secondary stained with rabbit-PE (santa cruz). Flow cytometry was performed using BD LSR II (BD Biosciences, Franklin Lakes, NJ) and analyzed using BD FACSDiva software.

Colony formation  Analysis method

In a 12-well plate agar (agar noble; Difco) DMEM / Ham F12 (D / F12; Invitrogen Gibco ) containing 10% FBS to create a melt to solidify 0.6% base agar, 3X10 then the upper layer of 0.3% agar ³ The cells / well were filled and solidified. After the gel solidified, 1 ml of the medium was added, and the medium was changed twice a week. After incubation for 2 weeks, colonies were stained with 0.005% crystal violet and observed.

Gamma-irradiation

³ x 10 ^{3 per} well Cells were prepared and irradiated with 2, 4, and 6 Gy, respectively, using gamma-irradiation (Gammacell ELAN; MDS Nordion, Ottawa, Ontario (ON), Canada).

Expression of pancreatic cancer stem cell-related proteins by immunohistochemical staining

Pancreatic tissue slides were deparaffinized in xylene and rehydrated in graded alcohols. Endogenous peroxidase activity was blocked with 0.3% hydrogen peroxide in methanol solution at room temperature for 20 minutes. Microwave antigen searches were performed in citrate buffer (0.01 M, pH 6.0) for 4 minutes. The slides were then incubated with a 10% normal donkey serum solution for 1 hour to reduce non-specific background staining. The primary antibody diluted 1: 100 was rabbit polyclonal SDCBP2 (Santa Cruz Biotechnology Inc, Santa Cruz, CA). The blocked sections were incubated with the primary antibody overnight at < RTI ID = 0.0 > 4 C. < / RTI > Subsequent reactions were performed using the recommended procedure included in the Envision kit (DakoCytomation, Carpineteria, CA, USA). Finally, the slides were incubated with 3,3'-diaminobenzidine (DakoCytomation, Carpinteria, Calif., USA) and the modified Harris hematoxylin (Sigma-Aldrich, Inc., St. Louis, Mo.). Strength of the staining was evaluated as -, +, ++ and +++ corresponding to the presence of negative, weak, medium and strong brown staining, respectively.

From pancreatic cancer cell lines  Having the characteristics of cancer stem cells Spear  Isolation and Culture

All of the pancreatic cancer cell lines used in the experiment were purchased from ATCC (USA), and the cell lines were cultured in accordance with the protocol as described by ATCC. Pancreatic cancer cell lines were cultured in a 6-well ultra-low-affinity plate (100 μl / well) at a concentration of 1,000 cells / ml in a sphere culture medium (serum-free medium, 0.5% BSA, 1 × ITS, 10 ng / ml EGF, 10 ng / ml bFGF) Corning) and cultured for 7-10 days. Cells grown in the same culture medium as the adherent medium were used as a control. As a result of confirming the presence or absence of spear representing the characteristics of cancer stem cells, it was confirmed that spears were formed in the cell lines of HPAC, Capan-1 and Capan-2 among 8 kinds of pancreatic cancer cell lines. Among them, HPAC and Capan- And the subsequent experiments were carried out.

Spear  Expression of Cancer Stem Cell Related Gene in Cells

The activation of stem cell-related signaling systems such as Notch, Hedgehog and Wnt in spear cells was confirmed by RT-PCR compared with adherent pancreatic cancer cell lines. The expression of genes such as Oct4, Nanog, and Stat3, which are known to increase in early stage of stem cell differentiation, was also increased. In addition, the expression of markers of cancer stem cells such as ABCG2 and PTEN was also increased.

Spear  In a cell Flow cell  Cancer stem cells through analysis Markers  Expression analysis

Expression of CD44, PROM2, EphA2, CD130, and CD271 was increased in HPAC spleen cells by the expression of known cancer stem cell markers through flow cytometry (FIG. 3).

Inhibition of cancer stem cell formation by pancreatic cancer stem cell-associated marker antibody

The expression of genes such as Oct4, Nanog, and Stat3, which indicate the differentiation potential of stem cells, which is known to be activated early in the development of stem cell related signaling systems such as Notch, Hedgehog and Wnt, which are already well known in spear cells of pancreatic cancer cell lines (Fig. 2). Based on the results shown in FIG. 2, inhibitors blocking the stem cell signaling system such as Notch inhibitor-DAPT, Hedgehog inhibitor-KAAD, GSK3? Inhibitor-LiCl, Oct4 inhibitor-ATRA and Nanog inhibitor- (Fig. 4). As shown in Fig. Antibodies that do not contain sodium azide that can affect possible cells have been selected and tested. When HPAC spleen cells obtained from human pancreatic cancer cell line HPAC were inoculated into the pancreas of NOD / SCID mice to compare tumor formation ability, the group of transplantation of HPAC spleen cells having cancer stem cell characteristics compared to HPAC And the metastasis to the organs and tissues such as lungs and peritoneum were observed (Fig. 5).

Establishment of cancer stem cell gene database for identification of new cancer stem cell markers

To identify novel cancer stem cell markers in pancreatic cancer, Affymetrix HG-U133 plus 2.0 Gene (Fig. 1) was used to identify cancer stem cell markers on the basis of the expression of genes and markers associated with cancer stem cells chip microarray. MRNA was extracted from spear cells isolated from pancreatic cancer cell line and adherent cells as a control, microarray experiments were performed after cDNA synthesis, and genes showing common changes in two repeated experiments were selected first. Among these, genes that were increased more than 1.5 times in spear cells were selected. The purpose of this study was to select novel cancer stem cell markers for therapy, and to select cell surface markers related genes. SDCBP2 is likely to be one of the candidates that has increased more than 1.5 times.

Experimental results of novel markers of pancreatic cancer stem cell

RT - PCR Gene expression analysis

As a proof-of-concept test for pancreatic cancer stem cell markers, mRNA expression was first confirmed by RT-PCR. The expression of each gene was confirmed when the adherent cells were identified as control cells in the pancreatic cancer cell line HPAC and Capan-1 spear cells (HPAC-adherent cells: HA, HPAC spinal cells: HS, Capan-1 adherent cells: CA, Capan- : HS) SDCBP2 gene was increased in the spear cells compared to the adherent cells (Fig. 6).

Western Blot  Protein expression analysis

Adherent cells and spear cells derived from HPAC and Capan-1 were collected and the whole protein was extracted. The increase of SDCBP2 was confirmed by western blotting method, and it was confirmed that it was increased in spear cells compared to adherent cells (Fig. 7).

Indirect Flow cytometry  Cell surface expression analysis

In addition, this protein was also analyzed by indirect flow cytometry in order to confirm the increase in the spore cells compared to the adherent cells on the cell surface. Since there is no commercially available antibody for flow cytometry analysis, the expression of the protein on the cell surface was confirmed by reacting the primary antibody and then binding the secondary antibody conjugated with PE. When the adherent cells of the pancreatic cancer cell line HPAC were used as the control group, it was confirmed that SDCBP2 protein increased cell surface expression (5.1% adherent cells, 30.6% spear cells) in the spear cells (Fig. 8).

Inhibition of Cancer Stem Cell Forming Ability by Commercialized Antibodies

Based on the results of inhibition of cancer stem cell formation ability by pancreatic cancer stem cell-associated marker antibody, it was confirmed that the ability of spear formation was completely inhibited or decreased by SDCBP2 antibody treatment in order to confirm the ability of new marker to inhibit spear formation 9).

Isolation and Characterization of Cancer Stem Cells Using New Marker Antibodies

To determine the isolation of cancer stem cells, pancreatic cancer cell HPAC cells were stained indirectly with SDCBP2 antibody, a new marker for pancreatic cancer stem cell, and then classified by FACSaria II (Fig. 9). As can be seen from FIG. 9, cell separation by SDCBP2 antibody was confirmed, and colony formation assay was performed to investigate the difference in the characteristics of stem cells between the cells isolated by each marker, that is, anchorage dependent growth . When SDCBP2 expressing cells and non-expressing cells were cultured in semisolid support media in the same number, SDCBP2 expressing cells showed more colonies, and SDCBP2 expressing cells showed adhesion-dependent growth I have confirmed that I have more abilities.

Isolation and Characterization of Cancer Stem Cells Using New Marker Antibodies

In order to confirm the radiation resistance, one of the characteristics of cancer stem cells, the cells were separated by SDCBP2 antibody and irradiated with various doses (0, 2, 4, 6 Gy). As a result of performing colony formation assay on the same number of irradiated cells, the number of colonies decreased according to the dose of radiation, but the number of colony was larger than that of SDCBP2 expressing cells, (Fig. 11).

Cancer stem cell related in human pancreatic cancer tissue Markers  Expression analysis

In order to examine the expression of SDCBP2, a cancer stem cell-related protein in human pancreatic cancer tissue, TMA (tissue microarray) with a sample of 33 pancreatic cancer patients was prepared and immunohistochemistry was performed 12). In SDCBP2, a total of 33 observable TMA slides were expressed in cancer tissue of 87% (27 cases) of pancreatic cancer patients (Fig. 12-a). When observed on a whole slide in the human pancreas normal tissues, it is observed that the cells are not stained in relatively normal acinar or duct cells except for Langerhans islets (Fig. 12-b). Overall, SDCBP2 expression was observed in metaplastic ducts and pancreatic cancer tissues, while it was not expressed in normal pancreatic tissues, suggesting that these novel cell surface proteins are involved in the carcinogenesis of pancreatic cancer . In addition to the results of the in vitro tests such as the increase of new markers, spear formation inhibition, colony formation assay, and radiation resistance analysis in the sphere cells of FIGS. 6 to 12 as well as the expression changes in the human tissues, the SDCBP2 discovered in the present invention was associated with pancreatic cancer stem cell Indicating that it has the potential of a target antigen.

Review

Pancreatic cancer has a 5 - year survival rate of 7.6%, which represents a very poor prognosis. Recently, in the journals in which cancer stem cells are involved in the process of cancer, tumors are formed by cancer stem cells having stem cell characteristics such as self-renewal and differentiation, and these tumors have resistance to current anticancer drugs And it is reported that it causes tumor recurrence. Therefore, in order to identify target antigens of cancer stem cells of pancreatic cancer, a spermatogonial stem cell having the characteristics of cancer stem cells was cultured from a pancreatic cancer cell line to carry out cDNA array, and a list of genes related to pancreatic cancer stem cells was obtained . Among them, SDCBP2 related to pancreatic cancer was found to increase at the mRNA and protein level in the spleen cells having the characteristics of cancer stem cells. Also, SDCBP2-expressing cells showed resistance to radiation and stained in cancer cells compared with normal tissues in human cancer tissues .

Although SDCBP2 (syndecan binding protein 2) has been reported to involve the PDZ domain of SDCBP2 in cell survival and division (1-4), SDCBP2 is a unique protein that has not been reported in relation to cancer or cancer. As described above, SDCBP2 has not been discussed in terms of the ability of cancer cells in cancer of other organs as well as in pancreatic cancer. Based on the above results, it is concluded that the cells expressing the pancreatic cancer stem cell- , Suggesting the possibility of a therapeutic target for cancer stem cells.

references

1. The carboxy-terminal cysteine of the tetraspanin L6 antigen is required for its interaction with SITAC, a novel PDZ protein. Mol Biol Cell. 2000 Dec; 11 (12): 4217-25.

2. Nuclear speckles and nucleoli targeting by PIP2-PDZ domain interactions. EMBO J. 2005 Jul 20; 24 (14): 2556-65. Epub 2005 Jun 16.

3. Syndecan recycling [corrected] is controlled by syntenin-PIP2 interaction and Arf6. Dev Cell. 2005 Sep; 9 (3): 377-88. Erratum in: Dev Cell. 2005 Nov; 9 (5): 721.

4. The prevalence and significance of PDZ domain-phosphoinositide interactions. Biochim Biophys Acta. 2006 Aug; 1761 (8): 947-56. Epub 2006 Apr 27. Review.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION, Yonsei University <120> Novel Therapeutic Target and Bio-marker for Cancer          Based on Cancer Stem Cell Characteristics <130> PN120190 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 207 <212> PRT <213> SDCBP2 human protein <400> 1 Met Val Ala Pro Val Thr Gly Tyr Ser Leu Gly Val Arg Arg Ala Glu   1 5 10 15 Ile Lys Pro Gly Val Arg Glu Ile His Leu Cys Lys Asp Glu Arg Gly              20 25 30 Lys Thr Gly Leu Arg Leu Arg Lys Val Asp Gln Gly Leu Phe Val Gln          35 40 45 Leu Val Gln Ala Asn Thr Pro Ala Ser Leu Val Gly Leu Arg Phe Gly      50 55 60 Asp Gln Leu Leu Gln Ile Asp Gly Arg Asp Cys Ala Gly Trp Ser Ser  65 70 75 80 His Lys Ala His Gln Val Val Lys Lys Ala Ser Gly Asp Lys Ile Val                  85 90 95 Val Val Val Arg Asp Arg Pro Phe Gln Arg Thr Val Thr Met His Lys             100 105 110 Asp Ser Met Gly His Val Gly Phe Val Ile Lys Lys Gly Lys Ile Val         115 120 125 Ser Leu Val Lys Gly Ser Ser Ala Ala Arg Asn Gly Leu Leu Thr Asn     130 135 140 His Tyr Val Cys Glu Val Asp Gly Gln Asn Val Ile Gly Leu Lys Asp 145 150 155 160 Lys Lys Ile Met Glu Ile Leu Ala Thr Ala Gly Asn Val Val Thr Leu                 165 170 175 Thr Ile Ile Pro Ser Val Ile Tyr Glu His Met Val Lys Lys Leu Pro             180 185 190 Pro Val Leu Leu His His Thr Met Asp His Ser Ile Pro Asp Ala         195 200 205 <210> 2 <211> 1467 <212> DNA &Lt; 213 > SDCBP2 human nucleotide <220> <221> gene <222> (1). (1467) <220> <221> CDS <222> (365). (985) <400> 2 gctgagagac agggctacgt ttcagggagg gaaacagatt cagcagcggc agcagctgga 60 gaaggtcgtg gagcagcacc ttgcctgcag ggtgttctga gaatcagcca tgtcatccct 120 gtacccatct ctagaggacc taaaagtgga ccaagccatt caggcccagg tcagagcctc 180 acccaagatg ccagccctgc cagtccaggc aacagccatt tccccaccac cagttttgta 240 cccaaacttg gcagaactgg aaaattatat gggtctttcc ctctccagcc aagaagtcca 300 ggagagcctg cttcagattc cagagggtga cagtacagcg gtctcgggcc ccgggcccgg 360 ccag atg gtg gca ccg gta acc ggg tac agc ctg ggc gtg cgg cga 406            Met Val Ala Pro Val Thr Gly Tyr Ser Leu Gly Val Arg Arg              1 5 10 gct gag atc aag ccc ggg gtg cgc gag atc cac ctg tgc aag gac gag 454 Ala Glu Ile Lys Pro Gly Val Arg Glu Ile His Leu Cys Lys Asp Glu  15 20 25 30 cgc ggc aag acc ggg ctg agg ctg cgg aag gtc gac cag ggg ctc ttt 502 Arg Gly Lys Thr Gly Leu Arg Leu Arg Lys Val Asp Gln Gly Leu Phe                  35 40 45 gtg cag ttg gtc cag gcc aac acc cct gca tcc ctt gtg ggg ctg cgc 550 Val Gln Leu Val Gln Ala Asn Thr Pro Ala Ser Leu Val Gly Leu Arg              50 55 60 ttt ggg gac cag ctc ctg cag att gac ggg cgt gac tgt gct ggg tgg 598 Phe Gly Asp Gln Leu Leu Gln Ile Asp Gly Arg Asp Cys Ala Gly Trp          65 70 75 agc tcg cac aaa gcc cat cag gg gag aag 646 Ser Ser His Lys Ala His Gln Val Val Lys Lys Ala Ser Gly Asp Lys      80 85 90 att gtc gtg gtt cgg gac agg ccg ttc cag cgg act gtc acc atg 694 Ile Val Val Val Val Arg Asp Arg Pro Phe Gln Arg Thr Val Thr Met  95 100 105 110 cac aag gac agc atg ggc cac gtc ggc ttc gtg atc aag aag ggg aag 742 His Lys Asp Ser Met Gly His Val Gly Phe Val Ile Lys Lys Gly Lys                 115 120 125 att gtc tct ctg gtc aaa ggg agt tct gcg gcc cgc aac ggg ctc ctc 790 Ile Val Ser Leu Val Lys Gly Ser Ser Ala Ala Arg Asn Gly Leu Leu             130 135 140 acc aac cac tac gtg tgt gag gta gac ggg cag aat gtt atc ggg ctg 838 Thr Asn His Tyr Val Cys Glu Val Asp Gly Gln Asn Val Ile Gly Leu         145 150 155 aag gac aaa aag atc atg gag att ctg gcc acg gct ggg aac gtt gtc 886 Lys Asp Lys Lys Ile Met Glu Ile Leu Ala Thr Ala Gly Asn Val Val     160 165 170 acc ctg acc atc atc ccc agt gtg atc tac gag cac atg gtc aaa aag 934 Thr Leu Thr Ile Ile Pro Ser Val Ile Tyr Glu His Met Val Lys Lys 175 180 185 190 ttg cct cca gtc ctg ctc cac cac acc atg gac cac tcc atc cca gat 982 Leu Pro Pro Val Leu Leu His His Thr Met Asp His Ser Ile Pro Asp                 195 200 205 gcc tgaag ccactggagg gcagggcagg cagggggggc ttcccgccct cctgcagcaa 1040 Ala agggcaacca ccctcggatg atgggttgca gccggcctgc tgcttaaggt gggggctgcc 1100 atgagggggg cgtgtccagg agggtgacca tgggatggct tatacacaca ggcctccttg 1160 gagcctcaga ctccaagcta ggctgaggct caggcagggc ccacaggcag ccgattctct 1220 tgtgctgatt taaatgctgg acacggaggc aggctgttta aacgctgctt aaagtcgcaa 1280 ctgggcccct ttcaagaaat tttgctctac caggaaaaca gttacacatt ttaagagaac 1340 agagctacgt tctttgtgag agctttttcc ttgccttgac ttgctctttg tcacagactg 1400 cataagttgt cagccttgac tatcttttga ataaagattt gattttaaac aaaaaaaaaa 1460 aaaaaaa 1467

Claims (13)

delete delete A method for screening a substance for inhibiting pancreatic cancer stem cell formation comprising the steps of:
(a) contacting a cell or tissue comprising the polynucleotide of the first sequence or the polynucleotide of the second sequence of the sequence listing with a sample to be analyzed; And
(b) measuring the expression level of the protein or polynucleotide in the step (a), wherein when the sample decreases the expression of the protein or polynucleotide, the sample is a substance for inhibiting the formation of pancreatic cancer stem cells .
A method for screening a substance for inhibiting pancreatic cancer stem cell formation comprising the steps of:
(a) preparing a protein of the first sequence;
(b) contacting the test substance with the protein; And
(c) analyzing whether the test substance binds to the protein or whether the test substance inhibits the function of the protein; When the test substance binds to the protein or inhibits the function of the protein, it is judged to be a substance inhibiting the formation of pancreatic cancer stem cells.
4. The method of claim 3, wherein the protein is present on a cell surface, on a virus surface or in an isolated form.
delete 1. A kit for detecting pancreatic cancer stem cells comprising an antibody that specifically binds to a protein of the first sequence or a primer or probe that specifically binds to a polynucleotide of the second sequence of the sequence listing.
delete An antibody that specifically binds to the protein of the first sequence or a primer or probe that specifically binds to the polynucleotide of the second sequence.
10. The kit according to claim 7 or 9, wherein the kit is an immunoassay kit.
The kit according to claim 7 or 9, wherein the kit is a gene amplification or microarray kit.
A composition for inhibiting the formation of pancreatic cancer stem cells comprising an antibody specifically binding to the protein of the first sequence of the sequence listing or a nucleic acid molecule for suppressing the expression of the polynucleotide of the second sequence as an active ingredient.
A composition for inhibiting recurrence or metastasis of pancreatic cancer, comprising an antibody that specifically binds to the protein of the sequence listing sequence 1 or a nucleic acid molecule for suppressing the expression of the polynucleotide of the second sequence, as an active ingredient.

Images