KR101444261B1 - A new scolopendrasin i peptide isolated from the scolopendra subspinipes and its synthetic composition - Google Patents

Abstract

The present invention relates to a novel Scolopendrasin I peptide isolated from Scolopendra subspinipes and a composition thereof. The present invention provides a novel gene (sequence number 1) of an antibacterial and antifungal peptide isolated from Scolopendra subspinipes, or amino acid (sequence number 2) deducted from the gene, and a peptide (sequence number 3) synthesized from the amino acid. The novel Scolopendrasin I peptide isolated from Scolopendra subspinipes and a composition thereof are provided by the present invention. Accordingly, provided are antibiotics, food preservatives, cosmetic preservatives, medicines, etc. which are free from cytotoxicity and are safe for the human body while showing excellent antibacterial activity and antifungal activity.

Description

[0001] The present invention relates to a novel scolopendrazine I peptide isolated from a Chinese cabbage and a composition thereof,

The present invention relates to a novel scolopendrazine I peptide isolated from Wang Ji Nee and a composition thereof. More particularly, the present invention relates to a novel scolopendrazine I peptide having no cytotoxicity and exhibiting antibacterial and antifungal activity, ≪ / RTI >

 Infection with pathogenic microorganisms is one of the most common and fatal causes of human disease, unfortunately the antibiotic resistance of pathogenic microorganisms has been caused by the abuse of antibiotics.

In fact, the rate at which pathogenic microorganisms are resistant to new antibiotics is much faster than the rate at which analogs of new antibiotics are developed.

For example, pathogenic microbial species such as Enterococcus faecalis , Mycobacterium tuberculosis , and Pseudomonas aeruginosa , which may pose a life threat, I have developed resistance to all antibiotics.

Tolerance to antibiotics is distinct from resistance to antibiotics, which was first discovered in the 1970s by Pneumococcus sp. And provided important clues to the mechanism of action of penicillin.

Resistant species stop growing in the presence of the usual concentration of antibiotics but do not eventually die.

This resistance occurs when the antibiotic inhibits the cell wall synthetase because the autolytic enzyme activity of the bacteria such as autolysin does not occur. This fact suggests that penicillin is an endogenous hydrolytic enzyme Activation kills bacteria and bacteria also inhibit their activity, resulting in the survival of antibiotics.

It is clinically very important that pathogenic microorganisms have resistance to antibiotics, because the inability to eradicate the resistant microorganisms is ineffective in antibiotic treatment in clinical infections.

In addition, tolerance is considered to be a prerequisite for resistance to antibiotics, which is due to the survival of strains despite antibiotic therapy.

These strains acquire new genetic elements that are resistant to antibiotics and continue to grow in the presence of antibiotics.

Since virtually all pathogenic microorganisms showing resistance are also known to be resistant, development of new antibiotics capable of killing pathogenic microorganisms resistant to these antibiotic resistance is urgent.

As described above, it is necessary to develop a new antibiotic to prevent damages caused by pathogenic microorganisms showing resistance to antibiotics, and to develop new antibiotics that act independently of autolysin activity.

In addition, there is a need to provide pharmaceutical compositions for effectively treating such new antibiotics with an infection of pathogenic microorganisms.

On the other hand, some of the substances that play an important role in maintaining the homeostasis of organisms are physiologically active substances derived from various organisms.

Many researches have been carried out on a number of biologically active substances, among which antimicrobial peptides isolated from various organisms are known to act in various ways, ranging from bacteria, fungi and viruses. Antimicrobial peptides are also known to play an important role in host defense and the innate immune system.

Korean Priority No. 10-0625875 (a novel peptide isolated from Aspergillus nidulans and a pharmaceutical composition containing it as an active ingredient) and Korean Patent No. 10-0964136 Antimicrobial and antifungal peptide genes, and synthetic peptides having antimicrobial and antifungal activity). However, no studies have been made on novel peptides isolated from Wang Ji Nee and novel uses thereof.

It is an object of the present invention to provide a novel scolopendrazine I peptide and a composition thereof isolated from Wang Zyne, which can be useful not only for Gram-negative bacteria, positive bacteria, but also for preventing and treating human fungal diseases.

In order to achieve the above object, the present invention provides a novel gene (SEQ ID NO: 1) of an antibacterial and antifungal peptide isolated from Scolopendra subspinipes or an amino acid deduced from the gene (SEQ ID NO: 2) Peptide (SEQ ID NO: 3).

The peptide is characterized by having antibacterial and antifungal activity.

The antimicrobial activity is characterized by exhibiting at least one of Staphylococcus aureus , Escherichia coli 0-157 ( Escherichia coli 0-157).

The antifungal activity is characterized in that it appears to Candida albicans .

The peptide is characterized by being non-toxic to human red blood cells.

The present invention provides a pharmaceutical composition for antibiotic and antifungal preparation containing the above peptide as an active ingredient, or antibiotic, food preservative, cosmetic preservative or pharmaceutical preservative.

According to the present invention, novel scolopendrazine I peptides and compositions thereof isolated from Wang Ji Nee are provided, and therefore, they are free from cytotoxicity, exhibit excellent antibacterial and antifungal activity, and can be used as antibiotics, food preservatives, cosmetic preservatives, And so on.

Brief Description of the Drawings Fig. 1 is a diagram showing antimicrobial activity and antifungal activity of the novel scolopendrazine I peptide of the present invention isolated from Wangjing.

Hereinafter, the present invention will be described in detail.

The present invention relates to a novel gene (SEQ ID NO: 1) of an antibacterial and antifungal peptide isolated from Scolopendra subspinipes or an amino acid deduced from the gene (SEQ ID NO: 2) and a peptide synthesized from the amino acid (SEQ ID NO: 3) to provide.

In the present invention, in order to identify a peptide gene derived from Scolopendra subspinipes , Wangzine is first rapidly frozen in liquid nitrogen to isolate total RNA, and then gene information on Wangzine transcripts is confirmed using RNA seq analysis Based on the sequence of the translated amino acids from each transcript, the unicin, which is presumed to be a peptide exhibiting antibacterial and antifungal activity, is selected through a secondary structure analysis and a comparative analysis of amino acid sequence using the SVM algorithm.

Then, the amino acid sequence of the biosynthetic peptide was composed of 14 amino acids with KAVVKEFLKRKIKV-NH ₂ , and it was confirmed that the amino acid sequence of Scolopendrasin I ).

Such peptides exhibit antibacterial and antifungal activity, and in particular, are non-toxic to human erythrocyte cells. Accordingly, the present invention provides a pharmaceutical composition for antibacterial and antifungal preparation containing the antibacterial and antifungal activity as an active ingredient, or a pharmaceutical composition for antibiotic, food preservative, cosmetic preservative, .

More specifically the inventors Stability Philo nose kusu aureus (Staphylococcus aureus) bacteria with antimicrobial activity the target to measure the antibacterial and antifungal activity of the new pen drive Ⅰ (ScolopendrasinⅠ) peptide in the Driscoll, E. coli 0-157 (Escherichia coli 0-157) and the Candida albicans as a fungicidal activity target, the RDA assay (radial diffusion assay) showed strong antibacterial or antifungal activity similar to that of melitin having strong antibacterial or antifungal activity (See Fig. 1).

Further, the present inventors investigated the cytotoxicity of the novel scolopendrazine I peptide of the present invention. As a result, the novel scolopendrazine I peptide of the present invention showed cytotoxicity Whereas melittin, a bee venom used as a positive control, was highly cytotoxic (see Table 2).

From the above results, it can be seen that the pharmaceutical composition containing the novel scolopendrazine I peptide of the present invention as an active ingredient exhibits excellent antifungal and antimicrobial effects as well as cytotoxicity, and thus is useful as a safe antimicrobial agent and antifungal agent Respectively.

Such a pharmaceutical composition can be administered parenterally at the time of clinical administration and can be used in the form of a general pharmaceutical preparation.

That is, the novel peptide of the present invention can be administered in various forms of parenteral administration. In the case of formulation, the peptide is prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. As the base of the suppository, witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like can be used.

In addition, the novel peptide of the present invention can be used in combination with various carriers permitted as pharmaceutical agents, such as physiological saline or an organic solvent, and can be used in combination with carbohydrates such as glucose, sucrose or dextran, Antioxidants such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers can be used as pharmaceuticals.

The effective dose of the novel peptide of the present invention is 0.01 to 100 mg / kg, preferably 0.1 to 10 mg / kg, and can be administered once to three times a day.

The total effective amount of the novel peptide of the present invention and the peptide having more than 95% homology thereto in the pharmaceutical composition of the present invention may be a single dose by a bolus form or by infusion for a relatively short period of time, , And may be administered by a fractionated treatment protocol in which multiple doses are administered over a prolonged period of time. Since the concentration of the effective dose of the patient is determined in consideration of various factors such as the route of administration and the number of treatments as well as the age and health condition of the patient, in view of this point, Lt; RTI ID = 0.0 > as < / RTI > the pharmaceutical composition of the novel peptide.

In addition, the present invention provides an antibiotic, a food preservative, a cosmetic preservative or a pharmaceutical preservative containing a novel peptide as an active ingredient.

In this case, food preservative, cosmetic preservative and pharmaceutical preservative are additives used to prevent deterioration, decay, discoloration and chemical change of foods or medicines, including bactericides and antioxidants, and proliferation of microorganisms such as bacteria, fungi and yeast As well as functional antibiotics such as inhibiting the growth of microorganisms or sterilizing the microorganisms in foods and medicines. Ideal conditions for these food preservatives, cosmetics, and medicine preservatives should be non-toxic and have a very small effect.

As shown in FIG. 1 and Table 2, the novel scolopendrazine I peptide of the present invention shows strong antimicrobial and antifungal activity and has no toxicity, and thus it can be used effectively as a preservative for foods, cosmetics and medicines.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example  1: Origin of Wang Ji Peptides  Gene selection

In order to identify the peptide gene that exhibits antibacterial or antifungal activity from Wang Ji, the Wang JiNe was rapidly frozen with liquid nitrogen to isolate total RNA. The gene information of Wangjing transcripts was confirmed using RNA seq analysis method. Based on the sequence of amino acids translated from the dead bodies, the SVM algorithm ( http://apps.sanbi.ac.za/dampd/ ) is used to analyze the secondary structural analysis and amino acid sequence comparison analysis to determine the antimicrobial peptide (Table 1).

It was confirmed that it contains alpha helical region, which was biosynthetically used in the experiment. The amino acid sequence of the biosynthetic peptide was composed of 14 amino acids with KAVVKEFLKRKIKV-NH ₂ and named 'Scolopendrazin I'.

Sequence of starter residue
(SEQ ID NO: 1) atgaaaccacttgaaggaaaagctgctttggttacaggaggtgccagtggaataggaaag
gcagtagttaaagaatttcttaaaagaaaaatcaaagttgctttcctcgatatcaatgaa
aatact Selection gene
Amino acid sequence
(SEQ ID NO: 2) MKPLEGKAALVTGGASGIG KAVVKEFLKRKIKV AFLDINENT Scolopendrazine I peptide sequence
(SEQ ID NO: 3) KAVVKEFLKRKIKV-NH ₂

Example  2: Scolopendrazine Ⅰ Of peptide  Synthesis and separation purification

In Example 1, the scallopendrazine I peptide derived from Wang Zee was synthesized, separated and purified.

First, in order to synthesize a scolopendrazine I peptide, the present inventors manufactured a peptide using Merrifield's liquid phase method using a Fmoc amino group protecting container.

Method of the peptide synthesis the Fmoc (9-fluorenylmethoxycarbonyl) amino acids of the N _α were synthesized and used as a protecting group (protecting group) amino Groom (amino group) to the conventional method (solid phase method).

Concretely, the peptide having carboxyl terminal in the form of -NH ₂ used Rink Amide MBHA-Resin as the starting material, and the peptide having carboxyl terminal in the form of -OH used Fmoc-amino acid-Wang Resin as a starting material.

Elongation of the peptide chain by coupling of Fmoc-amino acid was performed by DCC ( N -hydroxybenzo-triazole (HOBt) -dicyclo-hexylcar-bodiimide) method.

After the Fmoc-amino acid of the amino terminal of each peptide was coupled, the Fmoc group was removed with 20% piperidine / N-methylpyrrolidone (NMP) solution, washed several times with NMP and dichloromethane (DCM) It was dried with gas.

A solution of TFA (trifluoroacetic acid) -phenol-thioanisole-H ₂ O-triisopropylsilane (85: 5: 5: 2.5: 2.5, vol./vol.) Was added and the reaction was carried out for 3 hours. The peptides were separated and the peptide was precipitated with diethyl ether. The crude peptide thus obtained was subjected to a reverse phase-HPLC column (Delta Pak, C ₁₈ 300 Å, 15 μ, 19.0 mm × 20 cm) using an acetonitrile gradient containing 0.1% TFA 30, Waters).

After the synthetic peptide was hydrolyzed with 6 N HCl at 110 ° C for 24 hours, the resulting residue was concentrated under reduced pressure, dissolved in 0.02 N HCl, and the amino acid composition was measured with an amino acid analyzer (Hitachi 8500 A).

The molecular weight was calculated based on the sequence of the synthesized peptides, and the exact molecular weight was measured using a MALDI mass spectrometer (MALDI).

As a result, it was confirmed that the antimicrobial peptide having the correct amino acid sequence was synthesized because the calculated molecular weight and the calculated molecular weight were identical.

Example  3: Scolopendrazine Ⅰ Of peptide  Investigation of antimicrobial activity against pathogenic microorganisms

A radial diffusion assay (RDA) was performed to investigate the antimicrobial activity against the scolopendrazine I peptide. Melittin, a powerful antimicrobial peptide isolated from bees, was used as a positive control in the present invention. In the present invention, the antimicrobial peptide was stored at -20 ° C and dissolved in sterilized distilled water.

[Antimicrobial activity measurement]

In order to measure the antimicrobial activity of the antimicrobial peptide, the stapling Philo nose kusu aureus (Staphylococcus aureus) First pathogenic bacteria, E. coli 0-157 (Escherichia coli 0-157) was cultivated in 3% (w / v) trypticase soy broth at 37 ° C and 200 rpm for 18 hours, and then 4 × 10 ⁶ CFU (colony forming units) / ml concentration For 2 hours and 30 minutes.

Thereafter, a sterilized underlay gel consisting of citrate phosphate buffer (9 mM sodium phosphate, 1 mM sodium citrate, pH 7.4) and 1% (w / v) type I (low electroendosmosis) agarose and 0.03% TSB (4 × 10 ⁶ colony forming units / ml) were added to the underlay gel and poured into a square plate. When the underlay gel was hardened, a hole having a diameter of 3 mm was punched out to obtain a peptide having a concentration of 1 mg / ) Were added to the wells in 5 쨉 l portions.

peptide was allowed to diffuse for 3 hours at 37 ° C, 10 mL of an overlay gel (6% TSB, 1% agarose) was poured in and then re-cultured at 37 ° C to confirm formation of a clear zone. The results are shown in Fig.

[Measurement of antifungal activity]

To measure the antifungal activity of the antimicrobial peptide, the pathogenic fungus Candida albicans ( Candida albicans ) were grown in YPD medium (1% yeast extract, 2% peptone, 2% dextrose) overnight at 30 ° C and 200 rpm, and then inoculated on fresh medium for 2 hours to become logarithmic phase.

Bacteria cultured on sterilized underlay gel consisting of citrate phosphate buffer (9 mM sodium phosphate, 1 mM sodium citrate, pH 7.4) and 1% (w / v) type agarose and 0.03% ⁶ colony forming units / mL) were mixed and poured into a square plate. When the underlay gel was hardened, a hole having a diameter of 3 mm was drilled and 5 μl of a peptide with a concentration of 1 mg / mL was punched.

peptide was allowed to diffuse for 3 hours at 37 ° C, 10 mL of overlay gel (6% TSB, 1% agarose) was poured in and the cells were cultured again at 37 ° C. to confirm formation of CLEAR ZONE. The obtained results are shown in FIG. .

[Results of antibacterial activity]

As shown in Fig. 1, the scolopendrazine I peptide was found to have a stronger activity of the negative bacteria than the positive bacteria.

It was also found that the antimicrobial activity was similar to that of melittin, which is a powerful antimicrobial peptide.

[Results of antifungal activity]

As shown in FIG. 1, the antifungal activities of scolopendrazine I peptides were confirmed to be CLEAR ZONE.

This means that the antifungal peptide exhibits strong antifungal activity with antifungal activity as strong as that of meliltin, which is a powerful antifungal agent used as a control.

Example 4: Of the Scolopendrazine I Peptide  Cytotoxicity measurement on human red blood cells

The cytotoxicity of human red blood cells was measured as follows.

Human erythrocytes were washed three times with phosphate-sodium chloride buffer, pH 7.4 (PBS), and then diluted with phosphate-sodium chloride buffer to prepare 8.0% red blood cell solution.

Then, 100 μl of the 8.0% red blood cell solution was dispensed into a 96-well plate, and then a stepwise diluted solution of the peptide was mixed.

Then, physiological saline (Saline 0.85% NaCl) was added to all wells so that the total amount became 200 μl, and the cells were cultured in a 37 ° C. incubator for 1 hour.

After the culture was completed, the supernatant was transferred to the side wells by centrifugation at a rotation speed of 1000 rpm for 10 minutes in a centrifuge.

The destructive activity against red blood cells was measured by measuring the absorbance at 414 nm using an ELISA reader.

100% destructive capacity was calculated for 0.1% Triton X-100 as a control, and 0% destructive capacity for only red cell.

At this time, the destructive ability of the peptide was calculated by the following equation (1), and the obtained results are shown in Table 2 below.

[Equation 1]

% Absorbance of solution treated with Triton X-100 414 nm absorbance of phosphoric acid-sodium chloride buffer 414 nm) * 100 (absorbance of peptide-treated solution 414 nm-absorbance of phosphoric acid-sodium chloride buffer 414 nm)

Cytotoxicity of Scolopendrazine I Peptide to Human Erythrocytes (Human erythrocytes) % Human erythropoietin ^a (㎖ ml) 320 160 80 40 20 10 control Scolopendrazin I 0 0 0 0 0 0 0 Melitin 96 95 95 95 46 12 0 [Note] a: Cytotoxicity to human is measured by the ability of the peptide to destroy the human red blood cells

As shown in Table 2, it was confirmed that the scallopendrazine 1 peptide did not show cytotoxicity at all concentrations. In contrast, melittin, a potent antimicrobial peptide, was highly cytotoxic at low concentrations.

These results indicate that the peptides found in the present invention are free from cytotoxicity, exhibit excellent antibacterial and antifungal activity, and can be used as safe antibiotics, food preservatives, cosmetic preservatives and pharmaceuticals.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Republic of korea <120> An New Scolopendrasin i peptide isolated from the scolopendra          subspinipes and its synthetic composition <130> P2013-0040 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 126 <212> DNA <213> Scolopendra subspinipes <400> 1 atgaaaccac ttgaaggaaa agctgctttg gttacaggag gtgccagtgg aataggaaag 60 gcagtagtta aagaatttct taaaagaaaa atcaaagttg ctttcctcga tatcaatgaa 120 aatact 126 <210> 2 <211> 42 <212> PRT <213> Scolopendra subspinipes <400> 2 Met Lys Pro Leu Glu Gly Lys Ala Ala Leu Val Thr Gly Gly Ala Ser   1 5 10 15 Gly Ile Gly Lys Ala Val Val Lys Glu Phe Leu Lys Arg Lys Ile Lys              20 25 30 Val Ala Phe Leu Asp Ile Asn Glu Asn Thr          35 40 <210> 3 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> synthetic peptide <400> 3 Lys Ala Val Val Lys Glu Phe Leu Lys Arg Lys Ile Lys Val   1 5 10

Claims (12)

The genes of antimicrobial and antifungal peptides isolated from Scolopendra subspinipes , represented by SEQ.
SEQ ID NO: 1:
atgaaaccac ttgaaggaaa agctgctttg gttacaggag gtgccagtgg aataggaaag
gcagtagtta aagaatttct taaaagaaaa atcaaagttg ctttcctcga tatcaatgaa
aatact
Amino acid deduced from the gene of the antifungal and antifungal peptide (SEQ ID NO: 1) isolated from Scolopendra subspinipes , represented by SEQ ID NO: 2 below.
SEQ ID NO: 2:
Met Lys Pro Leu Glu Gly Lys Ala Ala Leu Val Thr Gly Gly Ala Ser
Gly Ile Gly Lys Ala Val Val Lys Glu Phe Leu Lys Arg Lys Ile Lys
Val Ala Phe Leu Asp Ile Asn Glu Asn Thr
The peptide synthesized in the amino acid sequence deduced from the gene of the antimicrobial and antifungal peptides isolated from Scolopendra subspinipes (SEQ ID NO: 2) represented by SEQ ID NO: 3 below.
SEQ ID NO: 3:
Lys Ala Val Val Lys Glu Phe Leu Lys Arg Lys Ile Lys Val
The method of claim 3,
Wherein said peptide has antibacterial and antifungal activity.
5. The method of claim 4,
Wherein the antimicrobial activity is exhibited for at least one of Staphylococcus aureus , Escherichia coli 0-157 ( Escherichia coli 0-157).
5. The method of claim 4,
Wherein said antifungal activity is exhibited against Candida albicans .
The method of claim 3,
Wherein said peptide is non-toxic to human red blood cells.
A pharmaceutical composition for an antibacterial and antifungal preparation, which comprises the peptide of any one of claims 3 to 7 as an active ingredient.
An antibiotic comprising the peptide of any one of claims 3 to 7 as an active ingredient.
A food preservative containing as an effective ingredient a peptide according to any one of claims 3 to 7.
A preservative for cosmetics containing the peptide of any one of claims 3 to 7 as an active ingredient.
7. A pharmaceutical preservative containing as an active ingredient a peptide according to any one of claims 3 to 7.

Images