KR101448802B1 - Coniochaeta velutina Strain KCTC12470BP degradating Galacto Fucoidan to Galacto Fuco Oligosaccharide - Google Patents
Coniochaeta velutina Strain KCTC12470BP degradating Galacto Fucoidan to Galacto Fuco Oligosaccharide Download PDFInfo
- Publication number
- KR101448802B1 KR101448802B1 KR1020130099816A KR20130099816A KR101448802B1 KR 101448802 B1 KR101448802 B1 KR 101448802B1 KR 1020130099816 A KR1020130099816 A KR 1020130099816A KR 20130099816 A KR20130099816 A KR 20130099816A KR 101448802 B1 KR101448802 B1 KR 101448802B1
- Authority
- KR
- South Korea
- Prior art keywords
- strain
- fucoidan
- present
- oligosaccharide
- galacto
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
- C08B37/0063—Glycosaminoglycans or mucopolysaccharides, e.g. keratan sulfate; Derivatives thereof, e.g. fucoidan
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/64—Xanthomonas
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
본 발명은 갈락토 푸코이단을 갈락토 푸코 올리고당으로 분해하는 코니오차이타 베루티나 균주 KCTC12470BP에 관한 것이다.
The present invention relates to a strain of KNTC12470BP which degrades galactofucoid to galactofucooligosaccharide.
우리나라 연안은 약 620여종의 각종 해조류가 다양하게 서식하고 있으며, 이중 다시마, 미역 등을 포함하는 130여 종의 갈조류에는 식품산업에 널리 사용되고 있는 기능성 다당류가 많이 존재하며 그 대표적인 것으로 한천(agar), 알긴산(alginic acid), 카라기난(carrageenan), 및 최근 생리활성이 검증되고 있는 푸코이단(fucoidan) 등이 있다.There are about 620 kinds of seaweeds in Korea, and there are many functional polysaccharides widely used in the food industry in about 130 species of brown algae including seaweed and seaweed. Agar, Alginic acid, carrageenan, and fucoidan, which have recently been tested for their physiological activity.
푸코이단은 기타 식이 섬유 다당인 알긴산, 카라기난, 라미나란 등과는 구조 및 생리적 작용이 다르고, 오히려 동물의 혈액응고 저해능이 있는 산성 다당인 헤파린과 구조 및 작용이 매우 유사하고 헤파린과 비교 시 약 40% 정도의 항혈액응고 및 혈액정화 활성을 나타낸다(Chizhov 등, Chordajlum Carbohydrates Res, 1999, vol.319, pp.108-119). 또한, 항염증(antiinflammatory), 항암(antitumor), 항바이러스(antiviral) 및 면역억제 (immunosuppressive) 등의 탁월한 생리활성능이 밝혀지고 있다(McClure 등, AIDA Res. Hum. Retroviruses, 1992, vol.8, pp.19-26; Nagumo와 Nishino, In Polysaccharides in Medicinal Applications, 1997, pp.545-574; Patankar 등, J. Biol. Chemi. 1993, vol.268, pp.21770-21776).Fucoidan is structurally and physiologically different from other dietary fiber polysaccharides such as alginate, carrageenan, and lamina nuran. It has a very similar structure and action to heparin, which is an acidic polysaccharide that has an inhibitory effect on the blood coagulation of animals. (Chizhov et al., Chordajlum Carbohydrates Res, 1999, vol.319, pp. 108-119). In addition, excellent physiological activities such as antiinflammatory, antitumor, antiviral and immunosuppressive activities have been found (McClure et al., AIDA Res. Hum. Retroviruses, 1992, vol.8 , pp. 19-26; Nagumo and Nishino, In Polysaccharides in Medicinal Applications, 1997, pp. 545-574; Patankar et al., J. Biol. Chem. 1993, vol. 268, pp.
그러나 이러한 고분자 푸코이단의 경우, 광범위한 기능성에도 불구하고, 높은 분자량, 점성 및 낮은 수용성으로 인해 인체 흡수율이 매우 낮아 실제 생체 내에서의 생리적 활성이 현저히 저하되는 것을 물론, 원료의 다양성과 제조공법의 변이 등에 따른 품질의 비균일성으로 인하여, 제품화의 한계 등의 문제점을 가지고 있다.However, in the case of such a polymeric fucoidan, due to its high molecular weight, viscosity and low water solubility, the human body absorption rate is very low, so that the physiological activity in the living body is remarkably reduced, and the variety of the raw material and the variation of the manufacturing method And there is a limitation in commercialization due to the nonuniformity of the quality due to such a problem.
반면, 항암활성, 항 HIV, 항혈액응고 작용 등은 모두 거대 분자량의 상태보다 작은 분자량(올리고당) 상태에서 활성이 증가한다고 보고되었다(Schaeffer 및 Krylov, Ecotoxicolgy Environmental Safety, 2000, vol.45, pp.208-227; Koyanagi 등, Biochemicl Pharmacology, 2003, vol.65, pp.173-179; Nishino 등, Phytochemistry, 1991, vol.30, pp.535-539).On the other hand, all of the anticancer activities, anti-HIV, and anti-coagulant activities have been reported to increase in the molecular weight (oligosaccharide) state rather than the macromolecular state (Schaeffer and Krylov, Ecotoxicolgy Environmental Safety, 2000, vol. 198-227; Koyanagi et al., Biochemicl Pharmacology, 2003, vol.65, pp.173-179; Nishino et al., Phytochemistry, 1991, vol.30, pp. 535-539).
따라서, 고분자 푸코이단을 저분자화 할 수 있는 기술은 고분자 푸코이단이 갖는 물성적 단점을 개선시켜 그 효과를 극대화시킴으로써, 고분자 푸코이단의 용도 확대 및 부가가치를 극대화할 수 있는 산업화를 위한 핵심 기술로서, 시급한 개발이 필요하다. 현재까지 공지된 푸코이단을 저분자화하는 방법은 크게 화학적 가수분해법과 효소를 이용한 효소 가수분해법이 있으며, 특히 효소 가수분해법을 사용한 푸코이단의 산업화는 매우 초기단계이다. 염산 등을 이용하는 화학적 가수분해법은 푸코이단의 글리코사이드 결합을 절단하여 저분자량의 푸코이단을 주로 생성하며, 강산을 포함한 유독한 다량의 화학약품의 사용으로 인해 제거과정이 미비할 경우, 인체에 유해한 문제가 있으며 화학적으로 푸코이단을 분해시키기 때문에 생리활성이 높은 활성형 올리고 푸코이단을 선택적으로 생산하는 것이 매우 어려워 아직 산업화에 적용되지 못하고 있다.Therefore, the technology that can lower the molecular weight of fucoidan is a key technology for industrialization that can maximize the use of polymeric fucoidan and maximize added value by maximizing the effect of polymeric fucoidan. need. Until now, the known methods of low molecular weight fucoidan are chemical hydrolysis and enzyme hydrolysis using enzymes. Especially, industrialization of Fucoidan using enzyme hydrolysis is very early stage. The chemical hydrolysis method using hydrochloric acid or the like cuts the glycoside bond of fucoidan to generate a low molecular weight fucoidan. When the removal process is insufficient due to the use of a large amount of a toxic chemical including strong acid, a harmful problem And it is very difficult to selectively produce active oligo fucoidan having high physiological activity because it decomposes fucoidan chemically, so that it is not yet applied to industrialization.
그러나 푸코이단 분해 효소 정제의 어려움 중 하나는 효소의 분해 기작에 관하여 알려진 것이 없고, 푸코이단 분해를 연구할 때 푸코이단의 원산지가 다르면 푸코이단의 구조가 다르기 때문에 조사 결과를 비교하기 어렵다는 것이다.However, one of the difficulties in purification of fucoidanase is that it is not known about the enzymatic degradation mechanism, and it is difficult to compare the results of the fucoidan decomposition studies because the structure of fucoidan is different when the origin of fucoidan is different.
푸코이단을 분해하는 효소들은 바다의 연체동물이나 박테리아에서 주로 보고되어 있다. 슈도모나스 아틀란티카 (Pseudomonas atlantica)와 슈도모나스 가라기노바(Pseudomonas carrageenova)라는 두 해양 미생물에서 푸코이단을 분해하여 환원당을 생산하는 능력이 처음 보고되었다(Yaphe and Morgan, Nature, 1959, vol.463, pp.761-762). 그 후 비브리오 속(Vibrio sp.) 및 슈도알테로모나스 시트레아(Pseudoalteromonas citrea)에서 분해효소가 발견되었다(Furukawa 등, Nippon Suisan Gakk. 1992, vol.58, pp.1499-1503; Furukawa 등, Biosci. Biotech. Biochem. 1992, vol.56, pp.1829-1834; Bakunina 등, Microbiology, 2002, vol.71, pp.41-47). 최근에 푸코이단 분해능을 가진 미생물의 연구가 활발히 진행되고 있으며, 플라보박테리아세애(Flavobacteriaceae)등 해양 미생물들이 발견되고 있다 (Takeshi 등, Marine Biotechnology, 2004, vol.6, pp.335-346; Urvantseva 등, Biochemistry and Microbiology, 2006, vol.42, pp.484-491; Descamps 등, Marine Biotechnology, 2005, vol.7, pp.1-13). 이러한 해양미생물뿐만 아니라 가리비나 전복 종류의 H. 루페센스(H. rufescens), H. 코루가타(H. corrugata), H. 지잔테아 (H. gigantea), P. 예소엔시스(P. yessoensis) 및 P. 막시무스(P. maximus)와 같은 연체동물에서도 푸코이단 분해능이 확인되었다(Thanassi와 Nakada, Arch. Biochem. Biophys. 1967, vol.118, pp.172-177; Tanaka와 Sorai, FEBS Letter, 1970, vol.9, pp.45-48; Kitamura 등, Biosci. Biotech. Biochem. 1992, vol.56, pp.490-494).Enzymes that degrade fucoidan are mostly reported in molluscs and bacteria of the sea. The ability to digest fucoidan and produce reducing sugars in two marine microorganisms, Pseudomonas atlantica and Pseudomonas carrageenova, was first reported (Yaphe and Morgan, Nature, 1959, vol.463, pp.761- 762). Then in Vibrio (Vibrio sp.) And Pseudomonas Alteromonas sheet Leah lyase from (Pseudoalteromonas citrea) have been found (such as Furukawa, Nippon Suisan Gakk 1992, vol.58, pp.1499-1503;. , Etc. Furukawa, Biosci Biotech. Biochem., 1992, vol.56, pp.1829-1834; Bakunina et al., Microbiology, 2002, vol.71, pp. 41-47). Recently, microorganisms having fucoidan resolution have been actively studied, and marine microorganisms such as Flavobacteriaceae have been found (Takeshi et al., Marine Biotechnology, 2004, vol.6, pp.335-346; Urvantseva et al. , Biochemistry and Microbiology, 2006, vol.42, pp.484-491; Descamps et al., Marine Biotechnology, 2005, vol.7, pp.1-13). In addition to these marine microorganisms, H. rufescens , H. corrugata , H. gigantea , P. yessoensis , Fucoidan degradation was also confirmed in molluscic animals such as P. maximus (Thanassi and Nakada, Arch. Biochem. Biophys. 1967, vol.118, pp. 172-177; Tanaka and Sorai, FEBS Letter, 1970 , vol.9, pp.45-48; Kitamura et al., Biosci. Biotech. Biochem., 1992, vol.56, pp. 490-494).
그러나, 상기 균주 및 연체동물 등에서 생산되는 푸코이단 분해 효소의 경우 효소반응을 통해 푸코 올리고당을 생성하는 수율이 매우 낮을 뿐만 아니라 균주자체의 안전성이나 연체동물에서의 대량생산 등의 애로점으로 인해 아직 산업적으로 활용되지 못하고 있는 실정이다.
However, in the case of the fucoidan degrading enzyme produced from the above strain and mollusk, the yield of fucooligosaccharide production through the enzyme reaction is very low, and it is still industrially utilized due to the safety of the strain itself and the mass production in mollusk animals It is a fact that it does not become.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.
본 발명자들은 항염증, 항암, 항바이러스 및 면역억제와 같은 광범위한 기능성에도 불구하고, 높은 분자량으로 인해 인체 흡수율이 낮은 갈락토 푸코이단을 인체 흡수가 용이한 중분자로 분해 할 수 있는 균주를 개발하고자 노력하였다. 그 결과, 갈락토 푸코이단을 갈락토 푸코 올리고당으로 분해하는 코니오차이타 베루티나(Coniochaeta velutina) 균주 KCTC12470BP를 규명함으로써, 본 발명을 완성하였다.The present inventors have sought to develop a strain capable of degrading galactofucoid, which has a low water uptake rate due to its high molecular weight, into an intermediate molecule capable of easily absorbing human body, despite its wide range of functions such as antiinflammation, anticancer, antiviral and immunosuppression . As a result, Coniochaeta, which degrades galactofucoid to galactofucooligosaccharide, velutina ) strain KCTC12470BP.
따라서, 본 발명의 목적은 코니오차이타 베루티나(Coniochaeta velutina) 균주 KCTC12470BP를 제공하는 데 있다.Accordingly, an object of the present invention is to provide a method for the treatment of coniochaeta velutina ) strain KCTC12470BP.
본 발명의 다른 목적은 갈락토 푸코 올리고당의 제조방법을 제공하는 데 있다.It is another object of the present invention to provide a process for producing galactofo-oligosaccharides.
본 발명의 또 다른 목적은 갈락토 푸코 올리고당을 제공하는 데 있다.
It is another object of the present invention to provide galactofuco oligosaccharides.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.
본 발명의 일 양태에 따르면, 본 발명은 갈락토 푸코이단을 갈락토 푸코 올리고당으로 분해하는 코니오차이타 베루티나(Coniochaeta velutina) 균주 KCTC12470BP를 제공한다.
According to one aspect of the present invention, there is provided a strain of Coniochaeta velutina KCTC12470BP which cleaves a galactofucoid to a galactofucooligosaccharide.
본 발명자들은 항염증, 항암, 항바이러스 및 면역억제와 같은 광범위한 기능성에도 불구하고, 높은 분자량으로 인해 인체 흡수율이 낮은 갈락토 푸코이단을 인체 흡수가 용이한 중분자로 분해 할 수 있는 균주를 개발하고자 노력하였다. 그 결과, 갈락토 푸코이단을 갈락토 푸코 올리고당으로 분해하는 코니오차이타 베루티나 균주 KCTC12470BP를 규명하였다.
The present inventors have sought to develop a strain capable of degrading galactofucoid, which has a low water uptake rate due to its high molecular weight, into an intermediate molecule capable of easily absorbing human body, despite its wide range of functions such as antiinflammation, anticancer, antiviral and immunosuppression . As a result, KCTC12470BP, which is a strain of Koniachaitarubutina, which degrades galactofucoid to galactofucooligosaccharide, was identified.
본 발명에서 코니오차이타 베루티나 균주 KCTC12470BP는 주로 갈조류(예컨대, 다시마, 미역, 톳 및 모자반)에 존재하는 갈락토 푸코이단을 갈락토 푸코 올리고당으로 분해한다.In the present invention, the conidiota iza verutiana strain KCTC12470BP decomposes the galactofucoid present mainly in brown algae (for example, seaweed, seaweed, sweet potato and mackerel) into galactofuco oligosaccharides.
상기 갈락토 푸코이단은 푸코이단의 한 종류로, 분자량이 200만이 넘는 점성이 있는 고분자이다. 고분자의 푸코이단을 약제학적 조성물로 사용하는 경우 모세혈관 폐쇄가능성과 같은 문제점이 있다. 푸코이단의 구조와 활성은 갈조류를 채취하는 시기, 지역 및 갈조류의 종류에 따라 달라진다. 대부분의 푸코이단은 약 70% 정도가 푸코즈(fucose)로 이루어져 있지만, 상기 갈락토 푸코이단은 푸코즈 약 40-60 중량% 및 갈락토즈(Galactose) 약 40-60 중량% 포함한다.The galactofucoidan is a kind of fucoidan and is a viscous polymer having a molecular weight of more than 2,000,000. When a fucoidan of a polymer is used as a pharmaceutical composition, there are problems such as capillary closure possibility. The structure and activity of fucoidan depends on the time of harvesting brown algae, the area and the type of brown algae. Most of the fucoidans comprise about 40% to about 60% fucose and about 40% to about 60% galactose, although about 70% of the fucoidans are composed of fucose.
상기 갈락토 푸코이단은 당업계에서 통상적으로 사용하는 방법에 의해 수득할 수 있다. The galactofucoidan can be obtained by a method commonly used in the art.
본 발명의 일 구현예에 따르면, 본 발명의 갈락토 푸코이단은 갈조류로부터 추출한다. 본 발명의 다른 구현예에 따르면, 본 발명의 갈락토 푸코이단은 미역으로부터 추출한다. 본 발명의 특정 구현예에 따르면, 본 발명의 갈락토 푸코이단은 한국산 미역귀(Undaria pinnatifida sporophyll)로부터 추출한다.According to one embodiment of the present invention, the galactofucoid of the present invention is extracted from brown algae. According to another embodiment of the present invention, the galactofucoid of the present invention is extracted from marine algae. According to some embodiments of the present invention, the Lactobacillus of the present invention, Fucoidan-going Korean miyeokgwi (Undaria pinnatifida sporophyll).
본 발명에서 코니오차이타 베루티나 균주 KCTC12470BP는 갈락토 푸코이단을 갈락토 푸코 올리고당으로 분해한다.In the present invention, the conidiota tea strain KCTC12470BP decomposes galactofucoid to galactofucooligosaccharide.
상기 갈락토 푸코 올리고당은 일반적으로 2 내지 20 개의 단당으로 이루어진 황산기를 가진 수용성 다당이다. 거대 분자량을 갖는 푸코이단보다 적은 분자량의 갈락토 푸코 올리고당은 모세혈관 폐쇄가능성이 없어 주사제로도 사용이 가능하다.The galactofuco oligosaccharide is a water-soluble polysaccharide having a sulfate group generally comprising 2 to 20 monosaccharides. Galactofuco oligosaccharides with lower molecular weight than fucoidan with macromolecular weight are not likely to capillary closure and can be used as injections.
본 발명의 일 구현예에 따르면, 상기 갈락토 푸코 올리고당은 1.5×105 내지 1.8×105 Da의 분자량을 갖는다. 본 발명의 다른 구현예에 따르면, 상기 갈락토 푸코 올리고당은 1.55×105 내지 1.75×105 Da의 분자량을 갖는다. 본 발명의 특정 구현예에 따르면, 상기 갈락토 푸코 올리고당은 1.6×105 내지 1.7×105 Da의 분자량을 갖는다.According to one embodiment of the present invention, the galactofuco oligosaccharide has a molecular weight of 1.5 × 10 5 to 1.8 × 10 5 Da. According to another embodiment of the present invention, the galactofuco oligosaccharide has a molecular weight of 1.55 × 10 5 to 1.75 × 10 5 Da. According to a specific embodiment of the present invention, the galactofuco oligosaccharide has a molecular weight of 1.6 x 10 5 to 1.7 x 10 5 Da.
본 발명의 코니오차이타 베루티나 균주 KCTC12470BP에 의해 제조된 갈락토 푸코 올리고당은 갈락토 푸코이단의 생리적 활성을 유지한다.The galactofuco oligosaccharide prepared by the conidioma ita verutiana strain KCTC12470BP of the present invention maintains the physiological activity of galactofucoid.
본 발명의 일 구현예에 따르면, 상기 갈락토 푸코 올리고당은 2개의 S=O 결합 부위를 갖는다. 이는 상기 갈락토 푸코 올리고당이 칼락토 푸코이단의 생리적 활성을 유지하고 있음을 의미한다.According to one embodiment of the present invention, the galactofuco oligosaccharide has two S = O bond sites. This means that the galactofuco oligosaccharide maintains the physiological activity of the cholesterol fucoidan.
본 발명의 코니오차이타 베루티나 균주 KCTC12470BP에 의해 생산된 갈락토 푸코 올리고당의 성분당 함량은 푸코오스 54 중량%, 갈락토오스 44 중량%, 자일로오스(xylose) 0.5 중량% 및 만노오스(mannose) 0.4 중량%이다. 이러한 성분당 함량은 갈락토 푸코이단과 유사하며, 탄소(C), 수소(H), 질소(N) 및 황상(S) 함량에도 갈락토 푸코이단과 유사하다(도 6a 및 도 6b).The content of galactofructooligosaccharide produced by the conidiota ita verutiana strain KCTC12470BP of the present invention was 54% by weight of fucose, 44% by weight of galactose, 0.5% by weight of xylose and 0.4% by weight of mannose %to be. These intracellular sugar contents are similar to galactofucoidan and are similar to galactofucoidan in carbon (C), hydrogen (H), nitrogen (N) and sulfur (S) contents (FIGS. 6A and 6B).
본 발명자들에 의해 토양에서 분리되고, 갈락토 푸코이단을 갈락토 푸코 올리고당으로 분해할 수 있는 효소를 보유한 균주는 코니오차이타 베루티나에 속하는 신규 미생물로 분류하여 “Coniochaeta velutina PF-2”로 명명하고 2013년 8월 13일자로 한국생명공학연구원내 미생물자원센터(Korean Collection for Type Cultures, KCTC)에 기탁하여 기탁번호 KCTC12470BP를 부여받았다.
The strain isolated from the soil by the present inventors and having an enzyme capable of degrading galactofucoid to galactofuco oligosaccharide was classified as a new microorganism belonging to the genus Conychaitaverutina and designated as " Coniochaeta named velutina PF-2 "and deposited by the Korea Research Institute of Bioscience and Biotechnology Microbial Resources Center (Korean Collection for Type Cultures, KCTC ) on August 13, 2013, it was given an accession number KCTC12470BP.
본 발명의 다른 양태에 따르면, 본 발명은 다음의 단계를 포함하는 갈락토 푸코 올리고당의 제조방법을 제공한다:According to another aspect of the present invention, the present invention provides a process for preparing galactofo-oligosaccharides comprising the steps of:
(a) 상기 제 1 항 내지 제 3 항 중 어느 한 항의 코니오차이타 베루티나 균주 KCTC12470BP를 갈락토 푸코이단을 포함하는 배양 배지에서 배양하는 단계; 및(a) culturing the conidia Itaerutina strain KCTC12470BP of any one of
(b) 상기 배양 배지로부터 갈락토 푸코 올리고당을 수득하는 단계.(b) obtaining galactofucooligosaccharides from the culture medium.
본 발명의 코니오차이타 베루티나 균주 KCTC12470BP는 배양 배지에서 배양한다.The conidia Itaerutina strain KCTC12470BP of the present invention is cultured in a culture medium.
본 발명의 일 구현예에 따르면, 상기 배양 배지는 갈락토 푸코이단 및 질소원을 포함하는 최소배지 또는 포테이토 덱스트로즈(potato dextrose) 배지이다.According to one embodiment of the present invention, the culture medium is a minimal medium or a potato dextrose medium containing galactofucoid and a nitrogen source.
상기 최소배지에 포함되는 질소원은 펩톤, KNO3, (NH4)2SO4 또는 NH4NO3이고, 이에 한정되지 않는다.The nitrogen source included in the minimal medium is peptone, KNO 3 , (NH 4 ) 2 SO 4 or NH 4 NO 3 , but is not limited thereto.
상기 포테이토 덱스트로즈 배지는 포테이토 및 덱스트로즈를 포함한다.The potato dextrose medium includes potato and dextrose.
상기 배양배지의 pH는 pH 5.0 내지 pH 10.0, pH 6.0 내지 pH 8.0 또는 pH 6.5 내지 pH 7.5이다.The pH of the culture medium is pH 5.0 to pH 10.0, pH 6.0 to pH 8.0, or pH 6.5 to pH 7.5.
본 발명의 방법은 상기 코니오차이타 베루티나 균주 KCTC12470BP를 이용하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
Since the method of the present invention uses the above-mentioned conidia mutant strain KCTC12470BP, the description common to both of them is omitted in order to avoid the excessive complexity of the present specification.
본 발명의 또 다른 구현예에 따르면, 본 발명은 갈락토 푸코 올리고당을 제공한다.According to another embodiment of the present invention, the present invention provides galactopo oligosaccharides.
본 발명의 갈락토 푸코 올리고당은 항혈액 응고작용, 항스트레스, 콜레스테롤 저하작용, 항종양 작용이 우수하여 식품 조성물, 기능성 식품 조성물 또는 약제학적 조성물로 적용될 수 있다.The galactofuco oligosaccharide of the present invention is excellent in anti-blood coagulation action, anti-stress, cholesterol lowering action, antitumor action, and can be applied as a food composition, a functional food composition or a pharmaceutical composition.
본 발명의 갈락토 푸코 올리고당을 유효성분 포함하는 식품 조성물로 제조되는 경우, 유효성분으로서 갈락토 푸코 올리고당뿐 만 아니라, 식품 제조 시에 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스, 올리고당 등; 및 폴리사카라이드, 예를 들어 덱스트린, 사이클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연 향미제 [타우마틴, 스테비아 추출물 (예를 들어 레바우디오시드 A, 글리시르히진 등]) 및 합성 향미제(사카린, 아스파르탐 등)를 사용할 수 있다. 예컨대, 본 발명의 식품 조성물이 드링크제로 제조되는 경우에는 본 발명의 갈락토 푸코 올리고당 이외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙, 두충 추출액, 대추 추출액, 감초 추출액 등을 추가로 포함시킬 수 있다.
When the galactofuco oligosaccharide of the present invention is prepared from a food composition containing an active ingredient, it contains not only galactofucooligosaccharide as an active ingredient, but also components normally added in food production, for example, a protein, a carbohydrate , Fats, nutrients, flavoring agents, and flavoring agents. Examples of the above-mentioned carbohydrates are monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And polysaccharides such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavorings such as tau martin and stevia extract (e.g., rebaudioside A and glycyrrhizin) and synthetic flavorings (saccharine, aspartame, etc.) can be used as flavorings. For example, when the food composition of the present invention is prepared as a drink, it may further contain, in addition to the galactofucooligosaccharide of the present invention, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, .
본 발명의 갈락토 푸코 올리고당이 기능성 식품 조성물로 제조되는 경우, 식품 제조 시 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소 및 조미제를 포함한다. 예컨대, 드링크제로 제조되는 경우에는 유효성분으로서 갈락토 푸코 올리고당 이외에 향미제 또는 천연 탄수화물을 추가 성분으로 포함시킬 수 있다. 예를 들어, 천연 탄수화물은 모노사카라이드(예컨대, 글루코오스, 프럭토오스 등); 디사카라이드(예컨대, 말토스, 수크로오스 등); 올리고당; 폴리사카라이드(예컨대, 덱스트린, 시클로덱스트린 등); 및 당알코올(예컨대, 자일리톨, 소르비톨, 에리쓰리톨 등)을 포함한다. 향미제로서 천연 향미제(예컨대, 타우마린, 스테비아 추출물 등) 및 합성 향미제(예컨대, 사카린, 아스파르탐 등)을 이용할 수 있다.
When the galactofuco oligosaccharide of the present invention is prepared from a functional food composition, it includes components that are ordinarily added in food production, and includes, for example, proteins, carbohydrates, fats, nutrients, and seasonings. For example, in the case of a drink, a flavoring agent or a natural carbohydrate may be added as an additional ingredient in addition to galactofucooligosaccharide as an active ingredient. For example, natural carbohydrates include monosaccharides (e.g., glucose, fructose, etc.); Disaccharides (e.g., maltose, sucrose, etc.); oligosaccharide; Polysaccharides (e.g., dextrin, cyclodextrin and the like); And sugar alcohols (e.g., xylitol, sorbitol, erythritol, etc.). Natural flavoring agents (e.g., tau marin, stevia extract, etc.) and synthetic flavoring agents (e.g., saccharin, aspartame, etc.) may be used as flavorings.
본 발명의 갈락토 푸코 올리고당을 유효성분으로 포함하는 약제학적 조성물로 제공되는 경우, 본 발명의 조성물은 (a) 상술한 본 발명의 갈락토 푸코 올리고당의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 약제학적 조성물이다. 본 명세서에서 용어 “약제학적 유효량”은 상술한 갈락토 푸코 올리고당의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.When provided as a pharmaceutical composition comprising the galactofructooligosaccharide of the present invention as an active ingredient, the composition of the present invention comprises (a) a pharmaceutically effective amount of the above-mentioned galactofucooligosaccharide of the present invention; And (b) a pharmaceutically acceptable carrier. As used herein, the term " pharmaceutically effective amount " means an amount sufficient to achieve efficacy or activity of the galactofucooligosaccharide described above.
본 발명의 조성물이 약제학적 조성물로 제조되는 경우, 본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함한다. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.When the composition of the present invention is manufactured from a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).
본 발명의 약제학적 조성물은 경구 또는 비경구 투여할 수 있으며, 바람직하게는 비경구 투여 방식으로 적용된다.The pharmaceutical composition of the present invention can be administered orally or parenterally, and is preferably parenterally administered.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 일반적인 투여량은 성인 기준으로 0.001-100 ㎎/kg 범위 내이다.The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Typical dosages of the pharmaceutical compositions of this invention are in the range of 0.001-100 mg / kg on an adult basis.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or in the form of excipients, powders, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.
본 발명의 특징 및 이점을 요약하면 다음과 같다: The features and advantages of the present invention are summarized as follows:
(a) 본 발명은 갈락토 푸코이단을 갈락토 푸코 올리고당으로 분해하는 코니오차이타 베루티나(Coniochaeta velutina) 균주 KCTC12470BP 및 상기 균주를 이용한 갈락토 푸코 올리고당의 제조방법을 제공한다.(a) The present invention relates to a method for producing a galactofuco- oligosaccharide from a coniochaeta velutina strain KCTC12470BP and a method for producing galactofo-oligosaccharides using the strain.
(b) 본 발명의 갈락토 푸코 올리고당은 항혈액 응고, 항스트레스, 콜레스테롤 저하, 항암 활성과 같은 다양한 기능을 갖는다.(b) The galactofuco oligosaccharides of the present invention have various functions such as anti-blood coagulation, anti-stress, cholesterol lowering, and anticancer activity.
(c) 본 발명의 갈락토 푸코 올리고당은 갈조류 유래로 수급이 용이하다.
(c) The galactofuco oligosaccharide of the present invention is easy to supply and receive from brown algae.
도 1a 및 도 1b는 선별된 6 종 갈락토 푸코이단 분해 균주의 특성을 조사한 결과를 나타낸다. 도 1a는 상기 갈락토 푸코이단 분해 균주의 성장곡선을 나타내고, 도 1b는 갈락토 푸코이단의 분해능을 시간별로 측정한 결과이다.
도 2는 갈락토 푸코이단 분해 균주 PF-2를 배양한 후 배양 여액과 균주 각각의 갈락토 푸코이단 분해능을 나타낸다.
도 3은 갈락토 푸코이단 분해 균주 PF-2에 의한 갈락토 푸코이단의 분해능을 HPLC로 분석한 결과를 나타낸다.
도 4는 갈락토 푸코이단 분해 균주 PF-2에 의해 생성된 갈락토 푸코 올리고당의 분자량을 나타낸다. 상기 갈락토 푸코 올리고당의 분자량은 약 1.67×105 Da이다.
도 5는 갈락토 푸코이단과 갈락토 푸코 올리고당의 적외선 분광법(FT-IR)을 이용하여 구조를 비교한 그래프를 나타낸다.
도 6a 및 도 6b는 갈락토 푸코 올리고당의 성분당 분석을 비교한 그래프를 나타낸다. 도 6a는 HPEAC-PAD를 이용한 성분분석이고, 도 6b는 원소분석 및 성분당의 mol %를 나타낸다.
도 7a 및 도 7b는 갈락토 푸코이단 분해 균주 PF-2의 염기서열 분석 결과를 나타낸다. 도 7a는 Coniochaeta velutina strain Jong107, Coniochaeta velutina strain JongS13, Coniochaeta velutina strain Jong108 및 Coniochaeta sp. 1 ICMP 18912와의 염기서열을 얼라인(align)한 결과를 보여주고, 도 7b는 염기서열 분석 결과에 따른 계통도를 나타낸다.
도 8은 본 발명의 갈락토 푸코이단 분해 균주 PF-2의 주사전자현미경(SEM) 사진을 나타낸다.FIGS. 1A and 1B show the results of investigating the characteristics of the selected six-type galactofucoidan degrading strains. FIG. 1A shows a growth curve of the galactofucoidan-degrading strain, and FIG. 1B shows the results of measuring the resolving power of galactofucoid in time.
FIG. 2 shows the ability of the culture filtrate and the strain to degrade the galactofucoidan after culturing the galactofucoidan-degrading strain PF-2.
Fig. 3 shows the results of analysis of the resolving ability of galactofucoidan by galactofucoidan-degrading strain PF-2 by HPLC.
4 shows the molecular weight of the galactofuco oligosaccharide produced by the galactofucoidan-degrading strain PF-2. The molecular weight of the galactofuco oligosaccharide is about 1.67 x 10 5 Da.
FIG. 5 shows a graph comparing the structures of galactofucoid and galactofucooligosaccharides using infrared spectroscopy (FT-IR).
Figures 6A and 6B show graphs comparing the analysis of galactofuco oligosaccharide per sex. FIG. 6A is a component analysis using HPEAC-PAD, and FIG. 6B shows elemental analysis and mol% per component.
7A and 7B show the nucleotide sequence analysis results of the galactofucoidan-degrading strain PF-2. FIG. 7A is a cross- velutina strain Jong107, Coniochaeta velutina strain JongS13, Coniochaeta velutina strain Jong108 and Coniochaeta sp. 1 shows the result of aligning the nucleotide sequence with
8 is a scanning electron microscope (SEM) photograph of the galactofucoidan-degrading strain PF-2 of the present invention.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .
실시예 1: 한국산 미역귀로부터 갈락토 푸코이단의 추출 및 정제Example 1: Extraction and purification of galactofucoid from Korean mycelia
실험에 사용한 갈락토 푸코이단은 국내 완도산 미역귀(Undaria pinnatifida sporophyll)로부터 추출하여 사용하였다.Galactofucoidan was extracted from Undaria pinnatifida sporophyll in Korea.
갈락토 푸코이단은 0.1 N HCl에 분쇄(3×3 ㎝)된 미역귀 250 g을 첨가하여 상온에서 24시간 동안 추출하였다. 이를 여액 및 침전물로 여과하여 수득한 여액을 NaOH로 중화한 후, 수득한 침전물을 동일 방법으로 재차 여과하였다. 여과한 여액에 3배 용량의 95% 에탄올을 첨가한 후 원심분리(6,000 rpm, 30분)로 회수하여 증류수에 용해시켰다. 용해 시 pH 2로 조정한 후 침전물을 용해하고 여기에 CaCl2을 최종농도가 4 M이 되도록 첨가하였다. 침전물을 동일한 방법으로 원심분리로 제거한 후 상등액에 다시 3배 용량의 95% 에탄올을 첨가하여 재침전시켰다. 재침전물을 원심분리로 회수한 다음, 증류수에 녹여 중화시켜 4℃에서 48시간 동안 투석(MWCO 14,000)한 것을 동결건조하여 푸코이단을 회수하였다. DEAE-셀룰로오스 컬럼(3×42 ㎝, Sigma)에 조정제 푸코이단 100 ㎎을 증류수에 녹여 주입하여 갈락토 푸코이단을 정제하였다. 시료의 용출은 증류수에 NaCl을 0.5 M, 1.0 M, 1.5 M, 2.0 M, 2.5 M, 및 3.0 M이 되게 각각 녹인 용출액으로 당이 검출되지 않을 때까지 단계적으로 용출시켰다. 용출액을 분취기로 8 ㎖씩 모은 후 페놀-황산법으로 490 ㎚에서 흡광도를 측정하였다. 각 시료의 분획을 합쳐 증류수에 24시간 투석한 후 농축하여 동결건조 하였다.
The galactofucoidan was extracted by adding 250 g of finely ground (3 x 3 cm) to 0.1 N HCl at room temperature for 24 hours. The filtrate obtained by filtration with the filtrate and precipitate was neutralized with NaOH, and the obtained precipitate was filtered again by the same method. To the filtrate, 3 times volume of 95% ethanol was added, and the mixture was recovered by centrifugation (6,000 rpm, 30 minutes) and dissolved in distilled water. After dissolution, the pH was adjusted to 2, the precipitate was dissolved, and CaCl 2 was added thereto so as to have a final concentration of 4M. The precipitate was removed by centrifugation in the same manner and then re-precipitated by the addition of 3 volumes of 95% ethanol to the supernatant. The precipitate was recovered by centrifugation, neutralized by distilled water, dialyzed at 4 ° C for 48 hours (MWCO 14,000), and lyophilized to recover the fucoidan. The galactofucoid was purified by dissolving 100 mg of the fucoidan as an adjusting agent in distilled water into a DEAE-cellulose column (3 x 42 cm, Sigma). The elution of the sample was eluted in a stepwise manner until no sugar was detected in the eluate which was dissolved in distilled water so that NaCl was 0.5 M, 1.0 M, 1.5 M, 2.0 M, 2.5 M, and 3.0 M, respectively. After collecting 8 ml of the eluate by an aliquot, absorbance was measured at 490 nm by phenol - sulfuric acid method. Fractions of each sample were combined, dialyzed against distilled water for 24 hours, concentrated and lyophilized.
실시예 2: 갈락토 푸코이단 분해균의 선별 및 갈락토 푸코이단 분해능 측정Example 2: Selection of galactofucoidan degrading bacteria and determination of galactofucoidal decomposition ability
2-1. 갈락토 푸코이단 분해균의 분리2-1. Isolation of galactofucoidan-degrading bacteria
갈락토 푸코이단에 대해 분해능을 가진 균주를 탐색하기 위해 토양에서 총 15 개의 시료를 채취하였다. 채취한 시료에서 갈락토 푸코이단 분해 균주를 분리배양하기 위해 사용된 배지의 조성은 다음과 같다. 0.5%(w/v) 갈락토 푸코이단 및 0.5%(w/v) 펩톤을 첨가한 후 pH 7.0로 맞추었다. 이를 멸균한 다음 각 토양 시료를 배양액의 10%(w/v)가 되도록 첨가한 후 150 rpm으로 30℃에서 9일 동안 배양하였다. 상기 배양액과 같은 조성 및 1.5%(w/v) 한천을 첨가한 한천 평판배지에 각각 100 ㎕씩 도말한 후 30℃에서 4-5일 동안 배양하여 성장이 우수한 16개의 균주를 분리하였다. 16개 균주를 한천을 제외한 액체 배양액에서 150 rpm으로 30℃에서 3일 동안 배양한 후 이 배양액을 100℃에서 10분 동안 처리하여 균의 증식 및 효소활성을 저지하고 푸코이단 분해능을 측정하였다. 분해능의 측정은 Somogyi-Nelson 법(Chaplin 및 Kennedy, In Carbohydrate Analysis, 3-4, 1994)으로 후술되는 ‘실시예 2-2’와 같이 실시하여 환원당을 측정하였다.
A total of 15 samples were collected from the soil in order to search for a strain having a resolution for the galactofucoid. The composition of the medium used to isolate the galactofucoidan-degrading strain from the collected samples is as follows. After adding 0.5% (w / v) galactofucoidan and 0.5% (w / v) peptone, the pH was adjusted to 7.0. After sterilization, each soil sample was added to 10% (w / v) of the culture solution and cultured at 150 rpm at 30 ° C for 9 days. 100 .mu.l of the same culture medium and 1.5% (w / v) agar-added agar plate medium were plated at 100 .mu.l each and cultured at 30.degree. C. for 4-5 days to isolate 16 strains with excellent growth. Sixteen strains were cultured in liquid culture medium except agar at 150 rpm for 3 days at 30 ° C. After incubation at 100 ° C. for 10 minutes, bacterial growth and enzyme activity were inhibited and fucoidan resolution was measured. The measurement of the resolution was carried out according to the Somogyi-Nelson method (Chaplin and Kennedy, In Carbohydrate Analysis, 3-4, 1994) as in Example 2-2 described below to determine the reducing sugar.
2-2. 갈락토 푸코이단 분해균의 갈락토 푸코이단 분해능 측정2-2. Determination of galactofucoidal decomposition ability of galactofucoidan degrading bacteria
0.5%(w/v) 갈락토 푸코이단 및 0.5%(w/v) 펩톤을 첨가한 후 pH 7.0로 조정하였다. 이 배지를 멸균한 후 앞서 분리한 16개의 균주를 각각 접종하였다. 3일 동안 배양한 후 1 ㎖의 배양액을 취하고 원심분리 후 100℃로 가열하여 반응을 정지시켰다. 200 ㎕의 배양액에 1 ㎖의 Somogyi 시약을 첨가하고 100℃에서 5분 동안 가열한 후 실온으로 냉각하고 1 ㎖의 Nelson 시약을 첨가하였다. 이를 12,000 rpm으로 10초 동안 원심분리한 후 분광광도계로 510 ㎚에서 흡광도를 측정하여 이를 효소활성으로 환산하였으며 표준당으로는 L-푸코오스 용액을 사용하였다. 상기와 같은 방법으로 최초 16 분리 균들로부터 갈락토 푸코이단 분해능이 우수한 균을 선별하였다.After adding 0.5% (w / v) galactofucoidan and 0.5% (w / v) peptone, the pH was adjusted to 7.0. After sterilizing the medium, each of the 16 strains isolated in the previous step was inoculated. After culturing for 3 days, 1 ml of culture was taken, centrifuged, and the reaction was stopped by heating to 100 ° C. 1 ml of the Somogyi reagent was added to 200 占 퐇 of the culture solution, heated at 100 占 폚 for 5 minutes, cooled to room temperature, and 1 ml of Nelson reagent was added. After centrifugation at 12,000 rpm for 10 seconds, the absorbance at 510 nm was measured with a spectrophotometer and converted to enzyme activity. L-fucose solution was used as a standard sugar. In the same manner as above, bacteria having excellent ability of resolving galactofucoidan from the first 16 isolates were selected.
그 결과, 갈락토 푸코이단 분해능이 가장 우수한 1개의 균주를 최종 선별하였다(도 1). 일례로서 분리균 1-1, 8-1, 10 및 15 등은 분리 과정에서 임의로 붙여진 분해균의 이름이며, 상기 분리균 15를 PF-2로 명명하였다. 환원당 측정 결과 PF-2가 다른 균들과 비교해 보았을 때, 약 2배 정도 환원당 값이 높게 나타났으며 갈락토 푸코이단 분해능이 가장 우수한 균주를 선별하였다. 상기 균주는 2013년 8월 13일자로 한국생명공학연구원 미생물자원센터에 기탁하여 기탁번호 KCTC12470BP를 부여받았다.
As a result, one strain having the best galactofucoidan resolution was finally selected (Fig. 1). As an example, the isolates 1-1, 8-1, 10, and 15 are names of degrading bacteria randomly attached in the separation process, and the isolate 15 is named PF-2. As a result of the measurement of reducing sugar, PF-2 showed about 2-fold higher reducing sugar value than other microorganisms and selected the strain with the best galactofucoidan resolution. The above strain was deposited on August 13, 2013 with the microorganism resource center of the Korea Research Institute of Bioscience and received the deposit number KCTC12470BP.
실시예Example 3: 3: 갈락토Galactto 푸코이단Fucoidan 분해균주Decomposition strain PFPF -2의 효소 반응 위치 탐색-2 enzyme reaction site search
갈락토 푸코이단 분해능이 있는 분해 균주 PF-2를 500 ㎖의 최소배지 (0.5%(w/v) 갈락토 푸코이단 및 0.5%(w/v) 펩톤)에서 배양하였다. 배양물을 원심분리하여 상등액과 침전물은 PF-2 세포 자체를 따로 모아서 0.2% 갈락토 푸코이단과 반응 후 Somogiy-Nelson 방법을 이용하여 환원당을 측정하였다(도 2). 측정 결과 PF-2 세포(침전물)에서는 환원당 값이 거의 나오지 않았지만, 상등액에서는 1 일 까지 환원당 값이 증가하였다. 이는 갈락토 푸코이단을 분해하는 PF-2의 효소는 PF-2 세포로부터 분비되어 갈락토 푸코이단과 반응하는 것을 알 수 있었다.
The degrading strain PF-2 with galactofucoidan resolution was cultured in 500 ml of minimal medium (0.5% (w / v) galactofucoid and 0.5% (w / v) peptone). The culture was centrifuged, and the supernatant and the precipitate were collected separately from PF-2 cells, reacted with 0.2% galactofucoid, and then measured for reducing sugar using the Somogy-Nelson method (FIG. 2). As a result, the reducing sugar value of PF-2 cells (precipitate) was almost not increased, but the reducing sugar value of the supernatant was increased to 1 day. This suggests that the enzyme of PF-2, which degrades galactofucoid, is secreted from PF-2 cells and reacts with galactofucoid.
실시예Example 4: 4: HPLCHPLC 를 이용한 Using PFPF -2 -2 갈락토Galactto 푸코이단Fucoidan 분해 산물의 분석 Analysis of decomposition products
갈락토 푸코이단 분해균주 PF-2를 0.5% 펩톤 및 0.5% 갈락토 푸코이단을 함유한 배지 1ℓ에서 3일 동안 배양한 후 원심분리하여 상등액을 취하였다. 상등액에 75% 에탄올 처리(분해되지 않은 푸코이단 제거)하여 원심분리한 후 상등액을 농축, 동결건조 하여 갈락토 푸코 올리고당을 획득하였다. HPLC(High-performance liquid chromatography, Dionex)를 이용한 푸코 올리고당 측정은 Shodex OHpak SB-805HQ(MW: -4 x 106 Da, 8.0×300 ㎜, Showa, Japan) 및 ELSD(Evaporative light scattering detector, Alltech)를 사용하여 확인하였다. 1% 갈락토 푸코 올리고당을 증류수에 용해하여 분석하였다. 용출용매는 증류수이고 유속은 0.8 ㎖/분으로 하였다. 도 3은 생성된 갈락토 푸코 올리고당을 HPLC로 분석한 결과를 나타낸 것이다. A는 갈락토 푸코이단과 표준물질로 사용하는 풀루란(pullulan)을 분자량(404, 212, 112, 47, 22 kDa) 별로 측정하였으며, B 는 효소 반응 후 75% 에탄올을 처리하여 분석한 것이다. 갈락토 푸코이단 분해 균에 의해 갈락토 푸코이단이 분해되어 하나의 중분자 갈락토 푸코 올리고당이 생성되었다.The galactofucoidan-degrading strain PF-2 was cultured in 1 L of medium containing 0.5% peptone and 0.5% galactofucoidan for 3 days, followed by centrifugation to take the supernatant. The supernatant was subjected to 75% ethanol treatment (removal of undissolved fucoidan) and centrifuged. The supernatant was concentrated and lyophilized to obtain galactofucooligosaccharide. The fucooligosaccharide determination using HPLC (High-performance liquid chromatography, Dionex) was performed using Shodex OHpak SB-805HQ (MW: -4
HPLC로 확인 되어진 갈락토 푸코 올리고당의 분자량을 시그마 플롯(Sigma Plot) 프로그램을 이용하여 분자량을 계산하였다(도 4). 그 결과, 갈락토 푸코 올리고당을 PF-2로 분해하여 얻어진 갈락토 푸코 올리고당의 분자량은 약 1.65 × 105 Da임을 확인 하였다.
The molecular weight of the galactofucooligosaccharide identified by HPLC was calculated using a Sigma Plot program (Fig. 4). As a result, it was confirmed that the molecular weight of the galactofructooligosaccharide obtained by digesting galactofucooligosaccharide with PF-2 was about 1.65 x 10 5 Da.
실시예Example 5: 5: 갈락토Galactto 푸코이단과Fucoidan and 갈락토Galactto 푸코Foucault 올리고당의 적외선 분광법( Infrared Spectroscopy of Oligosaccharides FTFT -- IRIR ) 분석) analysis
갈락토 푸코이단의 생리적 활성에 중요한 것으로 알려진 구조적 특성을 적외선 분광계(Fourier Transform Infrared Spectometer, FT-IR)를 이용하여 분석하였다. 스펙트럼은 4 ㎝- 1간격으로 4000-400 ㎝-1 범위로 최소 64번 스캔(scan) 하였으며, 옴닉(Omnic) 7.0 소프트웨어를 이용하여 분석하였다. 도 5에서 분석 결과를 비교한 결과, 본 발명에 의해 제조된 중분자의 갈락토 푸코 올리고당의 경우 고분자 갈락토 푸코이단과 FT-IR 분석에서 거의 유사한 결과로, 갈락토 푸코 올리고당의 구조적 변형이 없음을 알 수 있으며, 특히 생리 활성에 있어서 중요한 역할을 하는 S=O 결합 부위 2곳이 (1248-1256 cm-1, 820-830cm-1) 보존되어 있음을 확인 할 수 있었다. 이는 본 발명의 갈락토 푸코 올리고당이 갈락토 푸코이단 원래의 생리적 활성을 유지하고 있음을 증명하는 것이다.Structural properties known to be important for the physiological activity of galactofucoidan were analyzed using an infrared spectrometer (Fourier Transform Infrared Spectrometer, FT-IR). Spectra 4 ㎝ - was 4000-400 ㎝ -1 to scan (scan) at least 64 times the first interval range, were analyzed by omnik (Omnic) 7.0 software. As a result of comparing the results of the analysis in FIG. 5, it was found that the galactofucooligosaccharide of the intermediate produced by the present invention had no structural modification of galactofucooligosaccharide with almost the same result as the FT-IR analysis with the galactofucoid in the polymer , And it was confirmed that two S = O bond sites (1248-1256 cm -1 , 820-830 cm -1 ), which play an important role in physiological activity, are preserved. This proves that the galactofuco oligosaccharide of the present invention maintains the original physiological activity of galactofucoid.
실시예Example 6: 6: 갈락토Galactto 푸코Foucault 올리고당의 성분당 분석( Analysis of Streptomycin of Oligosaccharides HPEACHPEAC -- PADPAD , 원소분석), Elemental analysis)
본 발명의 갈락토 푸코 올리고당의 성분당 분석을 통한 갈락토 푸코 올리고당의 확인을 위해 HPEAC-PAD(High Performance Anion-Exchange Chromatography with Pulsed Amperometric Detection, Dionex)를 이용하였다. 효소 분해로 생성된 반응물을 75% 알코올로 침전시킨 후 12,000 rpm으로 10분 동안 원심분리하여 상등액을 농축하였다. 농축한 반응물은 1%로 증류수에 녹인 후 2 M 트리플루오로아세트산(trifluroroacetic aci, TFA)을 이용하여 100℃에서 4시간 반응 하였다. 용매는 18 mM NaOH 이고, 유속은 0.8 ㎖/분으로 하였으며, 시료는 10 ㎕ 주입하여 분석하였다. 푸코오스(fucose, Fuc), 갈락토오스(galactose, Gal), 자일로오스(xylose, Xyl) 및 만노오스(mannose, Man)를 표준용액으로 사용하였다.HPEAC-PAD (High Performance Anion-Exchange Chromatography with Pulsed Amperometric Detection, Dionex) was used for identification of galactofucooligosaccharides through analysis of the galactofuco oligosaccharides of the present invention. The reaction mixture was precipitated with 75% alcohol and centrifuged at 12,000 rpm for 10 minutes to concentrate the supernatant. The concentrated reaction product was dissolved in distilled water at 1% and then reacted at 100 ° C for 4 hours using 2 M trifluoroacetic acid (TFA). The solvent was 18 mM NaOH, the flow rate was 0.8 ml / min, and 10 μl of the sample was analyzed. Fucose, Fuc, galactose, Xylose, Xyl and mannose were used as standard solutions.
또한, 갈락토 푸코 올리고당을 이용하여 CE사의 CHNS-Porapack PQS 원소분석기를 이용하여 분석하였다. 위에서 얻어진 갈락토 푸코 올리고당 1 ㎎을 주입한 후 헬륨(He)을 이용하여 흘려주고, 열전도성 검출기(Thermal conductivity detector)로 검출하였다.In addition, galactofuco oligosaccharides were analyzed using a CHNS-Porapack PQS elemental analyzer from CE. 1 mg of galactofucooligosaccharide obtained above was injected, and then helium (He) was poured thereinto and detected by a thermal conductivity detector.
도 6은 갈락토 푸코 올리고당의 성분당 분석을 나타낸다. 그 결과, 갈락토 푸코이단과 갈락토 푸코 올리고당을 비교하였을 시, 푸코오스, 갈락토오스, 자일로오스, 만노오스의 함량이 약 54%, 44%, 0.5%, 0.4%로 갈락토 푸코이단과 성분이 유사함을 확인하였다. 또한 원소분석을 통하여 탄소(C), 수소(H), 질소(N) 및 황산(S)기의 변화가 없음도 확인하였다.
Figure 6 shows an analysis of galactofuco oligosaccharide per sex. As a result, the contents of fucose, galactose, xylose and mannose were about 54%, 44%, 0.5% and 0.4%, similar to those of galactofucoidan, when galactofucoidan was compared with galactofuco oligosaccharide Respectively. In addition, elemental analysis showed no change in carbon (C), hydrogen (H), nitrogen (N), and sulfuric acid (S) groups.
실시예Example 7: 28s 7: 28s rDNArDNA 및 염기서열에 의한 And by base sequence 갈락토Galactto 푸코이단Fucoidan 분해균의 동정 Identification of degrading bacteria
7-1. 7-1. DNADNA 분리 정제 Separation purification
갈락토 푸코이단 분해균주 PF-2에서 DNA를 분리하기 위해 구아니딘 티오시아네이트/페놀/클로로포름 방법를 사용하였다. 약 0.5 ㎖의 PF-2 배양액에 0.25 ㎖의 용액(4 M 구아니딘 티오시아네이트, 0.25 M 소듐 시트레이트 및 0.5% 사르코실)과 0.5 ㎖ 페놀-클로로포름(1:1)을 첨가하여 약 1시간 정도 혼합한 후 원심분리하여 상등액을 회수하고 DNA를 이소프로필알코올로 침전하였다. 회수된 침전물을 70% 알코올로 세척한 후 말려서 증류수에 녹여 PCR에 사용하였다.
The guanidine thiocyanate / phenol / chloroform method was used to isolate DNA from the galactofucoidan degrading strain PF-2. 0.25 ml of a solution (4 M guanidine thiocyanate, 0.25 M sodium citrate and 0.5% sarcosyl) and 0.5 ml phenol-chloroform (1: 1) were added to about 0.5 ml of the PF- After mixing, the supernatant was recovered by centrifugation and DNA was precipitated with isopropyl alcohol. The recovered precipitate was washed with 70% alcohol, dried and dissolved in distilled water and used for PCR.
7-2. 7-2. PCRPCR 의 반응 조건Reaction conditions of
PCR 반응액에는 10 mM Tris-HCl(pH 8.0), 50 mM KCl, 1.5 mM MgCl2, 200 μM dNTPs, 2.5 units Taq DNA 폴리머라제, 100 pmol 프라이머 및 DNA 주형을 첨가하여 총 부피를 100 ㎕가 되도록 하였다. 각 시료는 증폭기에서 증폭 사이클을 시작하기 전에 94℃에서 5분 동안 DNA를 변성시킨 후 PCR을 실시하였으며, 45 사이클을 종료한 후 72℃에서 7분 동안 연장 반응시킨 다음 반응을 종료하였다. 각 사이클은 94℃ 1분, 35℃ 2분, 72℃ 2분으로 하였다.
To the PCR reaction solution, add 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM MgCl 2 , 200 μM dNTPs, 2.5 units Taq DNA polymerase, 100 pmol primer and DNA template to a total volume of 100 μl Respectively. Each sample was subjected to PCR after denaturing the DNA at 94 ° C for 5 minutes before starting the amplification cycle in the amplifier. After completion of 45 cycles, extension reaction was performed at 72 ° C for 7 minutes, and the reaction was terminated. Each cycle was 94 ° C for 1 minute, 35 ° C for 2 minutes, and 72 ° C for 2 minutes.
7-3. 16s 7-3. 16s rDNArDNA 의 염기서열을 이용한 계통분석System analysis using the nucleotide sequence of
결정된 염기서열(5’- ATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGCTGCTTAATACCTTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATGGTCATCAGCGACCCGTCTTGAAACACGG-3′)의 상동성 검사는 GenBank의 database에 등록된 정보를 대상으로 블라스트 프로그램(http://www.ncbi.nlm.nih.gov/BLAST/)으로 수행하였다. 계통분석은 DNAstar의 MegAlign 프로그램을 사용하여 결정하였다. GenBank에 등록된 다른 균주들의 28s rDNA 염기서열 정보와 MegAlign 프로그램을 이용하여 이웃 결합 방법(neighbor-joining method, Saitou 및 Nei, Mol. Biol. 4:406-425, 1987)에 의해 염기 서열간의 계통수(phylogentic tree)를 얻었다.Inspection of the determined nucleotide sequence homology (5'- ATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGCTGCTTAATACCTTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATGGTCATCAGCGACCCGTCTTGAAACACGG-3 ') was carried out by blasting program (http://www.ncbi.nlm.nih.gov/BLAST/) with the target information registered in the GenBank database. Systematic analysis was determined using DNAstar's MegAlign program. Using the 28S rDNA sequence information and the MegAlign program of other strains registered in GenBank, the number of genomes between the base sequences by the neighboring joining method (Saitou and Nei, Mol. Biol. 4: 406-425, 1987) phylogentic tree.
PCR로 증폭된 28s rDNA를 이용하여 갈락토 푸코이단 분해능을 가진 PF-2의 염기서열 분석은 다음과 같이 진행하였다:Sequence analysis of PF-2 with galactofucoidal resolution using PCR-amplified 28s rDNA was performed as follows:
먼저 국립 생명공학정보 센터(NCBI)의 블라스트 검색을 통해 유사도를 조사한 결과, 코니오차이타 베루티나(Coniochaeta velutina, FJ167401)와 99%의 높은 염기서열 상동성을 보여 상기의 생화학적 방법과 동일한 결과를 보여줌을 확인하였다. 결정된 염기서열과 유사한 유형의 균주들과의 유연관계를 조사한 결과는 도 7에 나타내었다.
First, the blast search of the National Center for Biotechnology Information (NCBI) conducted a similarity study. As a result, Coniochaeta velutina , FJ167401), and showed the same results as the above biochemical method. The results of investigating the relationship between the determined nucleotide sequence and a strain of a similar type are shown in Fig.
실시예Example 8: 8: 갈락토Galactto 푸코이단Fucoidan 분해 균주 Decomposition strain PFPF -2의 주사전자현미경(-2 scanning electron microscope ( SEMSEM ) 분석) analysis
한천 배지(0.5% 갈락토 푸코이단, 0.5% 펩톤 및 1.5% 아가)에서 PF-2를 3일동안 배양 후 배지에서 백금이(platinum pool)를 이용하여 PF-2를 슬라이드 글라스(slide glass)에 도말하였다. 30% 에탄올을 이용하여 PF-2 탈수 작업을 거친 후 임계점 건조기(critical point dryer)를 이용하여 완전히 건조하였다. 건조된 PF-2는 구리양면 테이프를 붙인 원반형 스터브(stub) 위에 고정하였다. 건조된 PF-2는 주사전자현미경(SEM)으로 ×350 내지 ×4,000의 배율로 형태를 관찰하였다(도 8).
PF-2 was cultured in agar medium (0.5% galactofucoid, 0.5% peptone and 1.5% agar) for 3 days and then plated on a slide glass using a platinum pool in a medium. Respectively. PF-2 was dewatered using 30% ethanol and then completely dried using a critical point dryer. The dried PF-2 was fixed on a disc-shaped stub with a copper double-sided tape. The dried PF-2 was observed with a scanning electron microscope (SEM) at a magnification of × 350 to × 4,000 (FIG. 8).
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.
<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Coniochaeta velutina Strain KCTC12470BP degradating Galacto Fucoidan to Galacto Fuco Oligosaccharide <130> PN130493 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 563 <212> DNA <213> Coniochaeta velutina PF-2 16s rDNA <400> 1 attgccccag taacggcgag tgaagcggca acagctcaaa tttgaaatct ggcttcggcc 60 cgagttgtaa tttgtagagg atgcttttgg tgaggtgcct tctgagttcc ctggaacggg 120 acgccagaga gggtgagagc cccgtatagt cggccaccga tcctctgtaa agctccttcg 180 acgagtcgag tagtttggga atgctgctca aaatgggagg tatatctctt ctaaagctaa 240 atattggcca gagaccgata gcgcacaagt agagtgatcg aaagatgaaa agcactttga 300 aaagagggtt aaatagcacg tgaaattgtt gaaagggaag cgcttgtgac cagacttgtg 360 ccgggctgat catccagtgt tctcactggt gcactcgacc cggctcaggc cagcgtcggt 420 tctcgcgggg ggataaaagc ttcgggaacg tggcacctcc gggtgtgtta tagcccgctg 480 cttaatacct tcgcggggac cgaggttcgc gctctgcaag gacgctggca taatggtcat 540 cagcgacccg tcttgaaaca cgg 563 <210> 2 <211> 544 <212> DNA <213> Coniochaeta velutina PF-2 ITS <400> 2 agtcgtaaca aggtctccgt tggtgaacca gcggagggat cattattaga agccgaaagg 60 ctacttaaaa ccatcgcgaa ctcgtccaag ttgcttcggc ggcgcggcct ccctcacggg 120 ggcgccgcag ccccgcctct ccggaggtgt ggggcgcccg ccggaggtac gaaactctgt 180 attatagtgg catctctgag taaaaaacaa ataagttaaa actttcaaca acggatctct 240 tggttctggc atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt 300 cagtgaatca tcgaatcttt gaacgcacat tgcgcccgct agtactctag cgggcatgcc 360 tgttcgagcg tcatttcaac cctcaagccc tgcttggtgt tggggcccta cggctgccgt 420 aggccctgaa aggaagtggc gggctcgcta caactccgag cgtagtaatt cattatctcg 480 ctagggacgt tgcggcgcgc tcctgccgtt aaagaccatc tttaactcaa ggttgacctc 540 ggat 544 <110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Coniochaeta velutina Strain KCTC12470BP degradating Galacto Fucoidan to Galacto Fuco Oligosaccharide <130> PN130493 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 563 <212> DNA <213> Coniochaeta velutina PF-2 16s rDNA <400> 1 attgccccag taacggcgag tgaagcggca acagctcaaa tttgaaatct ggcttcggcc 60 cgagttgtaa tttgtagagg atgcttttgg tgaggtgcct tctgagttcc ctggaacggg 120 acgccagaga gggtgagagc cccgtatagt cggccaccga tcctctgtaa agctccttcg 180 acgagtcgag tagtttggga atgctgctca aaatgggagg tatatctctt ctaaagctaa 240 atattggcca gagaccgata gcgcacaagt agagtgatcg aaagatgaaa agcactttga 300 aaagagggtt aaatagcacg tgaaattgtt gaaagggaag cgcttgtgac cagacttgtg 360 ccgggctgat catccagtgt tctcactggt gcactcgacc cggctcaggc cagcgtcggt 420 tctcgcgggg ggataaaagc ttcgggaacg tggcacctcc gggtgtgtta tagcccgctg 480 cttaatacct tcgcggggac cgaggttcgc gctctgcaag gacgctggca taatggtcat 540 cagcgacccg tcttgaaaca cgg 563 <210> 2 <211> 544 <212> DNA <213> Coniochaeta velutina PF-2 ITS <400> 2 agtcgtaaca aggtctccgt tggtgaacca gcggagggat cattattaga agccgaaagg 60 ctacttaaaa ccatcgcgaa ctcgtccaag ttgcttcggc ggcgcggcct ccctcacggg 120 ggcgccgcag ccccgcctct ccggaggtgt ggggcgcccg ccggaggtac gaaactctgt 180 attatagtgg catctctgag taaaaaacaa ataagttaaa actttcaaca acggatctct 240 tggttctggc atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt 300 cagtgaatca tcgaatcttt gaacgcacat tgcgcccgct agtactctag cgggcatgcc 360 tgttcgagcg tcatttcaac cctcaagccc tgcttggtgt tggggcccta cggctgccgt 420 aggccctgaa aggaagtggc gggctcgcta caactccgag cgtagtaatt cattatctcg 480 ctagggacgt tgcggcgcgc tcctgccgtt aaagaccatc tttaactcaa ggttgacctc 540 ggat 544
Claims (7)
Coniochaeta verrucina, which degrades galactofucoid to galactofucooligosaccharide ( Coniochaeta velutina ) strain KCTC12470BP.
The method of claim 1 wherein the galacto-oligosaccharide is Foucault 1.5 × 10 5 to 1.8 × 10 5 Da Coney error itaconic beru Tina strain KCTC12470BP, characterized in that it has a molecular weight of from.
The conidia tea strain according to claim 1, wherein the galactofuco oligosaccharide has two S = O bonds.
(a) 상기 제 1 항 내지 제 3 항 중 어느 한 항의 코니오차이타 베루티나 균주 KCTC12470BP를 갈락토 푸코이단을 포함하는 배양 배지에서 배양하는 단계; 및
(b) 상기 배양 배지로부터 갈락토 푸코 올리고당을 수득하는 단계.
A process for producing galactofo-oligosaccharide comprising the steps of:
(a) culturing the conidia Itaerutina strain KCTC12470BP of any one of claims 1 to 3 in a culture medium containing galactofucoid; And
(b) obtaining galactofucooligosaccharides from the culture medium.
5. The method according to claim 4, wherein the culture medium of step (a) is a minimal medium containing galactofucoid and a nitrogen source.
5. The method according to claim 4, wherein the culture medium of step (a) has an optimum pH of from pH 6.0 to pH 8.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020130099816A KR101448802B1 (en) | 2013-08-22 | 2013-08-22 | Coniochaeta velutina Strain KCTC12470BP degradating Galacto Fucoidan to Galacto Fuco Oligosaccharide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020130099816A KR101448802B1 (en) | 2013-08-22 | 2013-08-22 | Coniochaeta velutina Strain KCTC12470BP degradating Galacto Fucoidan to Galacto Fuco Oligosaccharide |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR101448802B1 true KR101448802B1 (en) | 2014-10-13 |
Family
ID=51997065
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020130099816A KR101448802B1 (en) | 2013-08-22 | 2013-08-22 | Coniochaeta velutina Strain KCTC12470BP degradating Galacto Fucoidan to Galacto Fuco Oligosaccharide |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101448802B1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113755347A (en) * | 2021-10-20 | 2021-12-07 | 王晓艳 | Endophytic fungus AM1 for promoting nitrogen absorption of oil tea |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20080104679A (en) * | 2007-05-29 | 2008-12-03 | 가톨릭대학교 산학협력단 | Novel spingomonas sp. strain capable of degrading fucoidan of korean undaria pinatifida sporophyll |
| KR20100138438A (en) * | 2009-06-25 | 2010-12-31 | 주식회사 한립생명공학 | Composition for anticoagulation comprising fuco-oligosaccharides |
| KR20100138439A (en) * | 2009-06-25 | 2010-12-31 | 주식회사 한립생명공학 | Composition for activating immune cells comprising fuco-oligosaccharides |
-
2013
- 2013-08-22 KR KR1020130099816A patent/KR101448802B1/en active IP Right Grant
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20080104679A (en) * | 2007-05-29 | 2008-12-03 | 가톨릭대학교 산학협력단 | Novel spingomonas sp. strain capable of degrading fucoidan of korean undaria pinatifida sporophyll |
| KR20100138438A (en) * | 2009-06-25 | 2010-12-31 | 주식회사 한립생명공학 | Composition for anticoagulation comprising fuco-oligosaccharides |
| KR20100138439A (en) * | 2009-06-25 | 2010-12-31 | 주식회사 한립생명공학 | Composition for activating immune cells comprising fuco-oligosaccharides |
Non-Patent Citations (1)
| Title |
|---|
| Arch. Pharm. Rse., Vol.33, pp.125-131(2010.) * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113755347A (en) * | 2021-10-20 | 2021-12-07 | 王晓艳 | Endophytic fungus AM1 for promoting nitrogen absorption of oil tea |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Srikanth et al. | Antioxidant and anti-inflammatory levan produced from Acetobacter xylinum NCIM2526 and its statistical optimization | |
| Sun et al. | Purification, structure and immunobiological activity of a new water-soluble polysaccharide from the mycelium of Polyporus albicans (Imaz.) Teng | |
| Sakai et al. | A marine strain of Flavobacteriaceae utilizes brown seaweed fucoidan | |
| JPH08259602A (en) | New polysaccharide substance | |
| Pidoux et al. | Characterization of the polysaccharides from a Lactobacillus brevis and from sugary kefir grains | |
| CN111978421B (en) | Phellinus igniarius polysaccharide and preparation and application thereof | |
| El-Ghonemy | Antioxidant and antimicrobial activities of exopolysaccharides produced by a novel Aspergillus sp. DHE6 under optimized submerged fermentation conditions | |
| Jiang et al. | The antitumor and antioxidative activities of polysaccharides isolated from Isaria farinosa B05 | |
| US8563276B2 (en) | Method of enzyme cleavage of polysaccharides derived from algae | |
| KR100695779B1 (en) | Microorganism producing fucoidan and method for producing fucoidan using the same | |
| Baker et al. | Composition and proposed structure of a water-soluble glycan from the Keumsa Sangwhang mushroom (Phellinus linteus) | |
| KR101448802B1 (en) | Coniochaeta velutina Strain KCTC12470BP degradating Galacto Fucoidan to Galacto Fuco Oligosaccharide | |
| CN110373356B (en) | Bacillus amyloliquefaciens exopolysaccharide for inhibiting growth of enterotoxigenic escherichia coli | |
| Wu et al. | Characteristics of exopolysaccharides from the citrine oyster mushroom, Pleurotus citrinopileatus (Agaricomycetes), depend on the nitrogen source in the medium | |
| MOU et al. | Structural analysis of kappa‐carrageenan oligosaccharides released by carrageenase from marine cytophaga MCA‐2 | |
| KR100887682B1 (en) | Novel Spingomonas sp. Strain Capable of Degrading Fucoidan of Korean Undaria Pinatifida Sporophyll | |
| KR100339715B1 (en) | Process for Preparing Pullulan Employing Waste Materials Containing High Concentration of Sugars from Food-processing Industry | |
| Nwe et al. | Decomposition of myceliar matrix and extraction of chitosan from Gongronella butleri USDB 0201 and Absidia coerulea ATCC 14076 | |
| KR101727251B1 (en) | Pseudomonas geniculata KCTC12651BP having the Ability to Degrade Green Algae derived Polysaccharides | |
| KR102007421B1 (en) | Composition for anti-influenza virus comprising as active ingredient polysaccharide derived from Lactobacillus plantarum and method for producing the polysaccharide | |
| CN103484392A (en) | Application of pseudomonas fluorescens PGM37 strain to produce glucomannan | |
| KR20040008145A (en) | Sulfated fucoglucuronomannan | |
| Lu et al. | Enhanced α-glucosidase inhibition activity of exopolysaccharides fractions from mycelium of Inonotus obliquus under addition of birch sawdust lignocellulose component | |
| Oztopuz et al. | Chitinolytic Bacillus subtilis Ege-B-1.19 as a biocontrol agent against mycotoxigenic and phytopathogenic fungi | |
| CN115947876B (en) | beta-D-galactoglucan and preparation and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20170904 Year of fee payment: 4 |
|
| FPAY | Annual fee payment |
Payment date: 20180912 Year of fee payment: 5 |
|
| FPAY | Annual fee payment |
Payment date: 20190808 Year of fee payment: 6 |