KR101449598B1 - System for diagnosing Single Nucleotide Polymorphism using Mass analysis - Google Patents

Abstract

The present invention relates to a single base polymorphism diagnosis system using mass spectrometry.

Description

System for diagnosing Single Nucleotide Polymorphism using Mass analysis

The present invention relates to a system for diagnosing single base polymorphism using mass spectrometry.

The present invention is an application for the development of a disease diagnosis kit for mass spectrometry incorporating the subject serial number 　10033025, the research project titled by the Ministry of Knowledge Economy: Quantum International Joint Technology Development Project-Technology Complementary, Research Project Name: 　.

As the life expectancy of society is increasing and the fertility rate is falling, the population is aging socially. In addition, as the obese population and the adult disease population are increasing, complex diseases such as adult diseases, chronic diseases, and cancer are increasing. Therefore, it is becoming more and more important to accurately diagnose and effectively prevent and treat these diseases. The remarkable advances in modern molecular biology techniques have brought about many changes in the diagnosis and treatment of human diseases. These techniques have the advantage of being fast and accurate, so they are widely used in the fields of medicine and biomedical science, and their development potential is very high. Among them, the method using genetic tests in the field of cancer epidemiology research is being carried out very actively around the world in the field of molecular epidemiology. With the advent of the era of molecular epidemiology and increasing knowledge and interest in genetic factors and diseases, research results related to various diseases have been published numerous times since the 1980s. A number of research results are being published that study the relationship between a single SNP (Single Nucleotide Polymorphism) and a disease related to a gene, and a biomolecule, that is, a biomarker, that is an important clue in the diagnosis of DNA chips, microarrays, and diseases. It is being actively applied to research and development of molecular diagnostic markers by utilizing analysis technology using and the like. However, these technologies require an ultra-high sensitivity diagnostic method because they are present at very low concentrations in the body or in most samples, and the accuracy of diagnosis.

Peptide Nucleic Acid (PNA) is a polymer chemical substance similar in structure to nucleic acid DNA and was first developed in 1991. PNA is electrically neutral and has weak hydrophobicity. The kind of PNA technology can be applied to almost all fields requiring binding to nucleic acids. In addition to the medical purpose of regulating gene expression in biotechnology using PNA, many studies are being conducted in various basic and applied research fields throughout molecular biology.

Mass spectrometry is a method that accurately informs the type and amount of target molecules to be analyzed by measuring the signal strength of general organic molecules as well as biomolecules such as nucleic acids, proteins, peptides, and sugars. Since mass spectrometry is not restricted by the presence of a specific functional group, the theoretically applicable range of molecules is wide, and mass spectrometry can accurately analyze several types of target molecules in complex samples at the same time. It can be used for analysis and diagnosis.

Hepatitis B is a disease in which liver inflammation is caused by the immune response of our body when infected with Hepatitis B virus (HBV). Currently, about 8% of the total population in Korea has the hepatitis B virus. I'm doing it. If this disease persists for more than 6 months, it develops into chronic hepatitis, and further, terrible complications such as cirrhosis and liver cancer can occur. Therefore, researches for the treatment of this disease are continuously being conducted, and nowadays, as a nucleic acid derivative, it is converted into lamivudine triphosphate in cells and then inserted into the sequence of the viral DNA that is reverse transcribed from the pregenomic RNA of the hepatitis B virus, thereby preventing the proliferation of the virus. Lamivudine, which is an inhibitory antiviral agent, is mainly used, and antiviral agents such as adefovir, entecavir and clevudine have been developed and used. However, if these antiviral drugs are continuously administered, resistant mutants with resistance to drugs may develop and the disease may rapidly worsen. For this, it is necessary to administer an antiviral agent other than lamivudine. Such drug resistance is caused by genetic mutation, which is referred to as single nucleotide polymorphism (SNP), and appears as a point mutation in which one base of a specific gene is mutated. By detecting such a gene mutation, it is possible to select a mutant that is resistant to various antiviral agents, which can increase treatment efficiency by selecting and administering a more suitable antiviral agent.

Genetic diagnosis is in the post-genome era, as the genetic information of genes and pathogens involved in human diseases has progressed about 99%, and PCR (Polymerase Chain Reaction) technology to amplify nucleic acids has been established. It is a diagnostic technology that enables diagnosis and classification, and predicts response to drugs. Since this diagnostic system has excellent sensitivity, specificity, and accuracy, and can simultaneously diagnose several types of diseases with a very small amount of samples, early diagnosis and analysis of treatment effects are possible. Fields of application include early diagnosis and quantitative analysis of pathogen infection, diagnosis by identification of gene mutations related to diseases such as cancer genes, identification of gene differences related to gene onset, drug resistance and susceptibility diagnosis, customized medicine by identification of single nucleotide polymorphism (SNP genotyping). We expect to be able to provide a basis for this.

As a prior patent, Korean Patent Publication No. 1020040019276 discloses a cleavable signal element and the cleavable signal using a cleavable technique that specifically reacts to a complementary double-strand or single-strand of nucleic acid that can be used in a quantitative and qualitative analysis device. It relates to a method and apparatus for analyzing nucleic acid hybridization using urea, and not only increases detection sensitivity of target nucleic acids by using a cleavage technique that specifically reacts to complementary double strands or single strands of nucleic acids, but also for simultaneous (In Situ) measurement. By doubling the reliability of diagnosis and detection, the present invention enables more accurate diagnosis of various diseases by simultaneously observing the SNP test and the degree of expression, and is suitable for simple modification of disk devices such as a conventional CD-ROM. It is stated that it is possible by

As another prior patent, Korean Patent Publication No. 1020110073799 includes: 1) selecting a candidate SNP genotype for predicting anticancer drug susceptibility by correlating the results of the in vitro tumor reactivity test using the patient's tumor tissue and the SNP analysis result of the same patient; And (2) a nominal P-value of 0.1% or less among the selected genotypes, frequency of alleles in Asian genotypes, genotypes located in linkage disequilibrium blocks, htSNP (haplotype tagging SNP), functional SNPs, and A method for screening SNPs for predicting anticancer agent susceptibility is described, which includes selecting the SNP genotype in consideration of the Hardy-Weinberg equilibrium P value in the normal population.

The present invention has been conceived by the above necessity, and an object of the present invention is to provide a novel method for diagnosing single nucleotide polymorphism and a method capable of quantitatively diagnosing multiple mutation sites at the same time.

Another object of the present invention is to provide a novel composition for diagnosing single base polymorphism.

In order to achieve the above object, the present invention performs a hybridization reaction with the DNA to be measured for a specific peptide nucleic acid probe (PNA), and then cuts the DNA-PNA complex using enzymes or chemicals, and then is separated. It provides a method for detecting a single base polymorphism of a single mutation site or a multiple mutation site comprising the step of measuring the PNA mass by MALDI-TOF (Matrix-Assisted Laser Desorption/Ionization Time Of Flight).

In addition, the present invention provides a peptide nucleic acid probe (PNA) composition having the nucleotide sequence of SEQ ID NO: 5 to 7.

In addition, the present invention provides a primer composition having a nucleotide sequence of SEQ ID NO: 3 to 4.

In addition, the present invention provides a kit for diagnosing single base polymorphism comprising the above composition.

In addition, in the present invention, after a hybridization reaction with the DNA to be measured for the peptide nucleic acid probe (PNA), the formed DNA-PNA complex is cleaved using enzymes or chemicals, and the resulting PNA mass is MALDI- It provides a method for detecting or quantifying a single base polymorphism of a single mutation site or multiple mutation sites, including the step of measuring by TOF (Matrix-Assisted Laser Desorption/Ionization Time Of Flight).

In one embodiment of the present invention, the enzyme is preferably Benzonase Exonuclase, or Ribozyme, but is not limited thereto.

In another embodiment of the present invention, the chemical substance is preferably an oxidizing agent, more preferably KMnO ₄ , HOF, NH ₂ OH, or Piperidine, but is not limited thereto.

In a preferred embodiment of the present invention, the method is preferably for detecting drug resistance to a therapeutic agent for hepatitis B virus, and more preferably, lamivudine, adefovir, entecavir, or clevudine. It is for the detection of drug resistance to the hepatitis B virus therapeutic agent, but is not limited thereto.

In addition, the present invention is a specific peptide nucleic acid probe (PNA) consisting of C-PNA (Conserved PNA), WT-PNA (Wild Type PNA) and Mut-PNA (Mutant Type PNA) after hybridization reaction with sample DNA to be measured. , After cutting the DNA of the formed DNA-PNA complex using enzymes or chemicals, the mass of the separated PNA is measured by MALDI-TOF (Matrix-Assisted Laser Desorption/Ionization Time Of Flight), and the wild type and mutation of the sample DNA A single base polymorphism of a single mutation site or multiple mutation sites including the step of quantifying the peaks that appear different according to the template ratio by calculating the ratio of WT-PNA and Mut-PNA to C-PNA using the area values of each peak. Provides a method of quantification.

Hereinafter, the present invention will be described.

The present invention has developed a genetic diagnosis system using a mass spectrometry system of Peptide Nucleic Acid (PNA) and MALDI-TOF (Matrix-Assisted Laser Desorption/Ionization Time Of Flight).

In the present invention, after performing a hybridization reaction with the DNA for which PNA with high specificity is to be measured, the formed DNA-PNA complex is cleaved using an enzyme or a specific chemical, and then the separated PNA mass is MALDI-TOF (Matrix-Assisted). Laser Desorption/Ionization Time Of Flight).

As can be seen from the present invention, the present invention has the advantage of being able to quickly and accurately diagnose various diseases at once by using a small amount of sample.

1 is a schematic diagram of a hepatitis B diagnosis system.
2 is a graph showing a C-PNA detection test using a Mutant template.
3 is a graph showing a Mut-PNA detection test using a Mutant template.
4 is a graph showing a multiple PNA detection test using a Mutant template.
5 is a graph showing PNA MALDI detection for deriving a standard curve.
6 is a Standard Curve of WT-PNA (or Mut-PNA) compared to C-PNA.
7 is a graph showing PNA detection according to the ratio of wild and mutant template.
8 is a graph showing three MALDI detections of unknown samples.
9 is a quantitative curve according to the template ratio.

Hereinafter, the present invention will be described in more detail through non-limiting examples. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the examples.

Example One: Template And PNA probe making

1-1. DNA sequence design

(1) Wild type (WT) template sequence:

5'-CTGCACTTGTATTCCCATCCCATCATCCTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAG TCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGCAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCACTGTACTTTCTCTGT'ACTGTACTTT

(SEQ ID NO: 1)

(2)Mutant type (Mut) template sequence:: 5'-CTGCACTTGTATTCCCATCCCATCATCCTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAG

TCCGTTTCTCATGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATTGATGATGTGGTATTGGGGGCGAAGTCTGTACAACATCTTGAGTCCCTTTTTACCTCTATTACCAATTTTCTTTTG-3'

(SEQ ID NO: 2)

These templates are gene sequences that have drug resistance to lamivudine, a therapeutic agent for hepatitis B virus.

1-2. PCR product making

(1) Prepare two primers for synthesizing DNA.

Forward primer 5'-TTGCACTTGTATTCCCATCC-3' (SEQ ID NO: 3)

Reverse primer 5'- biotin-CAAAAGAAAATTGGTAATAGAGGTA -3' (SEQ ID NO: 4)

(2) Wild and mutant DNA production

: Add 10x reaction buffer, dNTP, template DNA (stock 100 ng/μl), forward primer, reverse primer, pfu polymerase, and DW to 0.2 ml PCR tube. Using a PCR (Polymerase Chain Reaction) device, denature at 94℃ for 5 minutes, proceed with 30 cycles of 94℃ denature for 30 seconds, 52℃ anneal for 30 seconds, and 72℃ extension for 30 seconds, and then extension at 72℃ for 7 minutes. do. The amplified PCR product is purified using a PCR purification kit.

1-3. PNA ( Peptide Nucleic Acid ) probe Design and production

(1)C-PNA(Conserved PNA) (Molecular weight: 2862.8)

: N-ATTCCTATGG-C (SEQ ID NO: 5)

(2)WT-PNA(Wild Type PNA) (Molecular weight: 2926.8)

: N-TATATGGATG-C (SEQ ID NO: 6)

(3)Mut-PNA(Mutant Type PNA) (Molecular weight: 2901.8)

: N-TATATTGATG-C (SEQ ID NO: 7)

The peptide nucleic acid probe (PNA) of the present invention was prepared by requesting PANAGENE, and the primer was prepared by requesting COSMOGENETECH.

Example 2 : Single PNA detection test

2-1. PCR product in ssDNA Separation

: Fill the empty column with Streptavidin sepharose bead 375 μl and remove the buffer from the inside using a syringe. Wash the column with 4 ml of 1x DPBS (Dulbecco's Phosphate Buffered Saline) buffer. The purified 225bp mutant template DNA is loaded onto the column. The DNA solution that has passed through the column is reloaded onto the column by repeating 3 times. Then, wash the column with 4 ml of DPBS and elution with 750 μl of 200 mM NaOH to separate ssDNA (Single Stranded DNA) without biotin. When loading NaOH on the column, use a syringe to slowly push it. When using a syringe, remove it from the column while pressing the plunger. Finally, wash the column with D.W.

2-2. Hybridization

: Resuspension the resin in the column with 50 μl of 1x SSPE (Salt, Sodium Phosphate, EDTA) buffer, and then transfer it to a 1.5 ml microcentrifuge tube. Prepare C-PNA and Mut-PNA for hybridization. Add C-PNA (or Mut-PNA), 1x SSPE buffer, and ssDNA attached to the resin to the PCR tube according to the concentration. After reacting the sample at 45°C for 30 minutes, it is transferred to ice.

2-3. Benzonase process

: Put the hybridized sample in the empty column and push it using a 10 ml syringe. Wash the column by adding 4 ml of DPBS buffer using a 10 ml syringe. After resuspension by adding 30 μl of benzonase buffer (50mM Ammonium bicarbonate (pH 7.0), 1mM MgCl ₂ ) to the resin in the column, transfer to a 1.5 ml microcentrifuge tube, add 0.3 μl of benzonase, and incubate at 37°C for 1 hour. After blowing the solvent out of the sample with a speed vacuum concentrator, add 10 μl of High Performance Liquid Chromatography (HPLC) grade water to perform resuspension.

2-4. MALDI Measure

: Matrix HCCA (α-Cyano-4-hydroxycinnamic acid) at 10 mg/ml in 70% ACN (Acetonitrile), 0.5% TFA (Trifluoroacetic Acid) concentration and HPA (3-Hydroxypicolinic acid) at 10 mg/ml in It is made with a concentration of 70% ACN and 0.1% TFA. HCCA and HPA are mixed well in a ratio of 1:2. Vortex for about 1 minute to mix the Matrix well. After mixing the matrix and sample in a ratio of 1:5, spot 1 μl on the MALDI plate. Samples are measured using AB SCIEX's 4800 MALDI TOF/TOF (Matrix-Assisted Laser Desorption/Ionization Time Of Flight) mass spectrometry.

2-5. Derivation of results

: As a result of measuring each sample by MALDI, as shown in Figs. 2 and 3, peaks appear at 2862, the original molecular weight of C-PNA, 2884, the salt form, and 2900, the molecular weight of Mut-PNA, and 2922, the salt form. It was confirmed that each PNA was detected in the sample.

Example 3: Multiple PNA detection test

3-1. PCR product in ssDNA Separation

: Fill the empty column with Streptavidin sepharose bead 375 μl and remove the buffer from the inside using a syringe. Wash the column with 4 ml of 1x DPBS buffer. The purified mutant template DNA is loaded onto the column. Repeat the DNA past the column 3 times and reload the column. Then, wash the column with 4 ml of DPBS and elution with 750 μl of 200 mM NaOH to separate ssDNA without biotin. When loading NaOH on the column, use a syringe to slowly push it. When using a syringe, remove it from the column while pressing the plunger. Finally, wash the column with D.W.

3-2. Hybridization

: Resuspension the resin in the column with 50 μl of 1x SSPE buffer and transfer it to an empty microcentrifuge tube. Prepare C-PNA and Mut-PNA for hybridization. Add C-PNA, Mut-PNA, 1x SSPE buffer, and ssDNA attached to the resin to the PCR tube according to the concentration. After reacting the sample at 45° C. for 30 minutes, it is transferred to ice.

3-3. Benzonase process

: Put the hybridized sample in the empty column and push it using a 10 ml syringe. Wash the column by adding 4 ml of DPBS buffer using a 10 ml syringe. After resuspension by adding 30 μl of benzonase buffer (50mM Ammonium bicarbonate (pH 7.0), 1mM MgCl ₂ ) to the resin in the column, transfer to a 1.5 ml microcentrifuge tube, add 0.3 μl of benzonase, and incubate at 37°C for 1 hour. After blowing off the sample solvent with a speed vacuum concentrator, add 10 μl of HPLC water to resuspension.

3-4. MALDI Measure

: Make Matrix HCCA to 10 mg/ml in 70% ACN, 0.5% TFA and HPA to 10 mg/ml in 70% ACN, 0.1% TFA. HCCA and HPA are mixed well in a ratio of 1:2. Vortex for about 1 minute to mix the Matrix well. After mixing the matrix and sample in a ratio of 1:5, spot 1 μl on the MALDI plate. Measure the sample using AB SCIEX's 4800 MALDI TOF/TOF mass spectrometry.

3-5. Derivation of results

: As a result of measuring the sample by MALDI, as shown in FIG. 4, peaks of 2862, the original molecular weight of C-PNA, 2884, the salt form, and 2900, the molecular weight of Mut2-PNA, and 2922, the salt form appear at the same time. It could be confirmed that all were detected.

Example 4: PNA standard curve

4-1. PNA mixture making

: Mix C-PNA and two PNAs (WT-PNA, Mut-PNA) in different ratios. C-PNA: WT-PNA: Mut-PNA (Stock 0.5 μM) = 0.1 μM: 0.1 μM: 0.1 μM, 0.1 μM: 75 nM: 75 nM, 0.1 μM: 50 nM: 50 nM, 0.1 μM: 25 nM: Make the ratio of 25 nM, 0.1 μM: 10 nM: 10 nM, respectively.

4-2. MALDI Measure

: Make Matrix HCCA to 10 mg/ml in 70% ACN, 0.5% TFA and HPA to 10 mg/ml in 70% ACN, 0.1% TFA. HCCA and HPA are mixed well in a ratio of 1:2. Vortex for about 1 minute to mix the Matrix well. After mixing the matrix and sample in a ratio of 1:5, spot 1 μl on the MALDI plate. Measure the sample using AB SCIEX's 4800 MALDI TOF/TOF mass spectrometry.

4-3. Derivation of results

: As a result of measuring with different concentration ratios of WT-PNA and Mut-PNA compared to C-PNA, it was confirmed that the intensity of the peak gradually decreased as the concentration of WT-PNA and Mut-PNA gradually decreased. Table 1 shows the results of calculating the ratio of WT-PNA and Mut-PNA to C-PNA using the area values of each peak. As a result of drawing a standard curve using this value, it was shown as shown in FIG. 7, and each equation was calculated as y = 0.013x -0.086 for WT-PNA and y = 0.016x -0.140 for Mut-PNA.

Example 5: PNA Quantitative curve derivation and unknown sample Measure

5-1. PCR product in ssDNA Separation

: Template DNA mixture (total 3880 ng) for quantitative experiments as follows: #1 wild template 100%, #2 wild template 75% + mutant template 25%, #3 wild template 50% + mutant template 50%, #4 Make 25% wild template + 75% mutant template, 100% #5 mutant template.

Unknown samples are made by arbitrarily setting the ratio of mutant template to wild template as 10: 9, 30: 7, 2: 8 as follows.

Fill the empty column with 150 μl of Streptavidin sepharose beads and remove the buffer from the inside using a syringe. Wash the column with 2 ml of 1x DPBS buffer. Load the 225bp PCR product mixture into each column. Repeat the sample past the column 3 times and reload the column. Wash the column with 2 ml of DPBS. Separate with ssDNA by elution with 300 μl of 200mM NaOH. When loading NaOH on the column, use a syringe to slowly push it. When using a syringe, separate it from the column while pressing the plunger. Wash the column with D.W.

5-2. Hybridization

: Resuspension the resin in the column with 50 μl of 1x SSPE buffer and transfer it to an empty microcentrifuge tube. Prepare C-PNA and Mut-PNA for hybridization. Add C-PNA, Mut-PNA, 1x SSPE buffer, and ssDNA attached to the resin to the PCR tube according to the concentration. After reacting the sample at 45°C for 30 minutes, it is transferred to ice.

5-3. Benzonase process

: Put the hybridized sample in the empty column and push it using a 10 ml syringe. Wash the column by adding 3 ml of DPBS buffer using a 10 ml syringe. After resuspension by adding 50 μl of benzonase buffer (50mM Ammonium bicarbonate (pH 7.0), 1mM MgCl ₂ ) to the resin in the column, transfer to a 1.5 ml microcentrifuge tube, add 0.5 μl of benzonase, and incubate at 37℃ for 1 hour. After blowing off the sample solvent with a speed vacuum concentrator, add 5 μl of HPLC grade water to resuspension.

5-4. MALDI Measure

: Make Matrix HCCA to 10 mg/ml in 70% ACN, 0.5% TFA and HPA to 10 mg/ml in 70% ACN, 0.1% TFA. HCCA and HPA are mixed well in a ratio of 1:2. Vortex for about 1 minute to mix the Matrix well. After mixing the matrix and sample in a ratio of 1:5, spot 1 μl on the MALDI plate. Samples are measured using AB SCIEX's 4800 MALDI TOF/TOF mass spectrometry.

5-5. Derivation of results

: As shown in FIG. 7, the MALDI result according to the ratio of the DNA template showed that the intensity of the Mut-PNA increased as the ratio of the mutant template gradually increased. The unknown sample also showed different peaks according to the ratio of wild and mutant templates.

The ratio of Mut-PNA to C-PNA according to the template ratio was shown in Table 2, and the quantification curve was linear up to 50% as shown in FIG. 9 and saturated after 50%. Looking at the unknown sample value, the ratio of 10:9 and 30:7 was calculated as the ratio of mutant template as 47.4 and 18.9%, which was somewhat similar to the expected value. In the case of 2:8, it was confirmed that the value of the mutant template was slightly higher because the ratio of the mutant template was saturated at 80%.

Table 1 is a table showing the ratio of WT-PNA and Mut-PNA to C-PNA.

Table 2 is a table showing the ratio of Mut-PNA to C-PNA according to Template %.

<110> DIATECH KOREA CO.,LTD. <120> System for diagnosing Single Nucleotide Polymorphism using Mass analysis <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 225 <212> DNA <213> Artificial Sequence <220> <223> Wild type(WT) template sequence <400> 1 ctgcacttgt attcccatcc catcatcctg ggctttcgca agattcctat gggagtgggc 60 ctcagtccgt ttctcctggc tcagtttact agtgccattt gttcagtggt tcgcagggct 120 ttcccccact gtttggcttt cagttatatg gatgatgtgg tattgggggc caagtctgta 180 caacatcttg agtcccttta tacctctatt accaattttc ttttg 225 <210> 2 <211> 225 <212> DNA <213> Artificial Sequence <220> <223> Mutant type(Mut) template sequence <400> 2 ctgcacttgt attcccatcc catcatcctg ggctttcgca agattcctat gggagtgggc 60 ctcagtccgt ttctcatggc tcagtttact agtgccattt gttcagtggt tcgtagggct 120 ttcccccact gtttggcttt cagttatatt gatgatgtgg tattgggggc gaagtctgta 180 caacatcttg agtccctttt tacctctatt accaattttc ttttg 225 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 ttgcacttgt attcccatcc 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 caaaagaaaa ttggtaatag aggta 25 <210> 5 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 5 attcctatgg 10 <210> 6 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 6 tatatggatg 10 <210> 7 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 7 tatattgatg 10

Claims (2)

A peptide nucleic acid probe (PNA) set composition represented by the nucleotide sequences of SEQ ID NOS: 5 to 7, and a primer set composition represented by the nucleotide sequences of SEQ ID NOS: 3 to 4, respectively. The kit according to claim 1, wherein said kit is a kit for detecting drug resistance to a hepatitis B virus therapeutic agent.

Images