KR101457983B1 - Method for Autosomal Analysing Human Subject of Analytes Using Multiplex Gene Amplification - Google Patents
Method for Autosomal Analysing Human Subject of Analytes Using Multiplex Gene Amplification Download PDFInfo
- Publication number
- KR101457983B1 KR101457983B1 KR20140058213A KR20140058213A KR101457983B1 KR 101457983 B1 KR101457983 B1 KR 101457983B1 KR 20140058213 A KR20140058213 A KR 20140058213A KR 20140058213 A KR20140058213 A KR 20140058213A KR 101457983 B1 KR101457983 B1 KR 101457983B1
- Authority
- KR
- South Korea
- Prior art keywords
- primer
- genetic locus
- seq
- complementarily
- final concentration
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Abstract
The present invention relates to a method of analyzing an autosome of a human subject, comprising the steps of: (a) obtaining a DNA sample to be analyzed; (b) Amelogenin, D5S818, TH01, D18S51, D3S1358, D7S820, D21S11, D6S1043, TPOX (human thyroid peroxidase gene), vWA (von Willebrand factor A), D16S539, CSF1PO -fms proto-oncogene for CSF-1 receptor gene), D8S1179, D13S317 and FGA (human fibrinogen alpha chain) genetic loci; And (c) determining an allelic genotype of the genetic locus using the multiplex amplification product of step (b), and identifying the human object as a gene. According to the present invention, sensitivity is superior to conventional Identifiler and PowerPlex16, and degeneracy is applied to the primer design so that amplification occurs at mutated binding sites.
Description
The present invention relates to a method for analyzing an autosomal chromosome of a human subject to be analyzed using multiplex gene amplification.
Since the early 1990s, the Amp-FLP (Amplification Fragment Length Polymorphism) typing method using PCR (Polymerase Chain Reaction) has been in full use since the early 1990s. The same applies to typing (forensic typing) or DNA database construction.
On the other hand, a multiplex PCR system is one in which a primer of several loci is inserted into a single PCR reaction and an experimental reaction is performed in a single tube. When a multiplex PCR system is used, taq Polymerase (PCR reaction enzyme) and other reagents, as well as minimizing the operation of the genotype capillary automatic analyzer, thereby reducing the cost. Gene detection has the advantage of being able to save considerably on budget considering that expensive commercial reagents are consumed. In this way, researches have been actively conducted to establish a multiplex PCR system suitable for the local reality in advanced countries such as the United Kingdom and the United States leading to gene identification due to the utility value of the multiplex PCR system.
Based on the commercially available triplex PCR kit (I, II) commercially available from Promega Corporation (Madison, Wi, USA), research and development centered on triplex PCR systems have been actively conducted in the early days (Kimpton et al., 1993 Urquhart et al., 1994). However, the development of the Quadruplex system (Sprecher et al., 1996; Lins et al., 1996; Robertson JM et al., 1995), which simultaneously analyzes four genetic loci, (Kimpton et al., 1996; Yest et al., 1997) have also been performed. Recently, Promega has been used as a promega in the form of D3S1358, D1S1656, D2S441, D10S1248, D13S317, Penta E, D16S539, D18S51, D2S1338, CSF1PO, Penta D, TH01, vWA, D21S11, D7S820, D5S818, TPOX, D8S1179, D12S391, D19S433, FGA, Simultaneous amplification and four-color detection of 24 genetic loci including DYS391 and Amelogenin were developed (PowerPlex Fusion System, Promega).
The continued development of such a multiplex PCR system has been a milestone in spurring the establishment and operation of the DNA database. As of August 2012, we have developed a DNA database There are 36 countries in Europe, including UK, USA, Germany, China, Singapore, Austria, Netherlands, Canada, Finland, Norway, Sweden, Denmark, Spain, Switzerland and Belgium. . In the preceding example, the UK has more than 6,700,000 data as of March 2013 since the entry of the subjects since 1995, and the case of finding the perpetrator through this database has resulted in an average of more than 300 perpetrators It is reaping. In the United States, the database that has been conducted in each state in the past has been used to build and integrate a national DNA database of all federal states using CODIS (Combined DNA Index System) administered by the Federal Bureau of Investigation (FBI) And it is said to be operated very efficiently. Other Netherlands In 1996, Austria, Germany In 1997 or early 1998, it started to enter the subjects and it is known that the current input is active and has a considerable effect.
However, since all the countries in which the DNA database is currently being run are white people, the genetic loci selected by these countries are made up of similar systems with many overlapping countries. To this system, a multinational corporation such as Applied Biosystems (AB, Applied Biosystems, Foster City, Ca, USA) or Promega has developed and commercialized a method of identifying the genetic loci used by these countries for these databases Many countries are already using it.
The somatic chromosome STR amplification method widely used in Korea is also a commercial kit manufactured and sold by a foreign company. This is because the STR markers developed in the US and UK, which led to the development of STR analysis method by PCR in the late 1990s, were acquired by the companies in the respective countries and commercialized as kits. In particular, as the criminal DNA database became globally universal, it was recommended that all countries use common STR markers for the exchange of DNA information between countries, so that later generations will use commercial kits that include a broad range of STR markers .
In addition, the above-mentioned commercialization kit has a merit that it is convenient, but it has a disadvantage that it relies on foreign company's technology. In fact, the companies that produce these kits are, as we have seen, Applied Biosystems and Promega, which are a major company, with over 10 commercial kits being produced and sold. The kits for these two companies, which have dominated the global market, are very expensive and represent a large part of the costs of gene detection.
Also, by constructing a DNA identification information system using these foreign kits, the technology will be dependent on foreign companies. If the kits become out of print, if there is an error in the supply, or if the kits are greatly increased in price There is no way to do so, and thus all the data entered in the meantime can be in danger of being useless. Therefore, it is very meaningful to make a self-development kit that can replace or supplement it. Even if international circumstances change, DNA identity verification information systems must continue to operate. If large quantities of samples need to be processed annually, such as a criminal DNA database, the ability to replace commercial kits with their own kits will contribute to the national economy, given that the database is a permanent system. In particular, in the case of identifying genotypes of a large number of type determinants (20,000 persons per year when operating a domestic DNA database) within a given time in the DNA database of Korea, a lot of effort and expense is required to analyze each STR genetic loci And the multiplex PCR method.
Domestic patents related to this technology include Korean Patent No. 10-1008828 entitled " Multiplex Gene Amplification System Including 16 Short Repeating Unit Genetic Locations and Gender Chromosomal Genetic Locations Having Differentiating Power in a Korean Population " Patent No. 10-0277289 entitled " Quadruplex PCA system composed of Esterella loci having discriminatory power in Korean group and gene detection method using the same ", and registered patent No. 10-1198096 (The name of the invention: a specific primer for identification or paternity identification and its use), and US Patent Application Publication No. US2002 / 0309637 (Multiplex amplification of STR loci), EP1135530 short tandem repeat loci) and US 6221598 (multiplex amplification of short tandem repeat loci).
As mentioned above, the present invention is designed to localize a gene expression kit to solve problems due to high dependence on a conventional foreign gene detection method.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.
The inventors of the present invention have developed an autosomal genetic analysis of a human subject with high accuracy and sensitivity that can simultaneously or in parallel with the Identifiler system used as a reference input system of a DNA database We tried to develop the method. As a result, the amelogenin, D5S818, TH01, D18S51, D3S1358, D7S820, D21S11, D6S1043, TPOX (Human thyroid peroxidase gene), vWA (von Willebrand factor A), D16S539, CSF1PO (Human c-fms proto-oncogene for CSF-1 receptor gene), D8S1179, D13S317 and FGA (human fibrinogen alpha chain) genetic loci, The present inventors have completed the present invention by confirming that the conventional foreign gene detection method is localized and have excellent sensitivity.
Accordingly, an object of the present invention is to provide a method for analyzing an autosomal gene of a human object.
Another object of the present invention is to provide a multiplex gene amplification kit for autosomal analysis.
Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.
According to one aspect of the present invention, the present invention provides a method for analyzing an autosomal analysis of a human subject to be analyzed using multiplex gene amplification comprising the steps of:
(a) obtaining a DNA sample to be analyzed;
(b) Amelogenin, D5S818, TH01, D18S51, D3S1358, D7S820, D21S11, D6S1043, TPOX (human thyroid peroxidase gene), vWA (von Willebrand factor A), D16S539, CSF1PO -fms proto-oncogene for CSF-1 receptor gene), D8S1179, D13S317 and FGA (human fibrinogen alpha chain) genetic loci; And
(c) determining an allelic genotype of the genetic locus using the multiplex amplification product of step (b), and identifying the human subject as a gene.
The present inventors have sought to develop a gene identification method of a human subject which is highly accurate and sensitive enough to be able to replace or replace the Identifiler system currently used as a reference input system of a DNA database. As a result, the amelogenin, D5S818, TH01, D18S51, D3S1358, D7S820, D21S11, D6S1043, TPOX (Human thyroid peroxidase gene), vWA (von Willebrand factor A), D16S539, CSF1PO (Human c-fms proto-oncogene for CSF-1 receptor gene), D8S1179, D13S317 and FGA (human fibrinogen alpha chain) genetic loci, It was confirmed that the conventional foreign gene detection method was localized and had excellent sensitivity.
The gene detection method of the present invention will be described step by step in detail.
Step (a): DNA Obtaining samples
The present invention obtains a DNA sample to be analyzed.
According to one embodiment of the present invention, the DNA sample is obtained from a tissue selected from the group consisting of blood, semen, vaginal cells, hair, saliva, urine, oral cells, placental cells or amniotic fluid including fetal cells, It is a separated DNA sample.
The DNA sample can be obtained through a conventional method known in the art. According to one embodiment of the present invention, the tissue is treated with a DNA lysis buffer (e.g., tris-HCl, EDTA, EGTA, SDS, deoxycholate, and tritonX and / To isolate the DNA.
According to one embodiment of the present invention, the DNA sample is a biological sample containing DNA.
The biological sample is a biological sample selected from the group consisting of blood, semen, vaginal cells, hair, saliva, urine, oral cells, placental cells or amniotic fluid including fetal cells, and mixtures thereof, but is not limited thereto.
In the present invention, direct PCR (Direct Polymerase Chain Reaction) involving nucleic acid molecules can be performed using the biological sample directly (see Korean Patent No. 10-0746372).
Step (b): Multiplex amplification step
Next, amelogenin, D5S818, TH01, D18S51, D511558, D7S820, D21111, D611043, TPOX, D7S82 thyroid2peroxidase gene, vW8, von Willebrand2factor 8), D16S539, CSF1PO, D7S82c-f7s2proto-oncogene2for CSF -1 receptor gene, D8S1 D9, D151, D511558, D7S820, D21111, D611043, T21111 and D61104.
The term " amplification " as described herein refers to a reaction that amplifies a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT- (Sambrook et al., Molecular Cloning . A Laboratory Manual , 3rd ed. Methods of ligase chain reaction (LCR) (17, 18), Gap-HI (
PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (differential display PCR), rapid amplification of cDNA ends (RACE), PCR (PCR, Inverse polymerase chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR) and PCR (PCR) were developed for specific applications. For more information on PCR, see McPherson, MJ, And Moller, SG PCR , BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.
The multiplex amplification is a multiplex PCR (Polymerase Chain Reaction) amplification. According to one embodiment of the present invention, the multiplex PCR amplification has an annealing temperature condition of 57-61 ° C. According to another embodiment of the present invention, the multiplex PCR amplification is performed at a temperature of 58-60 ° C Temperature conditions, and according to a particular embodiment of the present invention, the multiplex PCR amplification has an annealing temperature condition of 58.5-59.5 [deg.] C.
The multiplex PCR amplification requires a reasonable number of cycles to perform PCR. According to one embodiment of the invention, the multiplex PCR amplification is performed in 27-29 cycles. When the multiplex PCR amplification of the present invention was carried out in 26 cycles or less, peaks of 500 RFU or less were formed and peaks of 2,000 RFU or more were formed in 30 cycles, but noise was increased and incomplete A insertion occurred.
The present invention relates to primers that complementarily bind to amelogenin, D5S818, TH01, D18S51, D3S1358, D7S820, D21S11, D6S1043, TPOX, vWA, D16S539, CSF1PO, D8S1179, D13S317 and FGA genetic loci of the DNA samples Multiplex amplification is carried out.
According to one embodiment of the present invention, the primer which binds complementarily to the amelogenin gene locus of step (b) of the present invention is the sequence of SEQ ID NOS: 1 and 2; The primers complementarily binding to the D5S818 genetic locus are SEQ ID NOS: 3 and 4; The primer that binds complementarily to the TH01 genetic locus is the sequence of SEQ ID NO: 5 and SEQ ID NO: 6; The primers complementarily binding to the D18S51 genetic locus are SEQ ID NOS: 7 and 8; Wherein the primers complementarily binding to the D3S1358 genetic locus are SEQ ID NOS: 9 and 10; The primers complementarily binding to the D7S820 genetic locus are those of Sequence Listing 11 and 12; The primers complementarily binding to the D21S11 genetic locus are SEQ ID NO: 13 and SEQ ID NO: 14; The primers complementarily binding to the D6S1043 genetic locus are those of Sequence Listing 15 and 16; Wherein the primer that binds complementarily to the TPOX genetic locus is SEQ ID NO: 17 and SEQ ID NO: 18; The primers complementarily binding to the vWA genetic locus are SEQ ID NOS: 19 and 20; Wherein the primers complementarily binding to the D16S539 genetic locus are SEQ ID NOS: 21 and 22, the primers complementarily binding to the CSF1 PO genomic locus are SEQ ID NOS 23 and 24; The primers complementarily binding to the D8S1179 genetic locus are those of Sequence Listing 25 and Sequence 26; Wherein the primers complementarily binding to the D13S317 genetic locus are SEQ ID NOS 27 and 28; The primers that complementarily bind to the FGA gene locus are Sequence Listing Nos. 29 and 30. According to another embodiment of the present invention, a primer selected from the group consisting of SEQ ID NOS: 1 to 30 is labeled with a fluorescent dye. According to a particular embodiment of the present invention, a primer selected from the group consisting of the first to eighth sequences of the sequence listing is labeled with a first fluorescent dye and is selected from the group consisting of SEQ ID NOS: 9 to 16 Wherein the primer selected from the group consisting of SEQ ID NOS: 17 to 24 is labeled with a third fluorescent dye, and the primer selected from the group consisting of SEQ ID NOS: 25 to 30 Is labeled with a fourth fluorescent dye.
In the primer used in the gene detection method of the present invention, a fluorescent dye is labeled at the 5 'end of one primer of a pair of primers complementarily binding to the genetic locus. The first to fourth fluorescent dyes are labels for constituting three to four genetic loci in a lane so that they can be detected through capillary electrophoresis.
The primer applied degeneracy to the primer design so that even in the case of mutation of the base sequence of the primer, the amplification occurs at the mutated binding site. The amplification product of the multiplex PCR using the primer of the present invention has a size of 70-350 bp, which is advantageous for amplification of a very small amount of template or degraded sample, thereby contributing to improvement of detection sensitivity.
The primer used in the gene detection method of the present invention has an optimal blending ratio for adjusting the peak balance.
According to one embodiment of the present invention, the primer complementarily binding to the amelogenin gene locus has a final concentration of 0.01-0.50 μM, and the primer that binds complementarily to the D5S818 genetic locus is 0.1-0.5 μM final The primer complementarily binding to the TH01 genetic locus has a final concentration of 0.1-0.4 μM and the primer complementarily binding to the D18S51 genetic locus has a final concentration of 0.2-1.5 μM, The primers complementarily binding to the D3S1358 genetic locus have a final concentration of 0.1-0.5 [mu] M, the primers complementarily binding to the D7S820 genetic locus have a final concentration of 0.1-0.7 [mu] M, and the D21S11 genetic locus Complementarily binding primers have a final concentration of 0.3-1.1 [mu] M; The primer that binds complementarily to the D6S1043 genetic locus has a final concentration of 0.2-0.9 [mu] M; The primer that binds complementarily to the TPOX genetic locus has a final concentration of 0.03-0.35 [mu] M; The primer that binds complementarily to the vWA genetic locus has a final concentration of 0.3-1.2 [mu] M; The primer that binds complementarily to the D16S539 genetic locus has a final concentration of 0.1-0.5 [mu] M; The primer that binds complementarily to the CSF1PO genetic locus has a final concentration of 0.4-1.1 [mu] M; The primer that binds complementarily to the D8S1179 genetic locus has a final concentration of 0.2-0.8 [mu] M; The primer that binds complementarily to the D13S317 genetic locus has a final concentration of 0.1-0.6 [mu] M; The primer that binds complementarily to the FGA gene locus has a final concentration of 0.3-1.1 [mu] M. According to another embodiment of the present invention, the primer complementarily binding to the Amelozenein gene locus has a final concentration of 0.05-0.35 [mu] M, and the primer that binds complementarily to the D5S818 genetic locus is a final of 0.13-0.30 [mu] M Primer complementarily binding to the TH01 genetic locus has a final concentration of 0.13-0.30 [mu] M, the primer complementarily binding to the D18S51 genetic locus has a final concentration of 0.3-1.0 [mu] M, The primers complementarily binding to the D3S1358 genetic locus have a final concentration of 0.1-0.4 [mu] M, the primers complementarily binding to the D7S820 genetic locus have a final concentration of 0.1-0.5 [mu] M, and the D21S11 genetic locus Complementarily binding primers have a final concentration of 0.3-0.8 [mu] M; The primer that binds complementarily to the D6S1043 genetic locus has a final concentration of 0.2-0.7 [mu] M; The primer that binds complementarily to the TPOX genetic locus has a final concentration of 0.03-0.25 [mu] M; The primer that binds complementarily to the vWA genetic locus has a final concentration of 0.3-0.7 [mu] M; The primer that binds complementarily to the D16S539 genetic locus has a final concentration of 0.1-0.4 [mu] M; The primer that binds complementarily to the CSF1PO genetic locus has a final concentration of 0.4-0.7 [mu] M; The primer that binds complementarily to the D8S1179 genetic locus has a final concentration of 0.2-0.6 [mu] M; The primer that binds complementarily to the D13S317 genetic locus has a final concentration of 0.1-0.5 [mu] M; The primer that binds complementarily to the FGA gene locus has a final concentration of 0.3-0.8 [mu] M. According to a particular embodiment of the invention, the primer which binds complementarily to the amelogenin gene locus has a final concentration of 0.05-0.15 [mu] M, and the primer which binds complementarily to the D5S818 genetic locus is the final of 0.15-0.23 [mu] M Primer complementarily binding to the TH01 genetic locus has a final concentration of 0.15-0.25 μM and the primer complementarily binding to the D18S51 genetic locus has a final concentration of 0.4-0.5 μM, The primers complementarily binding to the D3S1358 genetic locus had a final concentration of 0.15-0.25 [mu] M, the primers complementarily binding to the D7S820 genetic locus had a final concentration of 0.22-0.35 [mu] M, Complementarily binding primers have a final concentration of 0.4-0.5 [mu] M; The primer that binds complementarily to the D6S1043 genetic locus has a final concentration of 0.3-0.4 [mu] M; The primer that binds complementarily to the TPOX genetic locus has a final concentration of 0.07-0.20 [mu] M; The primer that binds complementarily to the vWA genetic locus has a final concentration of 0.4-0.5 [mu] M; The primer that binds complementarily to the D16S539 genetic locus has a final concentration of 0.1-0.3 [mu] M; The primer that binds complementarily to the CSF1PO genetic locus has a final concentration of 0.4-0.6 [mu] M; The primer that binds complementarily to the D8S1179 genetic locus has a final concentration of 0.25-0.40 [mu] M; The primer that binds complementarily to the D13S317 genetic locus has a final concentration of 0.2-0.3 [mu] M; The primer that binds complementarily to the FGA gene locus has a final concentration of 0.4-0.6 [mu] M.
The amelogenin gene locus is a genetic locus on a sex chromosome used to identify human sex. Amelogenin locus is identified as HUMAMELX when identifying the locus on the Y chromosome present in the male DNA, and as HUMAMELX when identifying the locus on the X chromosome present in the female DNA.
Step (c): The step of gene detection
Next, the allele genotype of the genetic locus is determined using the multiplex amplification product of step (b), and the human gene is identified as a gene.
According to one embodiment of the present invention, the size of the amplified allele in the multiplex amplification product is compared / evaluated with a size standard, and the size standard is a DNA marker or a genetic locus-specific It is an allele ladder.
Since the size standard of the present invention is composed of fragments having various repetition times of STR (Short Tandem Repeat), it is used to evaluate correct alleles by analyzing the exact size and sequence of the multiplex amplification product. The ladder can be obtained through conventional methods known in the art. For example, a method of producing a genetic locus-specific allelic ladder by amplifying gDNA (genome DNA) of various alleles of each genetic locus, mixing / diluting the genomic DNA at an appropriate blending ratio according to the result of amplification, A direct synthesis method, and a method of synthesizing two or three fragments to prepare a full length amplification product, but the present invention is not limited thereto.
As used herein, the term ' STR ' refers to a tandem repeat sequence that is known to be widely distributed within an intron that does not contain genetic information such as a trait in the human genome, ), Which has been widely used worldwide. Many genetic loci in the human genome contain the STR region of the polymorphism. The STR locus consists of a short repeat sequence element, 2 to 7 base pairs in length, which is estimated to have 2 million trimer and tetramer STRs once every 15 kb in the human genome. As the number of short repeating units in a particular locus changes, the DNA length at that locus will vary with each allele and each individual. STR loci can be amplified by Polymerase Chain Reaction (PCR) using specific primer sequences identified on the side of this repeated sequence. The multiplex amplification products of the invention have a 10-20 bp interval. As shown in FIG. 1, the present invention constructs a genetic locus to maintain a 10-20 bp interval considering the rare gene distribution of Koreans.
These alleles of the genetic loci are classified according to the number of copies of the repeated sequences contained in the amplified region. After separation by electrophoresis, suitable detection methods such as radioactive, fluorescent, silver stain and color .
The multiplex amplification product of the present invention has a size of 70-350 bp. Small amplification products can be advantageous for amplification of very small template or degraded samples, resulting in improved detection sensitivity.
This is done using electrophoresis to separate the amplified allele in the multiplex amplification product of the present invention.
Electrophoresis relates to the flow of particles under the influence of the same spatially distributed electric field (Lyklema, J. (1995). Fundamentals of Interface and Colloid Science, vol. (1974), Electrokinetic Phenomena, J. Willey and Sons, Russell, WB, Saville and WR Schowalter (1989), Colloidal Dispersions, Cambridge University Press, Kruyt , HR (1952), Colloid Science, Volu El1, Irreversible systems, Elsevier and Dukhin, AS, PJ Goetz (2002), Ultrasound for characterizing colloids. The types of electrophoresis include, but are not limited to affinity electrophoresis, capillary electrophoresis, and gel electrophoresis.
According to one embodiment of the present invention, capillary electrophoresis is used to isolate the amplified allele in the multiplex amplification product of the present invention. In the capillary electrophoresis, an electric field is applied to the charged ions, and each of the ions moves to the electrode having the opposite charge. The movement speed depends on the average charge, size, shape, and properties of the solvent. Capillary electrophoresis is a technique that utilizes the property that when ions are applied to both ends of a tube in a state where ions are present through a thin tube, the ions move in the tube with different orientations at different rates according to their properties. It is a device to separate.
The gene detection method of the present invention has the use of forensic typing or identification.
In accordance with another aspect of the present invention, there is provided a method for the treatment of amelogenin, D5S818, TH01, D18S51, D3S1358, D7S820, D21S11, D6S1043, TPOX (human thyroid peroxidase gene), vWA (von Willebrand factor A) Multiplexed gene amplification for autosomal analysis comprising respective primers complementarily binding to the genomic locus of human fibrinogen alpha chain (FGA), D8S1179, D13S317 and CSF1PO (human c-fms proto-oncogene for CSF-1 receptor gene) Provide a kit.
Since the kit of the present invention uses an autosomal analysis method of a human subject to be analyzed using the multiplex gene amplification, the contents common to both of them are used in order to avoid the excessive complexity of the present invention. It is omitted.
The features and advantages of the present invention are summarized as follows:
(a) The present invention provides an autosomal analysis method of a human subject to be analyzed using multiplex gene amplification.
(b) The present invention provides better sensitivity than conventional Identifiler and PowerPlex16.
(c) The present invention applies degeneracy to the primer design so that amplification occurs at mutated binding sites.
Figure 1 shows the placement of each genetic locus.
Figure 2 shows optimal PCR conditions using GoldST * R buffer and AmpliTaq Gold DNA polymerase.
Figure 3 shows an electrophorogram obtained by amplifying standard DNA with Kplex-15 primer v. 1.0, GoldST * R buffer and AmpliTaq Gold DNA polymerase.
Figure 4 shows the noise difference before and after purification of the Kplex-15 primer.
Figure 5 shows the nonspecific peak of D6S1043.
FIG. 6 shows the results of amplifying 9947a DNA with Kplex-15 primer on the upper panel before purification and on the lower panel after purification.
Fig. 7 shows the results of comparing the pre-purification results after correcting the concentration of the primers using standard DNA.
Figure 8 shows the results of the change in annealing temperature in terms of electrophoretic graphs.
FIG. 9 shows the results of the change in the number of PCR cycles as an electrophoretic graph.
FIG. 10 shows the result of performing PCR by increasing the concentration of template DNA in 24 cycles in order to increase the sensitivity.
Fig. 11 shows the result of performing PCR by lowering the concentration of template DNA in 32 cycles.
Fig. 12 shows the results of the change in the amount of enzyme used as an electrophoretic graph.
Figure 13 shows the optimal conditions for performing PCR with HotSTAR buffer and Hot Taq DNA polymerase using Kplex-15 primer v.1.1.
Fig. 14 shows an electrophorogram obtained by PCR using the standard DNA 9947a as a template with HotSTAR buffer and Hot Taq DNA polymerase using Kplex-15 primer v.1.1.
Figure 15 compares the sensitivity of Kplex-15, Identifiler Plus and GlobalFiler to template DNA.
Figure 16 shows the inhibition of PCR reactions on concentrations of humic acid (0, 50, 100, and 150 ng / mu l).
Figure 17 shows the Kplex-15 allele ladder.
Figure 18 shows the difference in binning according to each allele gene call range.
Fig. 19 shows the moving distance average and deviation of two ladders and 34 samples.
Figure 20 shows a Kplex-15 panel and a Bin set.
Figure 21 shows the effect of variation of the primer binding site on test results.
FIG. 22 shows electrophoresis of a sample showing coincidence between Identifiler and Kplex-15 and a sample showing discrepancy in D7S820.
FIG. 23 shows the A → C displacement (upper panel) of the R342 genetic locus of the mismatch sample of FIG. 22 and the normal sequence of the coincident sample.
FIGS. 24A and 24B show the results of Identifiler and Kplex-15 electrophoresis of discordant samples, showing the A insertion mutation at the F183m end of each amplification product.
25 shows a sequencing result of the cloning of the inconsistent sample, wherein the upper panel shows the normal sequence and the lower panel shows the sequence in which the A insertion mutation occurred.
Figure 26 shows the variation found at the R344 primer site of D7S820.
Figure 27 shows the results of a reanalysis with Kplex-15 primer v.3.0 changed to 820-F183m1 / D7S820-R344.
Figure 28 shows an example of the discrepancy results between Identifiler and Kplex-15 at the TH01 genetic locus.
Figure 29 shows the optimal conditions for the Kplex-15 direct PCR experiment.
30A and 30B show direct PCR results of dry FTA discs of blood and saliva.
Figures 31 (a) and 31 (b) show the results of a direct PCR (Figure 31a) for direct PCR and a direct PCR (Figure 31b) of blood, saliva, hair and cigarette butts.
32 shows an example of the result of discrepancy between Identifiler and Kplex-15 in D21S11.
Figure 33 shows the 3 peaks of Kplex-15 in D7S820.
Figs. 34A and 34B show examples showing the result of discrepancy between Identifiler and Kplex-15 at the D3S1358 (Fig. 34A) and TH01 (Fig. 34B)
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .
Example
Research content and results
end. Primer design
The prototype of the kit to be developed in the present invention is Kplex-14, which was developed for use in identification or paternity testing. However, in order to use a DNA database in parallel with or in place of the Identifiler kit, differences in primer binding sites between two kits and PCR conditions And the difference in sensitivity and accuracy due to differences in the test results.
In addition, it is necessary to solve the allele genotyping problem of TH01 genetic loci in the analysis of the 3730 Genetic Analyzer, and the size of the amplification product based on the nucleotide sequence and the size deviation caused in the development of the capillary electrophoresis phase And the minimum appropriate distance between the genetic loci is narrowed.
Localization kits for replacing or performing field samples and database sample analysis using Identifiler should be able to analyze at least 13 CODIS core loci simultaneously. In addition, each genetic locus should be kept at 13 bp intervals considering the rare genetic distribution of Koreans, and the primer should be designed so that amplification product is generated within 70 - 350 bp to achieve sensitivity to obtain complete DNA profile from 100 pg template DNA Respectively. In addition, as shown in FIG. 1, 13 loci of the CODIS core genome and D6S1043 loci are included in addition to Amelogenin. D6S1043 is located on
This multiplex PCR system was designated as "Kplex-15 HID PCR Kit", and prototypes such as PCR conditions were developed to be validated.
For the purpose of designing the primer to achieve the above purpose, the nucleotide sequence information of each genetic locus is referred to as STRBase ( http://www.cstl.nist.gov/strbase/ ) and GenBank ( http://www.ncbi.nlm .nih.gov / genbank / ).
After obtaining information on all genetic loci, primers corresponding to flanking regions were designed to amplify STR repeats using Primer3 (v.0.4.0). At this time, the primers should be amplified simultaneously under the same temperature condition, so that the Tm of the primers was limited to be similar, and the amplification products were smaller than those of Identifiler and
The CODIS core gene locus amplification product of Kplex-15 was at least 2 bp up to 208 bp smaller than that of the other two kits. The small amplification product can be advantageous for the amplification of very small template or degraded samples, which will contribute to the improvement of detection sensitivity of Kplex-15.
I. Selection of optimal primer combination for multiplex configuration
In order to investigate the amplification efficiency and non - specific reaction of the prepared primers, monoflex PCR was performed to select the primers exhibiting the maximum amplification efficiency with minimized nonspecific reaction. 1 μl of template DNA, 1 μl of 10 × GoldST * R buffer (Promega, USA), the final concentration of 0.4 μM, and 0.5 μl of AmpliTaq Gold DNA polymerase (Applied Biosystems, USA) . As the template DNA, 9947A or 2800M standard DNA was mainly used and arbitrary DNA was also used when necessary. PCR amplification was performed at 94 ° C for 20 seconds, 59 ° C for 90 seconds, 72 ° C for 60 seconds, and 28 ° C for 45 minutes at 95 ° C for 11 minutes. The amplified product was confirmed by EtBr staining after polyacrylamide gel electrophoresis.
Among the primers selected in Monoflex PCR, mini - multiplex PCR was performed by binding primers to each lane in order to confirm amplification interference between primers entering the same fluorescent lane. At this time, the whole PCR reaction and confirmation of amplification products were the same as monoflex PCR, and 1.5 U of AmpliTaq Gold DNA polymerase was used.
The primers were prepared by assigning fluorescence to each lane according to the amplification intensity obtained from the above experiment, as shown in Table 1. In order to confirm interference between the genetic loci or fluorescent lanes due to fluorescence coupling, primers between lanes Multiplex PCR was carried out by combining the PCR products in the order of 1-4. At this time, the total PCR reaction was changed to 25 μl, and the concentrations of other components and the PCR cycle conditions were the same. AmpliTaq Gold DNA polymerase was used up to 3.5 U according to the number of lanes. The amplification product was electrophoresed with a 310 or 3130 Genetic Analyzer (Applied Biosystems) and analyzed with GeneMapperID v.3.2 to determine the size of the amplification product. If there is a problem with non-specific products or amplification efficiency due to interference, And the optimal combination experiment was repeated.
The final conditions of the multiplex PCR using GoldST * R buffer and AmpliTaq Gold DNA polymerase were set as shown in FIG.
In order to balance the peak height between each locus under the above conditions, the final concentration was determined by repeated experiments while adjusting the concentration of the primers in various samples including standard DNA. At this time, the maximum concentration of the primer was set to not exceed 1.0 μM to minimize the stochastic effect due to the difference in concentration between the primers.
The sequence and concentration of the primer (Kplex-15 primer v.1.0) initially used for the PCR conditions of Kplex-15 were as follows:
By the above conditions, it was confirmed that allele genes were correctly amplified (Fig. 3) without a noise phenomenon due to peak balance and interference in a multiplex PCR that finally includes all four fluorescent lanes.
All. Localization of reagents
Prior to the validation of the bulk samples, the products manufactured and manufactured domestically in order to localize GoldST * R buffer and AmpliTaq Gold DNA polymerase were obtained and compared. Among them, HotSTAR buffer (BioQuest, Korea) and Hot Taq DNA polymerase (BioQuest, Korea) showed the same level of amplification efficiency, specificity and sensitivity as those of comparative samples, and the following conditions were optimized and validated Result omitted). As a reference, Hot Taq DNA Polymerase (BioQuest, Korea) is a hot start enzyme in which the Pyridoxal Modifier is bound to the active lysine of the enzyme. AmpliTaq Gold DNA Polymerase While Hot Taq DNA Polymerase is restored to activity at 95 ℃ for 15 min. Thus, under the conditions using Hot Taq DNA polymerase, PCR amplification was performed at 94 ° C for 20 seconds, 59 ° C for 90 seconds, 72 ° C for 60 seconds, 28 times at 95 ° C for 15 minutes, and final reaction at 60 ° C for 45 minutes
la. Primer refine
Fluorescent / non-fluorescent primers used in this study are manufactured by commissioning synthesis. Primers are frequently changed through optimizing processes, and individual tablets are costly. In addition, refining services may not be available, so that the impurities contained in the synthesis process may cause background noise. Therefore, additional purification is introduced.
In the purification method, it is advantageous not to purify the primers individually but to purify the Kplex-15 primer at a time by mixing the primers at different concentrations. Therefore, in the present invention, a spin column of SEC (Size Exclusion Chromatography) method is applied.
In FIG. 4, the results of using the primers before and after purification without the PCR cycle show that the purification process significantly removes nonspecific fluorescence noise. In Fig. 5, VIC fluorescence noise was observed only in the combination of D6S1043 primer alone or in combination with D6S1043. Therefore, the primer-dimer induced by the D6S1043 primer can be interpreted as a cause of the noise. However, since the position of this noise is formed on the smaller side of the range of the Kplex-15 amplification product, it is not affected by the interpretation of the result and is not included in the Identifiler, so the optimization and validation will proceed without any modification.
As shown in FIG. 6, the pre-purification Kplex-15 primer does not have a good multiplex balance because the concentration of the primers set under the PCR conditions using GoldST * R buffer and AmpliTaq Gold DNA polymerase is lower than that of HotSTAR buffer and Hot Taq DNA polymer It is understood that this is a phenomenon that is not true in Raje. It is understood that the height of the peaks before and after the purification is changed due to the fact that the recovery rate of each primer is different due to purification of the primers having different length and molecular weight at the same time. Therefore, due to the difference in recovery rate between the PCR reaction system and the tablets, the balance imbalance of the peaks was corrected through readjustment of the primer concentration.
The concentration of the modified primer (Kplex-15 primer v.1.1) is as follows:
Fig. 7 shows the results of PCR amplification of 9947a and 9948 standard DNA with primers before and after purification after correcting the concentration of Kplex-15 primer. At this time, the total PCR reaction was adjusted to 25 μl, and 1 ng of 9947a or 9948 standard DNA, 2.5 μl of 10 × HotSTAR buffer, 5 μl of 5 × Kplex-15 primer v.1.1 before and after the purified calibration, 3.5 U of Hot Taq DNA polymerase . PCR was carried out at 94 ° C for 20 sec, 59 ° C for 90 sec and 72 ° C for 60 sec, followed by 28 cycles at 95 ° C for 15 min, final 45 ° C for 45 min, and then capillary electrophoresis (POP-4, 36 cm) using a 3130 Genetic Analyzer Respectively. As can be seen from the results, it can be confirmed that the result after the purification through the density correction improves the multiplex balance.
hemp. Optimization of reaction conditions
The introduction of tablets and the localization of the reaction reagents necessitated verification of the optimal conditions for the PCR reaction prior to validation testing.
First, various annealing temperatures were applied using HotSTAR buffer (BioQuest, Korea) and Hot Taq DNA polymerase (BioQuest, Korea) in order to confirm the extent of reaction buffer and enzyme changes on annealing temperature. At this time, 25 μl of the whole PCR reaction was performed, 2.5 μl of 10 × HotSTAR buffer, 5 μl of 5 × Kplex-15 primer v.1.1 purified by concentration correction, and 3.5 U of Hot Taq DNA polymerase were added. PCR was carried out at 94 ° C for 20 sec, 95 ° C for 20 sec, 55 ° C to 63 ° C (2 ° C interval) for 90 sec and 72 ° C for 60 sec, 28 times and final 60 ° C for 45 min, followed by capillary electrophoresis -4, 36 cm).
At 55 ° C and 57 ° C, non-specific peaks were observed at a size similar to the Y peak of amelogenin. Peak height and balance were best at 59 ° C and no nonspecific peaks were observed. 61 and 63 did not show nonspecific peaks, but the overall height of the peaks decreased and the balance became worse and even the peaks of certain genetic loci disappeared. Therefore, it was reaffirmed that the optimum annealing temperature was 59 ° C, and the later validation was to proceed at 59 ° C.
The following experiments were performed to determine the optimal number of PCR cycles. At this time, 25 μl of the whole PCR reaction was performed, 2.5 μl of 10 × HotSTAR buffer, 5 μl of 5 × Kplex-15 primer v.1.1 purified by concentration correction, and 3.5 U of Hot Taq DNA polymerase were added. PCR was carried out at 94 ° C for 20 minutes, 59 ° C for 90 seconds, and 72 ° C for 60 seconds at 95 ° C for 15 minutes, followed by 24-32 cycles (2 cycles apart) and final 60 ° C for 45 minutes. -4, 36 cm).
Peaks of less than 500 RFU were formed in 24 cycles and 26 cycles, and peaks of 500-2,000 RFU in 28 cycles were balanced and amplified. In 30 cycles and 32 cycles, more than 2,000 peaks were formed, but noise was increased as well, incomplete A insertion occurred, and the results were difficult to analyze.
In order to improve the low sensitivity of the 24 cycles, the template DNA was doubled and tested under the same conditions. As a result, the sensitivity was slightly improved, but the peak was formed at 500 RFU or less and the complete profile could not be obtained (FIG. 10). Therefore, increasing the cycle rather than increasing the amount of the template DNA was considered to be good for the analysis of the trace amount or the degraded field sample.
In 32 cycles, the PCR was performed by reducing template DNA to 100 pg to reduce nonspecific peak generation and overall sensitivity reduction. Although the overall peak was detected at over 500 RFU, non-specific peaks appeared near the Y peak of amelogenin and FGA, and the TH01 locus showed incomplete A insertion. In many genetic loci including TPOX, And the amplification efficiency of genotypes has been increased (Fig. 11). Therefore, it is considered that the method of reducing the template DNA while increasing the cycle will increase the error probability of the test. Therefore, we decided to proceed with validation under 28 cycle conditions.
Next, an experiment was conducted to determine the proper amount of the enzyme. At this time, 25 μl of the whole PCR reaction was performed, 1 ng of template DNA (9947a), 2.5 μl of 10 × HotSTAR buffer, 5 μl of 5 × Kplex-15 primer v.1.1 purified by concentration correction and Hot Taq DNA polymerase 2U, 3U, 3.5U, 4U and 5U were added. PCR was carried out at 94 ° C for 20 sec, 59 ° C for 90 sec and 72 ° C for 60 sec, followed by 28 cycles at 95 ° C for 15 min, final 45 ° C for 45 min, and then capillary electrophoresis (POP-4, 36 cm) using a 3130 Genetic Analyzer (Fig. 12).
As shown in FIG. 12, there is no significant correlation between the amount of enzyme used and the amplification efficiency. Rather, 4U and 5U increase the amplification efficiency. This is due to the fact that the ratio of the enzyme to the template is beyond the proper range, and the efficiency is lowered due to the lack of templates and other components relative to the enzyme. Between 2.0 and 3.5 U, the peak balance and amplification efficiency were almost the same. Therefore, we decided to proceed with validation by selecting 3.5 U. This is because DNA extracted from field samples is likely to contain a variety of PCR inhibitors, since the greater the amount of enzyme, the more advantageous it is to overcome the inhibition.
Thus, the finally determined PCR optimum conditions are shown in FIG.
Fig. 14 shows the results of analysis of 1 ng of the 9947a standard DNA template under the above conditions, showing good amplification amount, multiplex peak balance, and noise level.
The DNA sensitivity was measured using the conditions of FIG. At this time, the total PCR reaction was performed at 25 ㎕, and 16 pg of the template DNA (9947a), 32 pg, 63 pg, 100 pg, 125 pg, 250 pg, 500 pg, 1 ng and 2 ng, 2.5 ㎕ of 10 x HotSTAR buffer, 5 μl of 5 × Kplex-15 primer v.1.1 purified by concentration correction, and 3.5 U of Hot Taq DNA polymerase. The PCR reaction was carried out at 95 ° C for 15 minutes, followed by 28 cycles of 94 ° C for 20 seconds, 59 ° C for 90 seconds, and 72 ° C for 60 seconds, and final 60 ° C for 45 minutes. Then, the cells were subjected to capillary electrophoresis (POP- (Fig. 15).
Identifiler Plus and GlobalFiler are quoted from the manufacturer's public data. Kplex-15 is obtained by repeating 4 times with optimal PCR conditions using 9947 standard DNA (Cutoff = 50 RFU) The detection sensitivity in the concentration range was judged to be comparable. However, it was estimated that Kplex-15 did not obtain a complete profile at 100 pg, which may vary depending on the DNA concentration and the DNA storage state at the time of evaluation, requiring more precise experimentation.
Next, the suppression test by the humic acid of the Kplex-15 PCR system was performed. At this time, 25 μl of the whole PCR reaction was performed, 1 ng of template DNA (9947a), 2.5 μl of 10 × HotSTAR buffer, 5 μl of 5 × Kplex-15 primer v.1.1 purified by concentration correction, 3.5 μl of Hot Taq DNA polymerase U, 0-150 ng / μl humic acid (50 ng / μl interval, SigmaAldrich). PCR was carried out at 95 ° C for 15 minutes, followed by 28 cycles of 94 ° C for 20 seconds, 59 ° C for 90 seconds, and 72 ° C for 60 seconds, and final 60 ° C for 45 minutes, followed by capillary electrophoresis (POP-4, 36 cm) using a 3130 Genetic Analyzer (Fig. 16).
The Kplex-15 PCR system was able to obtain a complete profile even when 50 ng / μl humic acid was added, even though the amplification efficiency was somewhat lowered. However, the amplification efficiency was significantly lower at higher concentrations. Data show that the Identifiler kit is difficult to obtain a complete profile if 6 ng / μl of humic acid is added, and Identifiler_Plus is reported to have the ability to overcome inhibition to obtain a complete profile of up to 150 ng / μl. The ability of the Kplex-15 PCR system to overcome inhibition has been assessed to be somewhere in between the two comparison kits, and there is room for further development and improvement. The ability to overcome PCR inhibition depends not only on the additive for overcoming the inhibition but also on the conditions of the PCR parameters as well as factors such as buffer pH, salt type and concentration, and hot start chemistry. .
bar. Ladder And bin set making
Amelogenin, TH01, D21S11, D6S1043, vWA and D16S539 genomic loci were amplified by PCR using gDNA with various allelic forms, followed by PCR amplification in consideration of the peak height of the amplified products so that the ladder peaks were constant Ladder was secured. At this time, the amplification products were amplified under monoflex conditions to minimize noise and improve the quality of the peaks even under the same conditions.
First, the gDNA of the male was amplified with Kplex-15 amelogenin primer concentration under the same conditions as Kplex-15 and used as a template. At this time, 25 μl of the whole PCR reaction was performed, 1 μl of Amelogenin amplification product diluted 10 5 times, 2.5 μl of 10 × HotSTAR buffer, 5 μl of 5 × Amelogenin primer purified by concentration calibration, Hot Taq DNA polymerase And 3.5 U was added. PCR was performed 20 times at 95 ° C for 20 seconds, 59 ° C for 90 seconds, and 72 ° C for 60 seconds, and finally at 60 ° C for 45 minutes, followed by capillary electrophoresis (POP-4, 36 cm) with a 3130 Genetic Analyzer Respectively.
TH01 amplified the gDNA containing various allelic genotypes with the TH01 primer in the same manner as Kplex-15 condition, and amplified products were mixed so that the height of the peak was homogenized to secure the template of the ladder. The PCR conditions for securing the template are as follows:
The total PCR reaction was 25 μl, and 2 μl of the gDNA-derived TH01-amplified product diluted 10 2- fold, 2.5 μl of 10 × HotSTAR buffer, 25 μl of the 5 × TH01 primer-based PCR reaction purified by concentration correction, 2 μl of the resulting TH01 amplification product, 2.5 μl of 10 × HotSTAR buffer, 5 × TH 4 times of purification after concentration correction, and final 60 ° C. for 45 minutes, followed by capillary electrophoresis (POP-4, 36 ㎝) using a 3130 Genetic Analyzer .
D21S11, D6S1043, vWA, and D16S539 are PCRs with the same conditions, but PCR was performed with monoplex in order to make a ladder template from gDNA and then to make a ladder. The gDNA containing various allelic genotypes was amplified with the primers D21S11, D6S1043, vWA and D16S539 in the same manner as Kplex-15, respectively, and the amplification products were mixed so that the heights of the peaks were homogenized to secure ladder molds. The PCR conditions for securing the template are as follows:
The total PCR reaction was set to 25 μl each. D21S11 was diluted 10 5 times with 4 μl of the gDNA-derived amplification product (5 μl of the gDNA-derived amplification product diluted 10 2 -fold with D6S1043 / 1 μl of the amplification product derived from the gDNA diluted 10 4 -fold /
The ladder of each genetic loci made by the above process, or a combination thereof, was used as a ladder by calculating the height of the peak by capillary electrophoresis and determining the ratio to be a uniform peak height as high as possible near 1,000 RFU. The following figure shows the capillary electrophoresis results of the completed Kplex-15 ladder (Fig. 17).
As a result, all the alleles appeared to be above the
In order to accurately allocate alleles of samples with GeneMapper using binaural ladder, bin set should be produced, so that it is compatible with various genetic analyzers using POP-4. In addition, the call range of the right and left end of the allele of the bin set can be constructed considering the proprietary method of Kplex-15 that reflects the genotype distribution characteristics of Koreans and the input method of Identifiler and Identifiler_CODIS (FIG. 18). In order to ensure the integrity of the inspection in DNA database operation, it is better to use the unified method. Since we are using the allele range of Identifiler at present, we decided to make bin set according to the Identifiler method in Kplex-15.
First, 34 amplified products of standard DNA and other DNA samples including 2 ladder and 9947a were measured by capillary electrophoresis (POP-4, 36 ㎝) using 3130 Genetic Analyzer. The average of the alleles of each ladder was calculated and converted into an integer and assigned to the size of the corresponding allelotype of bin set. The size error of the allelic genotypes was measured to determine the magnitude of the left and right offset.
As shown in Fig. 19, the largest travel distance deviation was observed in D3S1358, but the size was less than 0.5 bp. Therefore, the left and right offsets of the bin set were determined to be 0.5 (FIG. 20). The panel also included the allele genotype and the allele genotype of the ladder, and the 9947a allele was used for the bin set of standard DNA.
four. Kplex -15 HID PCR Kit Validation of
Through the above process, the localized and optimized PCR system, ladder and bin set were called "Kplex-15 HID PCR kit" and evaluated whether it could be a parallel or alternative system of Identifiler operating in DNA database.
As previously described, Kplex-15 primers are miniaturized systems for the corresponding genetic loci as compared to Identifiler primers. That is, the location of the primers can cause the appearance of mutations in the primer binding site to be different in the two systems. Thus, with the emergence of mutations, the efficiency of the amplification product is reduced or the amplification product is not amplified and the heterozygosity appears to be homozygous (Figure 21).
Therefore, it is important to ensure the identity of the test with the Identifiler. If the mutation of the primer binding site is caused by a different result from the Identifiler, the position and sequence of the mutation can be identified through the base sequence analysis. Primer, and the identity was checked.
In general, validation is performed by applying optimized conditions to compare the identities and performances of the kits in the same state throughout the validation process. However, the present invention allows optimization and validation at the same time so that it can be applied to practice at the end of the task .
First, the identity test results were compared for arbitrary DNA samples that are known to be Idetifiler test results. At this time, 25 μl of the whole PCR reaction was performed, and 10 μl of the template DNA was subjected to primary dilution of 0.1 ng / μl, 2.5 μl of 10 × HotSTAR buffer, 5 μl of 5 × Kplex-15 primer purified by concentration correction, And 3.5 U, respectively. PCR was carried out at 95 ° C for 15 minutes, followed by 28 cycles of 94 ° C for 20 seconds, 59 ° C for 90 seconds, and 72 ° C for 60 seconds, and final 60 ° C for 45 minutes, followed by capillary electrophoresis (POP-4, 36 cm) using a 3130 Genetic Analyzer . 0.1 ng / ㎕ or less 5 min DNA was used in 10 ㎕ regardless of temperature and only 100 RFU or more was recognized as a peak (Table 4).
As shown in the results, all 10 samples were heterozygous at D7S820 locus of Identifiler, but homozygosity at Kplex-15 or high peak-to-peak height difference was observed. It was presumed that the mutation occurred in the template DNA sequence binding to the D7S820 primer of Kplex-15, and it was judged that the mutation near the 3 'end of the primer caused no amplification or very weak amplification.
For reference, the D7S820 primer used in the first step was 0.45 μM each of D7S820-F181m2 (5'-cttgtcatagtttagaaYgaactaac) and D7S820-R342 (5'-VIC-cattgacagaattgcaccaaa).
One of the samples with the same result as the DNA and the Identifiler which were expected to have the mutation was selected and the base sequence was analyzed. The outer primer about 100 bp from the D7S820 primer site of Kplex-15 was amplified as follows (Fig. 22).
D7S820-seq01: CTGAGGTATCAAAAACTCAGAGG
D7S820-seq02: ATGTTGGTCAGGCTGACTATG
The inconsistent samples were PCR-amplified using the above primers, followed by sequencing (BigDye Terminator v3.1) with the same primers to determine whether the mutations were mutations.
The analysis of the base sequence: was confirmed that a portion to (D7S820-R342 VIC-CATTGACAGAATTGCACCA A A) combining the A-> C mutation is present, a transition occurs, the amplification is significantly reduced which would look like a homozygous.
In consideration of this result, it was considered to change R342 to CATTGACAGAATTGCACCA (M) A, but there is a fear that the amplification efficiency for various mutations may occur due to the accumulation of the accumulation in D7S820-F181m2 (CTTGTCATAGTTTAGAAC (Y) GAACTAAC) The primers were designed so that the amplification product of the same size was produced by shifting the position of the reverse primer by two to avoid the mutation position and by moving the forward primer in the same direction at the same time. The newly designed primers were confirmed to have no abnormalities in noise and amplification efficiency through monoflex testing. After replacing the existing D7S820 primer with a Kplex-15 multiplex primer, the primer was subjected to a purification process and the concentration for optimal peak height balance . The sequences and concentrations used for the primers are as follows:
D7S820-F183m 5'-tgtcatagtttagaaYgaactaacg 0.4 uM
D7S820-R344 5'-VIC-ctcattgacagaattgcacca
The results of Identifiler and heterozygosity homologous to the results of Identifiler showed that the Kplex-15 primer modified with D7S820 was identified as v.2.0 and that homozygous homozygosity was different from that of Identifiler at D7S820. And secondly, additional new samples were analyzed.
No.
Three samples were identified from the Identifiler homozygosity analysis using the modified D7S820 primer (F183m / R344), which were analyzed as homozygosity at Kplex-15 (Table 5). The identity and heterozygous detection rates have been increased to reflect the variation of the R342 primer binding site, but the still inconsistent sample suggests additional mutations in other binding sites. Therefore, sequencing was performed for the three mismatch samples in the same manner.
As a result, No. 2 and No. 3 resulted in A insertion between C and G at the 3'-terminal to which D7S820-F183m (tgtcatagtttagaaYgaactaac g ) was bound, resulting in markedly reduced amplification and a homozygosity-like result (FIG. 24).
The A insertion by direct sequencing of the PCR amplification products of the second and third samples showed overlapping with the normal sequence, and the PCR product was cloned and confirmed by sequencing for more accurate judgment (FIG. 25).
However, no A insertion was observed in the D7S820-F183m binding site in the No. 1 sample. Nonetheless, the heterozygosity in Identifiler was observed as homozygous for Kplex-15, suggesting that there is a mutation in the primer-binding site that has not been identified until now. The new mutant has been found that G between D7S820-R344 position (5'-VIC-ctcattgacagaatt g cacca ) aatt cacca and the change in A (Fig. 26).
In order to reflect this variation, it is necessary to change the R344 primer to 5'-VIC-ctcattgacagaatt R cacca. However, since the opposite primer contains axial degradation, it is not desirable to design both primers to be degraded. Respectively. Therefore, in consideration of the A insertional mutation of the forward primer, the length of the entire amplification product was designed to be the same by reducing 2 bp at the 5 'end position instead of re-reducing the 3' end position by 2 bp as follows. The newly designed primers were confirmed to have no abnormalities in noise and amplification efficiency through monoflex testing. After replacing the existing D7S820 primer with a Kplex-15 multiplex primer, the primer was subjected to a purification process and the concentration for optimal peak height balance . The sequences and concentrations used for the primers are as follows:
D7S820-F183m1 tgtcatagtttagaaYgaactaac 0.53 uM
D7S820-R344 5'-VIC-ctcattgacagaattgcacca
Using the modified Kplex-15 primer, three samples showing homozygous homologous to the results of the Identifiler were identified in the second and third samples. As a result, the same results were obtained for the heterozygosity of Identifiler and homozygous alleles. And the peak height balance was significantly different due to the unreflected relationship (FIG. 27).
A third test was performed on a new sample with the Kplex-15 primer (Kplex-15 primer v.3.0) modified to D7S820-F183m1 / D7S820-R344.
The same analysis results were obtained except that one of the samples compared showed a discrepancy between Identifiler and Kplex-15 primer v.3.0 at TH01 (Fig. 28).
Ah. Kplex -15 Primer Used direct PCR optimization
In the course of the research, we decided to complete the first year of the first year in order to utilize the analysis method of Kplex-15 by direct PCR, which is the second year research plan, in the DNA database inspection system.
Some products such as Phusion / Phire are available for direct PCR. However, the present invention is excluded from the evaluation because it is the main target of the present invention, and the product manufactured in the country has no other than AnyDirect PCR buffer solution at the start of the task It was impossible to compare them separately.
For the direct PCR reaction, the use of AnyDirect PCR buffer solution was used. Among the various enzymes produced in Korea, Hot Taq DNA polymerase was applied without any evaluation process. This is because it is a domestic product proved by using direct PCR using primer. In addition, direct PCR products produced in-house were purchased and tested for direct PCR of Kplex-15 primers, but no comparable results were obtained (results omitted).
In order to validate the Kplex-15 direct PCR system using AnyDirect PCR buffer solution and Hot Taq DNA polymerase, it is necessary to confirm the conditions of use of existing primers used in PCR using DNA. The method of analysis of various samples used for input should be reestablished.
First, Kplex-15 primer v.3.0 was applied using the conditions of Kplex-15 PCR using DNA as it is. At this time, 25 μl of the whole PCR reaction was performed. One saliva FTA disk having a diameter of 1.2 mm, 19.25 μl of AnyDirect PCR buffer solution, 5 μl of the purified 5 × Kplex-15 primer v.3.0, 3.75 μl of Hot Taq DNA polymerase . As a positive standard for the reaction, 3 ng of 9947a standard DNA was used. The PCR reaction was carried out at 95 ° C for 15 minutes, followed by 28 cycles of 94 ° C for 20 seconds, 59 ° C for 90 seconds, and 72 ° C for 60 seconds, followed by a final 60 ° C for 45 minutes, followed by capillary electrophoresis (POP-4, 36 cm) with a 3130 Genetic Analyzer Respectively.
As a result, compared with DNA-based PCR, the amplification was relatively high in the saliva-dried FTA disk even in the same 28-cycle condition. Peak height balances also changed, especially amelogenin, and several genetic loci, including TH01, were lower. Therefore, the use of primers was reduced by half compared with the DNA PCR, and the concentration of the primers was adjusted to adjust the peak balance. In addition, TH01, vWA or CSF1PO exhibited incomplete insertion of A under strong amplification conditions. TH01, which has a high degree of double strand displacement, shifted the position of the fluorescence from the forward primer toward the reverse primer and the final extension of the PCR cycle from 45 to 60 Minute to improve it. The above results are summarized and the concentration ratio of the primer (Kplex-15D primer v.1.0) is summarized as follows, and the optimum reaction conditions are shown in FIG. 30:
From the saliva and blood dried FTA disks with a diameter of 1.2 mm using the above conditions
(Fig. 30). Direct PCR methods were also set up for hair, whole blood, and saliva swabs after simple pretreatment.
As can be seen from FIG. 31, good analysis results are obtained with respect to hair, whole blood and saliva swabs. However, in the case of cigarette butts (saliva dried paper part), the detection sensitivity is low and the improvement is required.
character. Kplex -15 HID direct PCR Kit Validation of
In the previous process, a system that localizes the Kplex-15 primer for DNA analysis after direct PCR using AnyDirect PCR buffer solution and Hot Taq DNA polymerase is called "Kplex-15 HID direct PCR kit" and the system of Identifiler It was evaluated whether it was possible as a parallel or alternative system.
For this, Kplex-15 primer, which reflects the mutation of the primer binding site in the optimization and validation process of the localized Kplex-15 DNA PCR system, is applied to the direct PCR in the same way, Respectively.
Then, the success rate by the 3130 Genetic Analyzer after the direct PCR test of Kplex-15 was evaluated. However, the direct PCR analysis of Identifiler did not compare the success rates between the two methods because the results were obtained from the 3700 Genetic Analyzer.
In addition, PCR cycle optimization was performed simultaneously during the validation, and the success rate of the cycle difference was compared. In other words, the number of cycles was initially validated by applying 28 cycles in the 3130 Genetic Analyzer, but the overall success rate including the first success rate and rerun by dilution / cleanup was evaluated, Was determined.
In the present invention, the multiplex performance of the Kplex-15 system by the intra / inter peak height ratio measurement is not separately evaluated because it is meaningful to evaluate the product when the stabilization phase is entered after the optimization is completed.
First, the dried part of the saliva was directly poured into a 1.2 ㎜ diameter disc in an arbitrary sample known to Idetifiler's direct PCR test result and directly put into the PCR solution. First, several samples were analyzed firstly, and the success rate of the test was evaluated. Then, the sample was used as the basic data for establishing the optimal conditions. At this time, the whole PCR reaction was performed by applying the direct PCR optimal conditions set up above and confirmed by capillary electrophoresis (POP-4, 36 cm) with a 3130 Genetic Analyzer.
Assessment of the success rate of the test was made to quantitatively evaluate the electropherogram to minimize the intervention of subjective judgment (Table 8).
"Bad injection" refers to the case where the peak height of the size marker is less than or equal to
"Low yield (25-100 rfu) (& dye blobs)" means that any one of the 15 alleles of opposite genetic loci is 100 rfu or less, and the PCR product is enriched 2.4 times with the Qiagen's MinElute PCR purification kit ㎕ loading → 5 용 elution → loading 24 ㎕ → 10 ㎕ elution) and PCR products were injected twice (1 ㎕ → 2 ㎕). At this time, it is considered as failure if the full profile analysis is not performed even though this process is performed, and when the entire profile is obtained, it is calculated as the 'second success'.
"Full profile (100 rfu or more, pull-up
&Quot; Off-scale (Pull up
"No or extremely low peaks" refers to cases where there is no partial or no profile due to strong noise peaks compared to the amplification products, and DNA is newly extracted from the sample, analyzed by DNA PCR, and considered to be a failure.
"OL / specific result" refers to the case where the conditions for obtaining the overall profile are met, but the reproducibility is confirmed through a new variant or other repeat (rerun) that is not specified in the ladder and is considered as "first success" .
The success rate was evaluated by classifying the samples subjected to the first analysis by the above evaluation criteria (Table 9).
(Pull up
In the first analysis, the overall success rate was 94.2%, but the success rate of 65.81% at the first success rate was relatively low. If the primary success rate is lower than the overall success rate, the effect of introducing direct PCR in terms of time and cost of analysis may be deteriorated.
A more detailed analysis of the test results showed that peak heights of test results rated as "Full profile (100 rfu or more, below pull up
Therefore, it may be considered to reduce the size of the saliva-drying FTA disk used in the PCR, reduce the amount of the enzyme used, reduce the concentration of the primer as a whole, or reduce the intensity of the PCR amplification by shortening the PCR cycle. In the present invention, it was evaluated whether the reduction of the PCR cycle had a primary success rate relative to the overall success rate. Therefore, in the second analysis, optimization is performed by changing from 28 to 27 cycles.
On the other hand, the test identities of Kplex-15 Identifiler were compared with those of the samples determined to be successful. Among them, TH01 of one sample showed Kfix-15 (29, , 30) showed heterozygous disagreement (Fig. 32).
As a result, it was determined that the 29 genotypes were not amplified due to the presence of a mutation at the D21S11 primer binding site of Identifiler. However, the identification and sequence of the D21S11 primer of Identifiler were not known accurately.
As previously suggested, in the second test, one cycle from 28 cycles to 27 cycles was shortened to evaluate the impact on overall success rate and primary success rate. At the same time, the identifiler results were checked for identity. The success rate was evaluated by classifying the samples subjected to the second analysis by the above evaluation criteria (Table 10).
(Pull up
In the first and second tests (28 cycles → 27 cycles), the overall success rate remained almost unchanged and the primary success rate improved by more than 10%.
On the other hand, the test identities of Kplex-15 Identifiler were compared with those of the samples which were determined to be successful, and three samples showed test discrepancy (FIG. 33).
Identifiler at the locus of D7S820 of
Conclusion and discussion
The present invention has been carried out with the aim of paralleling or replacing the Identifiler system, which is currently used as a reference input system for DNA databases, by combining DNA and direct reagent for direct PCR analysis into Kplex-15 primer system.
The Kplex-15 primer was designed to minimize the size of all amplification products compared to the Identifiler kit. It was found to be sensitive to trace amounts, degradation products and PCR inhibition, and was sensitive enough to detect 100 pg of standard DNA .
This primer system has been used in the present invention to evaluate the conformity of the test through localization, optimization, and validation for the purpose of development to the practical stage rather than a level of research that suggests a development prototype.
The DNA and direct PCR method was optimized using Korean reagent, and the agreement of the test with Identifiler was evaluated. In case of mutation in the Kplex-15 primer binding site, the primer reflecting the mutation was redesigned to improve the agreement Respectively.
There were two samples in D7S820, two samples in TH01, and one in D21S11 and D3S1358, respectively, showing discrepancies in the test by Kplex-15 v.3.0 and Kplex-15D v.1.0. For reference, the primers of Kplex-15 v.3.0 and Kplex-15D v.1.0 have the same sequence and different concentration ratios.
In addition, three homozygotes in Identifiler were found in two genetic loci (TH01, D21S11) with heterozygosity at Kplex-15. This is interpreted as the result that Identifiler did not reflect the variation in the primer binding site of the Identifiler, and the Kplex-15 test is an accurate result.
Conversely, one sample from D7S820 showed homozygosity for the heterozygosity in Kpix-15 in Identifiler. We know the cause of the mutation in the new primer binding site of D7S820 of this sample, so if we design the primer that reflects this mutation, we expect that the agreement rate will be improved.
In Identifiler, heterozygosity appeared in three peaks containing two alleles in Kplex-15, and is under investigation to determine the cause of discrepancies.
Identifiler and Kplex-15 were all homozygous but genotypes were different from each other. In the Identifiler, D3S1358 locus was 15 and OL (20.1), and Kplex-15 was 15 and 20. This may be caused by a mutation that inserts a single nucleotide in the flanking region that does not overlap with the amplification region of Kplex-15 in the amplification product region of the Identifiler, which is the inevitable cause of discrepancy in the case of different primer positions.
In addition, 99.27% is calculated as the DNA profile unit of the sample considering only the test result by Kplex-15 v.3.0 and Kplex-15D v.1.0, 99.95% is calculated as the genetic locus unit (excluding D6S1043) .
The results of the above evaluation are analyzed by 3130 Genetic Analyzer for both DNA PCR and direct PCR. For the DNA database, input should be made at 3730. Therefore, some of DNA PCR and direct PCR samples analyzed at 3130 were also analyzed in 3730.
The overall results were not significantly different from the 3130 results and there was no problem with ladder-based allele designation. However, in the 3130 assay, the non-specific peak induced by the D6S1043 primer and present on the left side of the analysis region of D3S1358 was detected from within the analysis region at 3730, increasing the likelihood of causing D3S1358 analysis problems. Therefore, in order to utilize Kplex-15 in 3730, this problem should be solved in the future.
In addition, with the launch of GlobalFiler and PowerPlexFusion System, and the demand for expanding the genetic locus of DNA database worldwide, development of localization kits corresponding to this trend is also urgent.
Resources
K- pex -15 STR LOCI INFORMATION
Y: p11.2
NG_008011.1
] x
While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.
<110> Republic Of Korea (Supreme Public Prosecutor's Office) <120> Method for Autosomal Analysis of Human Subject of Analytes Using Multiplex Gene Amplification <130> PN130294 <160> 30 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Amelo-F180g <400> 1 gccctttgaa gtggtaccag ag 22 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Amelo-R262 <400> 2 gcatgcctaa tattttcagg gaataa 26 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> D5S818-F155 <400> 3 aagggtgatt ttcctctttg gt 22 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> D5S818-R270m1 <400> 4 atctttatct gtatccttat ttatacmtct atct 34 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TH01-F117 <400> 5 gattcccatt ggcctgttc 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TH01-R286 <400> 6 ctgtgggctg aaaagctcc 19 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> D18S51-F115 <400> 7 ggacatgttg gcttctctct g 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D18S51-R369 <400> 8 gagccatgtt catgccactg 20 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> D3S1358-F164 <400> 9 gagcaagacc ctgtctcata ga 22 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> D3S1358-R265 <400> 10 tcaacagagg cttgcatgta t 21 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> D7S820-F183m1 <400> 11 gtcatagttt agaaygaact aac 23 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> D7S820-R342 <400> 12 cattgacaga attgcaccaa a 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D21S11-F161 <400> 13 aattccccaa gtgaattgcc 20 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> D21S11-R365m <400> 14 gtcaatgttc tccagagaca gacta 25 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> D6S1043-F056 <400> 15 ggcactctta ttcatctagt tgcc 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D6S1043-R332 <400> 16 gcttcccttg ttctgaggct 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TPOX-F109 <400> 17 gcacagaaca ggcacttagg 20 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TPOX-R198 <400> 18 tccttgtcag cgtttatttg c 21 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> vWA-F096 <400> 19 gaataatcag tatgtgactt ggattg 26 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> vWA-R249m <400> 20 aggttagata gagataggac agatga 26 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> D16S539-F037s <400> 21 gaagaatcca gaaaaccaca g 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> D16S539-R250 <400> 22 tttagcgttt gtgtgtgcat c 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CSF1PO-F134 <400> 23 ttgctaacca ccctgtgtct c 21 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CSF1PO-R409 <400> 24 ccatcttcag cccattctcc 20 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> D8S1179-F173 <400> 25 tttttgtatt tcatgtgtac attcgt 26 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> D8S1179-R275 <400> 26 gtagattatt ttcactgtgg ggaa 24 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> D13S317-F169 <400> 27 tggactctga cccatctaac g 21 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> D13S317-R328g <400> 28 gctcctcctt caacttgggt t 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FGA-F109 <400> 29 caaatgcccc ataggttttg 20 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> FGA-R336 <400> 30 aatatggtta ttgaagtagc tgctg 25
Claims (28)
(a) a DNA sample separated from the human object, amelogenin, D5S818, TH01, D18S51, D3S1358, D7S820, D21S11, D6S1043, TPOX (human thyroid peroxidase gene), vWA (von Willebrand factor A) , Multiplex amplification using primers complementarily binding to the genomic locus of human CSF1 (human c-fms proto-oncogene for CSF-1 receptor gene), D8S1179, D13S317 and FGA (human fibrinogen alpha chain) ; Wherein the primer complementarily binding to the amelozinein genetic locus is a first sequence and a second sequence of Sequence Listing; The primers complementarily binding to the D5S818 genetic locus are SEQ ID NOS: 3 and 4; The primer that binds complementarily to the TH01 genetic locus is the sequence of SEQ ID NO: 5 and SEQ ID NO: 6; The primers complementarily binding to the D18S51 genetic locus are SEQ ID NOS: 7 and 8; Wherein the primers complementarily binding to the D3S1358 genetic locus are SEQ ID NOS: 9 and 10; The primers complementarily binding to the D7S820 genetic locus are those of Sequence Listing 11 and 12; The primers complementarily binding to the D21S11 genetic locus are SEQ ID NO: 13 and SEQ ID NO: 14; The primers complementarily binding to the D6S1043 genetic locus are those of Sequence Listing 15 and 16; Wherein the primer that binds complementarily to the TPOX genetic locus is SEQ ID NO: 17 and SEQ ID NO: 18; The primers complementarily binding to the vWA genetic locus are SEQ ID NOS: 19 and 20; Wherein the primers complementarily binding to the D16S539 genetic locus are SEQ ID NOS: 21 and 22, the primers complementarily binding to the CSF1 PO genomic locus are SEQ ID NOS 23 and 24; The primers complementarily binding to the D8S1179 genetic locus are those of Sequence Listing 25 and Sequence 26; Wherein the primers complementarily binding to the D13S317 genetic locus are SEQ ID NOS 27 and 28; The primers complementarily binding to the FGA genetic locus are selected from the group consisting of SEQ ID Nos. 29 and 30 sequences; And
(b) determining the allelic genotype of the locus using the multiplex amplification product of step (a), and identifying the human object as a gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20140058213A KR101457983B1 (en) | 2014-05-15 | 2014-05-15 | Method for Autosomal Analysing Human Subject of Analytes Using Multiplex Gene Amplification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20140058213A KR101457983B1 (en) | 2014-05-15 | 2014-05-15 | Method for Autosomal Analysing Human Subject of Analytes Using Multiplex Gene Amplification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR101457983B1 true KR101457983B1 (en) | 2014-11-06 |
Family
ID=52289304
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR20140058213A KR101457983B1 (en) | 2014-05-15 | 2014-05-15 | Method for Autosomal Analysing Human Subject of Analytes Using Multiplex Gene Amplification |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101457983B1 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101533792B1 (en) * | 2015-02-24 | 2015-07-06 | 대한민국 | Method for Autosomal Analysing Human Subject of Analytes based on a Next Generation Sequencing Technology |
| KR101672240B1 (en) * | 2015-12-30 | 2016-11-07 | 대한민국 | Method for Analysing Human Subject Chromosomal STR and Kits using Thereof |
| KR20170018994A (en) * | 2015-08-10 | 2017-02-21 | 대한민국(관리부서 대검찰청) | Forensic profiling by differential pre-amplification of STR loci |
| KR101920872B1 (en) | 2018-02-27 | 2018-11-28 | 대한민국 | Analysis system using next generation sequencing |
| KR20190054477A (en) * | 2017-11-13 | 2019-05-22 | 순천향대학교 산학협력단 | PCR Premixes composition containing STR markers and a genetic analysis kit for scientific investigation education using the composition |
| WO2019132582A1 (en) * | 2017-12-28 | 2019-07-04 | 주식회사 엔젠바이오 | Method for analyzing str of human subject by using multiplex system, and analysis kit using same |
| CN110643712A (en) * | 2018-06-26 | 2020-01-03 | 深圳华大法医科技有限公司 | Five-color fluorescent STR typing method for synchronously detecting 22 gene loci and special kit thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012155084A1 (en) * | 2011-05-12 | 2012-11-15 | Netbio, Inc. | Methods and compositions for rapid multiplex amplification of str loci |
-
2014
- 2014-05-15 KR KR20140058213A patent/KR101457983B1/en active IP Right Grant
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012155084A1 (en) * | 2011-05-12 | 2012-11-15 | Netbio, Inc. | Methods and compositions for rapid multiplex amplification of str loci |
| US20130184176A1 (en) * | 2011-05-12 | 2013-07-18 | Netbio, Inc. | Methods and Compositions for Rapid Multiplex Amplification of STR Loci |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101533792B1 (en) * | 2015-02-24 | 2015-07-06 | 대한민국 | Method for Autosomal Analysing Human Subject of Analytes based on a Next Generation Sequencing Technology |
| KR20170018994A (en) * | 2015-08-10 | 2017-02-21 | 대한민국(관리부서 대검찰청) | Forensic profiling by differential pre-amplification of STR loci |
| KR101716108B1 (en) | 2015-08-10 | 2017-03-15 | 대한민국 | Forensic profiling by differential pre-amplification of STR loci |
| KR101672240B1 (en) * | 2015-12-30 | 2016-11-07 | 대한민국 | Method for Analysing Human Subject Chromosomal STR and Kits using Thereof |
| KR20190054477A (en) * | 2017-11-13 | 2019-05-22 | 순천향대학교 산학협력단 | PCR Premixes composition containing STR markers and a genetic analysis kit for scientific investigation education using the composition |
| KR101997134B1 (en) | 2017-11-13 | 2019-07-05 | 순천향대학교 산학협력단 | PCR Premixes composition containing STR markers and a genetic analysis kit for scientific investigation education using the composition |
| WO2019132582A1 (en) * | 2017-12-28 | 2019-07-04 | 주식회사 엔젠바이오 | Method for analyzing str of human subject by using multiplex system, and analysis kit using same |
| KR20190080223A (en) * | 2017-12-28 | 2019-07-08 | 주식회사 엔젠바이오 | Method for Analysing Human Subject STR loci by using Dual Multiplex System and Kits using Thereof |
| KR102074959B1 (en) * | 2017-12-28 | 2020-03-02 | 주식회사 엔젠바이오 | Method for Analysing Human Subject STR loci by using Dual Multiplex System and Kits using Thereof |
| KR101920872B1 (en) | 2018-02-27 | 2018-11-28 | 대한민국 | Analysis system using next generation sequencing |
| US11597972B2 (en) | 2018-02-27 | 2023-03-07 | Republic of Korea (National Forensic Service Director Ministry of Interior and Safety) | Method of analyzing microhaplotype using next generation sequencing |
| CN110643712A (en) * | 2018-06-26 | 2020-01-03 | 深圳华大法医科技有限公司 | Five-color fluorescent STR typing method for synchronously detecting 22 gene loci and special kit thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101457983B1 (en) | Method for Autosomal Analysing Human Subject of Analytes Using Multiplex Gene Amplification | |
| Hill et al. | Characterization of 26 miniSTR loci for improved analysis of degraded DNA samples | |
| Vossen et al. | High‐Resolution Melting Analysis (HRMA)—More than just sequence variant screening | |
| Mulero et al. | Development and validation of the AmpFℓSTR® MiniFilerTM PCR Amplification Kit: a miniSTR multiplex for the analysis of degraded and/or PCR inhibited DNA | |
| KR101533792B1 (en) | Method for Autosomal Analysing Human Subject of Analytes based on a Next Generation Sequencing Technology | |
| How Kit et al. | Sensitive Detection of KRAS Mutations Using E nhanced‐ice‐COLD‐PCR Mutation Enrichment and Direct Sequence Identification | |
| JP5298013B2 (en) | Transcription infidelity, its detection and use | |
| KR101667526B1 (en) | Method for Extended Autosomal STR Analysing Human Subject of Analytes using a Next Generation Sequencing Technology | |
| Zhang et al. | Development and validation of a new STR 25-plex typing system | |
| KR101923647B1 (en) | SNP markers for discrimination of Jubilee type or Crimson type watermelon cultivar | |
| US6007231A (en) | Method of computer aided automated diagnostic DNA test design, and apparatus therefor | |
| KR101902508B1 (en) | Multiplex PCR system with twenty Autosomal-STR gene markers and sex chromosome gene marker for rapid detection of human identification | |
| Bono et al. | Genetic screening of Fabry patients with EcoTILLING and HRM technology | |
| CN111304194A (en) | Nucleic acid amplification blocker for detecting low-abundance mutant sequence and application thereof | |
| KR101672240B1 (en) | Method for Analysing Human Subject Chromosomal STR and Kits using Thereof | |
| CN107236037B (en) | Mutant MSH6 protein, and coding gene and application thereof | |
| Yu et al. | DNA mutation detection using denaturing high‐performance liquid chromatography (DHPLC) | |
| Alfano et al. | Characterization of full-length CNBP expanded alleles in myotonic dystrophy type 2 patients by Cas9-mediated enrichment and nanopore sequencing | |
| Al-Eitan et al. | Investigation of the forensic GlobalFiler loci in the genetically isolated Circassian subpopulation in Jordan | |
| CN112442530B (en) | Method for detecting CAH related true and false gene | |
| Goswami et al. | An overview of molecular genetic diagnosis techniques | |
| CN112639127A (en) | Method for detecting and quantifying genetic alterations | |
| Baudhuin et al. | Analysis of hMLH1 and hMSH2 gene dosage alterations in hereditary nonpolyposis colorectal cancer patients by novel methods | |
| CN110257505B (en) | Non-deletion α thalassemia point mutation rapid detection kit and detection method | |
| CN104726604A (en) | Decayed-sample degradation DNA (deoxyribonucleic acid) detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant |