KR101440915B1 - Specific primers for external amplification of dog interleukin-15, uese thereof, and method of manufacturing recombination dog interleukin-15 using the same - Google Patents

Abstract

The present invention relates to a primer set for external amplification of canine interleukin-15 and, more specifically, to a primer set capable of increasing the efficiency of external amplification of canine interleukin-15 and accordingly mass-producing recombinant canine interleukin-15; to a use thereof; and to a method of manufacturing recombinant canine interleukin-15 using the same.

Description

[0001] The present invention relates to a primer set for interleukin-15 in vivo amplification, a use thereof, and a recombinant recombinant interleukin-15 preparation method using the same,

The present invention relates to a primer set for canine interleukin-15 extracorporeal amplification, and more particularly, to a method for enhancing the efficiency of extracorporeal amplification of canine interleukin-15 using the above primer set, A primer set that can be produced, use thereof, and a method for producing recombinant canine interleukin-15 using the primer set.

Hematopoietic stem cells, one of the adult stem cells, are cells capable of differentiating into all the cells constituting the blood (red blood cells, white blood cells, platelets and lymphocytes), and mainly from the hematopoietic stem cells in the bone marrow. The cells that make up are continuously self-renewing. Among the cells constituting these immune systems, natural killer cells (hereinafter abbreviated as "NK cells") have been found to be capable of killing cancer cells and virus-infected cells nonspecifically, and many studies have been conducted , Defects in NK cell differentiation and activity have been found to be associated with various diseases such as breast cancer, melanoma, and lung cancer. Based on these studies, NK cell therapy using NK cells is emerging for the treatment of intractable diseases such as cancer.

Korean Patent No. 10-1375153 (published on Oct. 27, 2006) discloses a specific antibody that regulates the activity of NK cells in a mammalian subject and raises NK cell toxicity, Fragments and derivatives thereof as well as fragments and derivatives of the antibodies for increasing NK cell activity or cytotoxicity in a subject, especially in therapy, and methods of use thereof.

In addition, the method of immunological regulation of placental stem cells and placental stem cell group, more specifically, by immunological regulation, also produces placental cells and placental cell groups, Provides a screening method and describes compositions containing such cells and cell populations.

NK cells usually exhibit low numbers in peripheral blood mononuclear cells (PBMCs) and represent the preparation of reactor cells such as LAK cells. Therefore, current good manufacturing practice (cGMP), which allows polyclonal NK cells and NK-like T cells and B cells to multiply in flask cell culture using healthy donor-derived peripheral blood mononuclear cells, Are being developed. These cells appear to exert specific cytotoxic activity against new human tumor cells in vitro and experimental human tumor models opening the possibility of being evaluated in clinical settings. However, conventional flask-based cultures are labor-intensive and cumbersome, and only an assessment of virtually limited cell numbers can be made.

In order to treat cells using NK cells as described above, it is necessary to cultivate NK cells ex vivo, and it is essential to optimize the ex vivo differentiation conditions of NK cells. However, it is well known that experimental animal experiments such as the syngenic mouse model or xenograft mouse model, which have been used in the past, have difficulty in predicting the actual clinical efficacy as compared to the experiments using dogs and primates Since the in vitro amplification technique of NK cells was not established in experimental rats, most of the NK cells were purified and then activated by cytokines.

On the other hand, dogs have been shown to be very similar to human and dog genomes as a result of dog genome readings, and the genome, molecular biology, and histopathologic features of naturally occurring cancers in dogs, It has been shown that the response is very similar to that of cancer in humans, and it is a very interesting experimental model because of the spontaneous induction of diseases similar to human immune and infectious diseases. In addition, the incidence of intractable diseases such as cancer and viral diseases in dogs is remarkably increasing, and it is also necessary to develop new therapeutic agents for these intractable diseases.

Because of this biological similarity, studies on cancers in dogs provide valuable information that differentiates them from cancer studies that target only human or experimental animals. The awareness of such values is linked to cancer-related gene identification studies, environmental risk factors, Understanding of the biological characteristics of cancer, and development of novel cancer therapies and evaluation of efficacy, among others. However, there is no report about the confirmation of NK cells from dogs, its amplification, and cancer treatment using it from around the world.

In addition, the number of natural killer cells (NK cells) in the peripheral blood of dogs (0 ~ 5% of total lymphocytes) is significantly lower than that of humans (10 ~ 15%). Therefore, it is practically impossible to isolate and purify NK cells present in very small amounts (0 to 5% of total lymphocyte) from the peripheral blood of dogs and to directly use them for chemotherapy in order to perform immunotherapy, It is known that NK cells are a serious obstacle to in vitro amplification. However, since a large amount of highly activated NK cells is required for clinical treatment, there is a desperate need to improve the efficiency of amplification in vitro.

Disclosure of the Invention The present invention has been conceived to solve the above problems, and it is an object of the present invention to provide a primer set capable of amplifying canine interleukin-15 in vitro, a recombinant canine interleukin-15 produced using the same, and a method for producing the same.

The present invention provides a primer set for extracorporeal amplification of interleukin-15 comprising two or more base sequences of the group consisting of SEQ ID NOS: 2 to 5.

According to a preferred embodiment of the present invention, the canine interleukin-15 vector amplification primer set of the present invention comprises a primer set of SEQ ID NO: 2 and SEQ ID NO: 3; Or a primer set of SEQ ID NO: 4 and SEQ ID NO: 5.

According to another preferred embodiment of the present invention, the canine interleukin-15 vector amplification primer set of the present invention comprises a primer set of SEQ ID NO: 2 and SEQ ID NO: 3; And a primer set of SEQ ID NO: 4 and SEQ ID NO: 5.

In addition, the present invention provides a recombinant interleukin-15 comprising an amino acid residue at amino acid position 49 to amino acid position 162 of interleukin-15 from the genus.

According to a preferred embodiment of the present invention, the recombinant canine interleukin-15 may have an average molecular weight of 10 to 15 kDa.

Furthermore, the present invention provides a composition for preventing or treating canine or canine viral diseases comprising the recombinant canine interleukin-15.

In addition, the present invention provides anticancer agents comprising the recombinant canine interleukin-15.

In addition, the present invention provides a recombinant anti-interleukin-15 cell therapeutic agent.

Furthermore, the present invention relates to a method for isolating RNA, comprising the steps of: 1) isolating RNA by superposing blood collected from a dog on a concentration density gradient; A second step of preparing a DNA fragment by performing a reverse transcription-polymerase chain reaction from the RNA isolated in step 1; A step of ligation of an E. coli-derived cloning vector and a step of adding a recombinant cloning vector by adding E. coli and transformation; Amplifying the amplified product by performing amplification reaction using the recombinant cloning vector as a template; And 5) a step of ligation and transformation of the amplification product and an expression vector derived from Escherichia coli to produce a mature interleukin-15 expression vector; 15 (dog mature interleukin-15) expression vector comprising the same.

According to a preferred embodiment of the present invention, the concentration density gradient of the first step is a density gradient of Ficoll-Hypaque concentration and the specific gravity of Ficoll-Hypaque is 1.0 to 1.2 g / Lt; / RTI >

According to another preferred embodiment of the present invention, the amplification reaction of the two-step amplification reaction is performed by using Reverse Transcription-Polymerase Chain Reaction (PCR) using primers set forth in SEQ ID NOS: 2 and 3, The amplification reaction of the above 4 steps can be performed by a polymerase chain reaction using primers set forth in SEQ ID NOS: 4 and 5.

In addition, the present invention provides a method for producing a recombinant interleukin-15 gene, comprising the steps of: transforming the mature interleukin-15 expression vector with Escherichia coli; And an isopropyl-1-thio-beta-D-galactopyranoside was added to the transformed dog mature interleukin-15 expression vector to obtain recombinant interleukin-15 expression ; Lt; RTI ID = 0.0 > interleukin-15. ≪ / RTI >

Hereinafter, terms of the present invention will be described.

"Nucleotides" of the present invention are deoxyribonucleotides or ribonucleotides that are present in the form of single-stranded or double-stranded nucleic acids as constituent components of nucleic acids that are macromolecular molecules and, unless otherwise specified, Deoxyribonucleotide " means < / RTI > an analog of deoxyribonucleotide.

The term "primer " of the present invention is a single strand of oligodeoxyribonucleotides, suitable conditions (presence of four different nucleoside triphosphates and DNA or RNA polymerase) Quot; means to act as a starting material capable of initiating template-directed DNA synthesis in a suitable buffer solution. The suitable length of the primer is determined by the characteristics of the primer to be used, but it can be generally used as a length of 15 to 70 bp. The primer need not be exactly complementary to the sequence of the template, but may be complementary enough to form a hybridcomplex with the template.

Furthermore, the term "vector" of the present invention means an expression vector capable of expressing a protein of interest in a suitable host, which DNA sequence contains a DNA sequence operably linked to a suitable regulatory sequence so that the gene insert is expressed. Specifically, it may be constructed to include a suitable regulatory sequence including a promoter sequence, a terminator sequence, a cloning site, a constant resistance marker gene, an origin sequence for self-replication, and other suitable sequences. Such vectors may be plasmids, phages, cosmids, and the like. The preparation of these vectors, mutagenesis, sequencing, introduction of DNA into cells, and gene expression and protein analysis are described in detail in Current Protocols in Molecular Biology, edited by Ausubel et al., John Wiley & Sons (1992). Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, be integrated into the genome itself, and the term 'plasmid' and 'vector' are sometimes used interchangeably .

In addition, the term "operably linked " of the present invention means that the expression control sequences are functionally linked to regulate the transcription and translation of polynucleotide sequences encoding the protein of interest. It also involves maintaining the correct decoding frame so that a polynucleotide sequence is expressed under the control of an expression control sequence (including a promoter) to produce a polypeptide of the desired protein encoded by the polynucleotide sequence.

In addition, the target protein to be expressed in the present invention may be the target protein itself, but may be a sequence that facilitates purification, has various functions by fusion with an antibody or an enzyme, or increases solubility to increase solubility and Fusion protein, and the like. When the target protein contains a sequence for facilitating purification and the like, the desired protein can be expressed in the form of a fusion protein with such a sequence. Such a fused target protein can be composed of a fusion partner-linked peptide-target protein and can be produced variously according to each kind. More preferably, the fusion partner is selected from the group consisting of a histidine-tag, a glutathione-S-transferase, a maltose-binding protein, protein, protein A, protein G, flag peptide, thioredoxin, S-peptide, avidin, streptavidine, galactose binding protein A cellulose-binding domain, a chitin-binding domain, polyarginine, polycysteine, or polyphenylalanine can be used.

Further, the "transformation" of the present invention means that a vector is introduced into a prokaryotic cell such that a cloning vector or an expression vector recombined by a ligase reaction is amplified in bacteria or a gene transferred to an expression vector is expressed

The present invention provides a primer set for extracorporeal amplification of canine interleukin-15, which is essential for remarkably increasing the number of individual NK cells, to facilitate in vitro amplification of canine interleukin-15, There is an effect of inducing the increase.

In addition, recombinant canine interleukin-15 can be provided by using the above-mentioned canine interleukin-15 extracorporeal primer set, and the recombinant canine interleukin-15 can significantly increase the number of NK cells in a living body It is effective. Furthermore, the recombinant canine interleukin-15 has an effect of significantly increasing the extracorporeal amplification efficiency of the individual NK cells. Accordingly, the present invention can provide a composition for preventing and treating cancer or viral diseases of dogs comprising the recombinant canine interleukin-15.

FIG. 1 is a schematic diagram of an electrophoresis image and an expression vector cloning process as a PCR result in Example 2. FIG.
FIG. 2 is a schematic diagram of an electrophoresis photograph and a recombinant expression vector cloning process as PCR results in Example 3. FIG.
FIG. 3 is a SDS-PAGE photograph which is a result of induction of expression of canine interleukin-15 of Example 4 with IPTG.
Fig. 4 is a SDS-PAGE photograph showing induction of expression of canine interleukin-15 in Example 5 with IPTG and purification of large capacity.
5 is an SDS-PAGE photograph of the recombinant canine interleukin-15 of Example 5 after clean-up through Example 6. FIG.
Fig. 6 is a schematic diagram showing the manner of administration of the sterilized recombinant canine IL-15 protein and the blood collection schedule in the experimental preparation example.
7 shows the result of flow cytometry measured in Experimental Example 1. FIG.
8 is a flow cytometry analysis result measured in Experimental Example 2. FIG.
9 is a flow cytometry result measured in Experimental Example 2. FIG.
10 is a flow cytometry analysis result measured in Experimental Example 2. FIG.
FIG. 11 is a graph comparing changes in expression of NK cell-specific genes measured in Experimental Example 3. FIG.
12 is a graph showing the cytotoxicity of the CTAC cancer cell line of Experimental Example 4.
13 is a graph showing the in vitro amplification efficiency of NK cells measured in Experimental Example 5. FIG.
14 is a graph showing the cytotoxicity of the CTAC cancer cell line in Experimental Example 6.
15 shows the result of the interferon-gamma production assay analyzed in Experimental Example 7. Fig.
16 is a graph comparing changes in expression of NK cell-specific genes measured in Experimental Example 8. FIG.

Hereinafter, the present invention will be described in more detail.

As described above, it is practically impossible to isolate and purify NK cells present in peripheral blood (0 to 5% of total lymphocyte) in the peripheral blood and directly use them for chemotherapy, Is known to be a serious obstacle to in vitro amplification of NK cells. However, for the clinical treatment of dogs, a highly activated large amount of canine NK cells is required, and therefore, there is a desperate need to improve the efficiency of in vitro amplification.

Accordingly, the present invention has solved the above-mentioned problem by providing a canine interleukin-15 in vivo amplification primer set comprising two or more base sequences of the group consisting of SEQ ID NOS: 2 to 5. This has the effect of increasing the efficiency of canine interleukin-15 in vitro amplification which can increase the number of individual NK cells.

The canine interleukin-15 extracorporeal primer set of the present invention comprises two or more base sequences of the group consisting of SEQ ID NOS: 2 to 5.

The above primer set for extracorporeal external stimulation is not particularly limited as long as it comprises two or more base sequences of the group consisting of SEQ ID NOS: 2 to 5, preferably a primer set of SEQ ID NOS: 2 and 3; Or a primer set of SEQ ID NO: 4 and SEQ ID NO: 5, or a primer set of SEQ ID NO: 2 and SEQ ID NO: 3; And a primer set of SEQ ID NO: 4 and SEQ ID NO: 5.

The primer set for canine interleukin-15 extracorporeal amplification is not particularly limited as long as it is usually used for extracorporeal amplification of canine interleukin-15, but preferably it can be used for amplifying the interleukin-15 base sequence shown in SEQ ID NO: 1 , 243 to 729 nucleotides 486 base pairs in the actual open reading frame (ORF) among the above interleukin-15 base sequences, or 342 base pairs in nucleotides 388 to 729 nucleotides encoding the mature protein.

The suitable length of the primer is determined by the characteristics of the primer to be used, but it is usually 15 to 70 bp. The primer need not be exactly complementary to the sequence of the template but can be complementary enough to form a hybridcomplex with the template.

The present invention also relates to a primer set described above; And a reagent for carrying out an amplification reaction. ≪ IMAGE >

In the kit of the present invention, the reagent for carrying out the amplification reaction is not particularly limited as long as it is included in a DNA or RNA extracorporeal amplification kit, but it may include a DNA polymerase, dNTPs, a buffer solution and the like .

In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure may include instructions on the surface of a package that includes a brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure may include information that is disclosed or provided through an electronic medium, such as the Internet.

The primer set contained in the kit is a canine interleukin-15 extracorporeal primer set. The primer set included in the kit can be easily designed by those skilled in the art using the canine interleukin-15 primer set for extracorporeal amplification of the present invention , A primer set designed in this way is included within the scope of the present invention. Preferably, it may be a primer set designed based on the mRNA nucleotide sequence of canine interleukin-15 represented by SEQ ID NO: 1. More preferably, homology was determined after inputting human, mouse, and interleukin-15 sequences using a multiple sequence alignment program; And a secretion sequence prediction program, it is possible to design a primer set to amplify a sequence predicted as a mature protein.

Furthermore, the present invention provides a recombinant interleukin-15 comprising the 49th residue to the 162nd residue at the N-terminal amino acid position of the interleukin-15 from the individual. In addition, the recombinant canine interleukin-15 may have an average molecular weight of 10 to 15 kDa.

The amino acid sequences used in the present invention are abbreviated as follows in accordance with the IUPAC-IUB nomenclature.

IUPAC-IUB Nomenclature Abbreviation IUPAC-IUB Nomenclature Abbreviation IUPAC-IUB Nomenclature Abbreviation Alanine A Glycine G Proline P Arginine R Histidine H Serine S Asparagine N Isoleucine I Threonine T Aspartic acid D Leucine L Tryptophan W Cysteine C Lee Sin K Tyrosine Y Glutamic acid E Methionine M Balin V Glutamine Q Phenylalanine F

In addition, the present invention provides a composition for preventing or treating canine or canine viral diseases comprising the recombinant canine interleukin-15 described above.

The present invention also provides anticancer drugs or cell therapy agents for antivirus comprising the recombinant canine interleukin-15 described above.

The cancers are not particularly limited as long as they are abnormally grown by autonomous overgrowth of the body tissue. For example, the cancers are fibrosarcoma, lung cancer, breast cancer, leukemia, lymphoma, myeloma, osteosarcoma, breast cancer, rhabdomyosarcoma, , Liver cancer, pancreatic cancer, stomach cancer, colon cancer, skin cancer, brain cancer, prostate cancer and the like.

In addition, the above viral diseases are not particularly limited as long as they are viral diseases that can usually occur in dogs. Examples of such viral diseases include canine measles (distemper virus), kennel kope (parainfluenza), respiratory diseases (adenovirus type 2) It may be a viral disease such as hepatitis (adenovirus type 1), enteritis (parvovirus, coronavirus, rotavirus, astrovirus), flu (influenza virus), rabies (rabovirus).

The composition for preventing or treating canine or viral diseases comprising recombinant canine interleukin-15 according to the present invention may be administered orally or parenterally in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, Formulations, external preparations, suppositories, or sterile injection solutions.

More specifically, when formulating the composition, it can be prepared using a diluent or an excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, and the like.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like. These solid preparations may contain at least one excipient such as starch, calcium carbonate, Sucrose, lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Examples of liquid formulations for oral use include suspensions, solutions, emulsions, syrups and the like. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, .

Furthermore, the preparation for parenteral administration includes sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations and suppositories. Examples of the non-aqueous solutions or suspensions include propylene glycol, polyethylene glycol and olive oil Vegetable oil, injectable esters such as ethyl oleate, and the like can be used.

In addition, witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like may be used as a base for suppositories.

The recombinant canine interleukin-15 according to the present invention may vary depending on the age, sex and body weight of the dog, but is generally in an amount of 0.1 to 50 μg / kg, preferably 10 to 30 μg / kg, It can be administered in divided doses. In addition, the dose of recombinant interleukin-15 may be increased or decreased depending on route of administration, degree of disease, sex, weight, age, and the like. Accordingly, the dosage is not limited in any way to the scope of the present invention.

The present invention also relates to a method for isolating RNA, comprising the steps of: 1) isolating RNA by superimposing blood collected from a dog on a concentration density gradient; A second step of preparing a DNA fragment by performing a reverse transcription-polymerase chain reaction from the RNA isolated in step 1; A step of ligation of an E. coli-derived cloning vector and a step of adding a recombinant cloning vector by adding E. coli and transformation; Amplifying the amplified product by performing amplification reaction using the recombinant cloning vector as a template; And 5) a step of ligation and transformation of the amplification product and an expression vector derived from Escherichia coli to produce a mature interleukin-15 expression vector; 15 (dog mature interleukin-15) expression vector comprising the same.

First, the blood collected from the dog in the first step is superimposed on the concentration density gradient to collect white blood cells and isolate the RNA.

The concentration gradient is not particularly limited as long as it is usually used for separating RNA from a sample, but it may preferably be a density gradient of Ficoll-Hypaque concentration.

The specific gravity to be used for the density gradient of the Ficoll-Hypaque concentration is not particularly limited, but preferably 1.0 to 1.2 g / ml can be used.

On the other hand, when the RNA is separated from the blood collected from the dog by overlapping the concentration density gradient, there may occur a problem that excessive erythrocytes and granulocytes that do not actually express interleukin-15 may be excessively contained, It may be more desirable to isolate RNA from isolated white blood cells after leukocyte separation.

Thus, in one embodiment of the present invention, the step 1) of separating the mononuclear cells in leukocytes by superimposing the blood obtained from the dogs on the concentration density gradient, And separating the RNA from the mononuclear cells separated in the step 1-1. As a result, when the RNA was isolated directly from the blood collected from the dog, the amount of the RNA derived from the monocyte expressing the desired interleukin-15 in the sample when separated into the 1-1 and 1-2 stages as described above .

A method for separating mononuclear cells from blood is not particularly limited as long as it is a method used for separating mononuclear cells from blood. Preferably, a method for separating mononuclear cells from each other by concentration density gradient can be used. The concentration density gradient is not particularly limited as long as it is a method commonly used in the life sciences field, but preferably a Ficoll-Hypaque density gradient can be used.

Furthermore, the specific gravity to be used for the density gradient of Ficoll-Hypaque concentration is not particularly limited, but preferably 1.0 to 1.2 g / ml can be used.

The method for separating RNA from the monocytic cells of the present invention is not particularly limited as long as it is a method used for separating RNA from cells. For example, when monocyte cells are stimulated with lipopolysaccharide (LPS) Can be collected by a centrifuge, washed, and then purified to isolate RNA molecules.

Lipopolysaccharide (LPS) is a substance that constitutes the cell surface of Gram-negative bacteria and is known to play various roles in the interaction between pathogenic bacteria and eukaryotes. Another role of LPS is known to activate the cellular defense system of vertebrates and invertebrates, causing an inflammatory response in the host's body. In particular, lipopolysaccharides are known to stimulate immune cells and significantly enhance the expression of inflammatory cytokine genes.

The concentration of the LPS stimulation is not particularly limited as long as it is a concentration capable of stimulating cells, but it is preferable to add LPS at a concentration of 0.1 to 5 占 퐂 / ml.

Next, in step 2, a reverse transcription-polymerase chain reaction is performed from the RNA isolated in step 1 to prepare a DNA fragment.

The RNA amplification reaction is not particularly limited as long as it is an amplification method usually used for amplifying DNA from animal RNA. For example, reverse transcription-polymerase chain reaction (RT-PCR), polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification acid sequence-based amplification, a transcription-based amplification system, a strand displacement amplification or an amplification through a Q [beta] replicase, or any amplification of nucleic acid molecules known in the art Other suitable methods may be used.

In addition, among these methods, the polymerase chain reaction (PCR) is a method of amplifying a target sequence from a primer set that specifically binds to a target sequence using a polymerase. Such PCR methods are well known in the art and commercially available kits can be used.

Further, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance is not particularly limited as long as it is ordinarily used as a primer-labeled substance. For example, fluorescent, phosphorescent or radioactive materials can be used, and preferably Cy-5 or Cy-3 can be used. When Cy-5 or Cy-3 is used, Cy-5 or Cy-3 is labeled at the 5'-end of the primer when the target sequence is amplified. When PCR is performed, the target sequence is labeled with a detectable fluorescent labeling substance . When the radioactive isotope such as ³² P or ³⁵ S is added to the reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive.

Furthermore, a set of primers used for amplifying the target sequence may include two or more of the nucleotide sequences shown in SEQ ID NOS: 2 to 5.

In one embodiment of the present invention, the amplification reaction in the second step may be performed by performing a polymerase chain reaction (PCR) using the primer sets of SEQ ID NOS: 2 and 3.

On the other hand, in the step 2, in the case of preparing the DNA fragment by performing the amplification reaction only on the RNA isolated in the step 1, problems such as amplification failure and / or nonspecific amplification may occur. it may be more preferable to perform a polymerase chain reaction (PCR) after transcription.

Thus, in another embodiment of the present invention, the step 2 includes a step 2-1 of preparing cDNA by reverse transcription from the RNA isolated in step 1; And 2-2 step of preparing a DNA fragment by performing a polymerase chain reaction (PCR) from the cDNA.

First, in step 2-1, cDNA can be prepared by reverse transcription from the RNA isolated in step 1.

The reverse transcription reaction is a method for synthesizing a complementary DNA from a primer set that specifically binds to a target sequence using a reverse transcriptase in an RNA template, and is not particularly limited as long as it can be used for producing cDNA.

Next, in step 2-2, a DNA fragment can be prepared by performing a polymerase chain reaction (PCR) on the cDNA.

The polymerase chain reaction (PCR) is performed to amplify a target sequence from SEQ ID NO: 2 and SEQ ID NO: 3, which are primer sets that specifically bind to a target sequence using a polymerase. Generally, The PCR method to be performed is not particularly limited, and a commercially available kit can be used.

Next, in step 3, a recombinant cloning vector is prepared by ligation of an E. coli-derived cloning vector and E. coli addition and transformation of the DNA fragment of the second step.

The transformation is not particularly limited as long as it is a method of transforming DNA. Preferably, one or more methods selected from the group consisting of heat shock therapy and electric shock therapy can be used. More preferably, thermal shock therapy have.

The E. coli added to the DNA fragment is added to amplify the introduced vector in bacteria, and is not limited as long as it can be usually obtained or purchased from an organism.

Next, in step 4, an amplification product is prepared by amplifying the recombinant cloning vector as a template.

The amplification reaction is not particularly limited as long as it is an amplification method usually used for amplifying an animal DNA. For example, reverse transcription-polymerase chain reaction (RT-PCR), polymerase chain reaction (PCR), ligase reaction, nucleic acid sequence amplification sequence amplification, sequence-based amplification, transcription-based amplification systems, amplification with strand displacement amplification or Qβ replicase, or any other means for amplifying nucleic acid molecules known in the art A suitable method can be used.

Furthermore, a set of primers used for amplifying the target sequence may include two or more of the nucleotide sequences shown in SEQ ID NOS: 2 to 5.

In one embodiment of the present invention, the amplification reaction in step 4 may be performed by a polymerase chain reaction (PCR) using primers set forth in SEQ ID NOS: 4 and 5.

Next, in step 5, a mature interleukin-15 expression vector is prepared by ligation and transformation of the amplification product prepared in step 4 and an E. coli-derived expression vector.

The transformation is not particularly limited as long as it is a method of transforming DNA, but preferably one or more methods selected from the group consisting of heat shock therapy and electric shock therapy can be used, more preferably thermal shock therapy have.

The ligation reaction uses a ligase in DNA replication to form a phosphodiester bond between the newly synthesized 5 'phosphate group and the adjacent 3' OH of the adjacent DNA fragment, For example, a ligase such as a ligase selected from the group consisting of Escherichia coli ligase and T4 phage ligase can be used. For example, Can be used.

The E. coli-derived expression vector is used for purifying a recombinant protein, and is not particularly limited as long as it is a vector derived from Escherichia coli.

In addition, the present invention provides a method for producing a recombinant interleukin-15 comprising the steps of: transforming a mature interleukin-15 expression vector prepared as described above by adding E. coli; And an isopropyl-1-thio-β-D-galactopyranoside (IPTG) was added to the transformed mature interleukin-15 expression vector to obtain recombinant interleukin- 15 expression of the recombinant interleukin-15.

First, the step of transforming E. coli into a mature interleukin-15 expression vector is described.

The E. coli is added to amplify the expression vector and express the mature interleukin-15 gene and to express the expressed mature interleukin-15 protein, and is not limited as long as it can be usually obtained or purchased from an organism.

In addition, the method carried out in the above transformation is not particularly limited as long as it is a method of transforming DNA, but preferably one or more methods selected from the group consisting of heat shock therapy and electric shock therapy can be used, Can use thermal shock therapy.

Next, isopropyl-1-thio- beta -D-galactopyranoside (IPTG) was added to the transformed mature interleukin-15 expression vector to obtain recombinant dogs RTI ID = 0.0 > interleukin-15 < / RTI >

The IPTG is added to induce the expression of the mature interleukin-15 gene carried in the expression vector in the transformed E. coli cells, and is not particularly limited as long as it can be synthesized or purchased.

The concentration to which IPTG is added is not particularly limited as long as it is ordinarily used for inducing protein expression, but a concentration of 0.1 to 0.5 mM is preferably used.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to explain the present invention to the average person skilled in the art in more detail.

[ Example ]

Example  1. Specific to Interleukin-15 primer  Produce

In order to prepare a vector expressing recombinant canine interleukin-15 (IL-15) in E. coli, four primers were prepared based on the IL-15 mRNA base sequence (Genbank accession number, NM_001197188.1) represented by SEQ ID NO: Respectively. The IL-15 mRNA and the four primers are shown in Table 2 below.

division Sequence SEQ ID NO: 1 agaaacgttc gtgttgaaaa gccgagcggc ttccgttcca ggagacgcac ccccagagcc
cgtgagagcc ccctcgcgtg ctgcgtggcc gccttggctg tgaccgtgac ccgaagccac
ccgaagcctg tcactgcagc cgcggcctgg acaaaggaag tattctggat ggatggctgc
tggaaaccca ttgccatagc cagctcttct tcaatactta aggatttacc ctgcattgag
taatgagaat ttcgaaacca catttgagaa gtacttccat ccagtgctac ttgtgtttac
ttctgaacag tcattttcta actgaggctg gcattcatgt cttcattttg ggctgtatca
gcgcaggtct tcccaaaaca gaggcaaatt ggcaggacgt gatacttgat ttggaaaaaa
ttgacaatct tattcaatct atacatatgg ataccactct gtatactgaa agtgatgtgc
atcccagttg caaagtaacc gcgatgaagt gctttctcct ggagttaggt gttatctcgc
tcgagtccgg cagtcatccc attaaggaag cagtagagaa cctcatcatc ctcgcaaaca
gtgatctgtc ttcgaagggg aatataactg aaacgggatg caaagaatgt gaagaactgg
aggaaaagag tattaaggag tttttgcaga gtttcgtgca tatcgtacaa atgttcatca
actcctcttg atggcaaagg atctgcttcg gcatttctgc gattaaccag cgtcttccca
cggctcgaag gccgtgaaac cctctgcagg tcgttcgggc cgcctgaacg aatttttcta
acgagaagat gatccggaat ctcgggtcgg atgaactctt agaaactgaa ggcagaaaaa
tggcatcgag ggacgtgtcc gtgaactgtc ctcgtgctga ttttgttcat ttattcttaa
tttattaccg acgttgtaca tatctgtagc atactataga gcattgaata aaatcgtgta SEQ ID NO: 2 AAAGAATTCATGAGAATTTCGAAACCACATTTG SEQ ID NO: 3 AAACTGCAGTCAAGAGGAGTTGATGAACATTTG SEQ ID NO: 4 GAAGAATTCCATATGAATTGGCAGGACGTGATACTT SEQ ID NO: 5 TTTTTGTCGACTCAATGATGATGATGATGGTGGCCAGAGGAGTTGATGAACATTTG

SEQ ID NO: 2 and SEQ ID NO: 3 are primers designed to amplify 243 to 729 nucleotides, 486 base pairs, which is an actual open reading frame (ORF) among the IL-15 nucleotide sequences represented by SEQ ID NO:

SEQ ID NOS: 4 and 5 are primers designed to amplify 342 base pairs of 388 to 729 nucleotides encoding the final mature polypeptide from which the secretory signal peptide was removed in the ORF of the IL-15. to be. In addition, the primers of SEQ ID NOS: 4 and 5 predicted the maturation sequence of the IL-15 from which the secretion sequence functioning in vivo was removed. The primer of the last 162nd residue It is possible to amplify the gene coding sequence to serine.

The secretion sequence can be obtained by inputting human, mouse and IL-15 sequences into a multiple sequence alignment program provided at http://multalin.toulouse.inra.fr/multalin/multalin.html to analyze homology One result; And secretory sequence prediction programs provided at http://www.cbs.dtu.dk/services/SignalP/; And primer sequences for amplifying the sequences predicted as mature proteins were generated based on the results.

Example  2 IL -15 ORF Cloning  And transformation vector production

In order to clone the whole IL-15 whole ORF of Example 1, mononuclear cells in white blood cells were separated from the peripheral blood by using a discontinuous density gradient solution. For this purpose, 50 ml of peripheral blood was collected by aseptic heparin tube (BD Biosciences, Vacutainer Sodium Heparin) in the jugular vein of 8-year-old female dogs who were found to be healthy through blood tests and regular physical examinations.

The peripheral blood was diluted with PBS buffer (phosphate-buffered saline buffer: WEL GENE, DPBS) at a ratio of 1: 2 (v / v) to prepare a diluted peripheral blood. In addition, mononuclear cells were isolated from the diluted peripheral blood using a discontinuous density gradients solution.

The discontinuous density gradient solution was prepared by adding 100% Lymphoprep (specific gravity 1.077 g / ml, Axis-Shield, Lymphoprep ^TM ) to a 10 ml solution of Histopaque (specific gravity 1.119 g / ml, Sigma, HISTOPAQUEⓡ- 5 ml, and 10 ml of Lymphoprep (final specific gravity 1.058 g / ml, Axis-Shield, Lymphoprep ^TM ) diluted to 76% were each carefully stacked. Finally, 20 ml of the diluted peripheral blood was overlaid and then placed in a Beckman Coulter The mononuclear cells were separated by centrifugation at 400 xg for 25 minutes at room temperature using Allegra X-15R.

The separated mononuclear cells were placed in a 24-well flask (BD Biosciences, Tissue Culture Plate 24-Well) at 1 × 10 ⁶ cells / well and then the cells were treated with RPMI 1640 (Invitrogen Lipopolysaccharides (Sigma-Aldrich, Lipopolysaccharides) at a concentration of 1 μg / ml were added to the medium (composition: 450 ml of RPMI1640 + FBS 50 ml) and stimulated for 16 hours at 37 ° C in a 5% CO ₂ incubator , MCO-175). Then, the cultured cells were collected with a centrifuge (Beckman Coulter, Allegra X-15R), washed with saline, and then the washed cells were purified with a Trizol solution of TAKARA according to the manual.

Then, the cDNA was synthesized using a PCR Thermal Cycler device of TAKARA using oligo dT primer (base sequence: TTTTTTTTTTTTTTTTTTTTT) and Promega's ImProm-II Reverse Transcriptase. 1 μg of the above RNA and 1 μl of the 50 μM oligodeoxynthymine were mixed and incubated at 70 ° C. for 5 minutes. Then, 1 μl of 10 mM dNTPs added to the reverse transcriptase kit according to the manufacturer's instructions, 25 mM 4.8 μl of MgCl ₂ , 4 μl of 5 × reaction buffer, 1 μl of reverse transcriptase and sterilized distilled water were mixed and mixed in a 250 μl-PCR tube (AXYGEN) to a final volume of 20 μl, and the mixture was transferred to a PCR Thermal Cycler device Followed by reaction at 25 캜 for 5 minutes and 42 캜 for 90 minutes.

PCR was performed using the synthesized cDNA as a template and the primers represented by SEQ. ID. NO. 2 and SEQ ID NO: 3 using PCR Thermal Cycler device manufactured by TAKARA. 1 μl of the synthesized cDNA, 1 μl of each of the primers of SEQ ID NO: 2 and SEQ ID NO: 3 dissolved in 10 pmole / μl and 17 μl of sterilized water were suspended in PCR PreMix of Bioneer Inc. and PCR was carried out in a PCR Thermal Cycler apparatus of TAKARA The amplification process consisting of 30 seconds at 94 ° C, 30 seconds at 53 ° C, and 1 minute at 72 ° C was repeated 30 times, and the final step The final extension process was carried out at 72 ° C for 15 minutes. The DNA product amplified by PCR was electrophoresed on 1% agarose gel at 100 V for 45 minutes, stained with ethidium bromide (EtB) for 15 minutes, and stained with 507 bp After confirming the band of the amplified DNA fragment, the phenomenon was recorded as a photograph and shown in FIG.

1, M is a 100 bp size marker of Bioneer, and lines 1 and 2 are the amplified DNA fragments.

The amplified fragment of FIG. 1 was purified with a QIAquick PCR Purification kit of QIAGEN Co., Ltd. to a final volume of 20 μl according to the manual, and 3 μl of the purified DNA fragment was mixed with 1 μl of Promega's pGEM T easy vector. Mu] l and the mixture was ligation at 16 [deg.] C for 16 hours using an ALB6400 apparatus (Heating & Cooling Block) manufactured by FINEPCR to prepare a ligation reaction product.

A powder of calcium chloride (CaCl ₂ , Sigma-Aldrich) at a concentration of 0.1 M and a powder of Tris (Sigma-Aldrich) at a concentration of 10 mM were homogeneously dissolved in distilled water and then diluted with a Steritop filter (0.22 μm, GP millipore Express PLUS Membrane) to prepare a soluble cell buffer. After refrigerating at 4 ° C or lower, the compe- tent Escherichia coli DH5-alpha was prepared from the calcium chloride.

Specifically, Escherichia coli DH5-alpha was inoculated into 50 ml of LB medium (BD Biosciences, DIFCO ^占 LB Broth) and cultured at 37 占 폚 at 150 revolutions per minute with shaking in NB-205V apparatus of N-BIOTEC. After incubation for 30 minutes, the culture was cooled and incubated at 3500 rpm at 4 ° C for 20 minutes in a centrifuge (Beckman Coulter, Allegra X-15R). The cells were precipitated to remove the supernatant. The supernatant was removed by washing with 20 ml of the calcium chloride buffer solution and again with a centrifuge (Beckman Coulter, Allegra X-15R) under the above conditions. The precipitated cells were resuspended in 8 ml of the calcium chloride buffer and 600 쨉 l of DMSO (Sigma-Aldrich) was mixed to prepare a compeptent E. coli DH5-alpha. Then, the ligation reaction product was transformed into the water-soluble E. coli by thermal shock method to prepare a recombinant cloning vector.

Specifically, 10 .mu.l of the ligation reaction product was mixed with 100 .mu.l of the soluble E. coli DH5-alpha, preserved in ice for 1 hour, and heat shocked at 42.degree. C. for 1 minute using an ALB6400 apparatus (Heating & Cooling Block) And quickly stored on ice for 1 minute to cool. 200 μl of LB medium (BD Biosciences, DIFCO ^™ LB Broth) was added to the soluble Escherichia coli and ligation mixture and cultured at 37 ° C. for 20 minutes in an ALB6400 apparatus (Heating & Cooling Block) of FINEPCR. The cultured cells using the ampicillin (Sigma) the 100㎍ / ㎖ LB- agar medium containing the (BD Biosicences four, DIFCO ^TM LB Agar) JEIOTECH's culture medium (IB-25G) and plated on overnight at 37 ℃ Lt; / RTI > On the day following the transformation, 10 colonies showing resistance to ampicillin (Sigma) were selected and cultured in 3 ml of LB-amphicillin medium (LB; BD Biosciences, DIFCO ^占 LB Broth, ampicillin; , Sigma) in a 15 ml conical tube (15 ml Cornical Tube) containing SPL and incubated at 37 ° C for 7 hours with shaking on NB-205V apparatus of N-BIOTEC. After completion of the shaking culture, the cells were precipitated and recovered with a centrifuge (Beckman Coulter, Allegra X-15R). The plasmid DNA was purified according to the manual of DNA-spin plasmid DNA purification kit of iNtRON, Sequence analysis was requested.

As a result, one recombinant cloning vector carrying a complete sequence free of mutation was obtained and we named it pGEMT-cIL15 (see Fig. 1).

Example  3. mature dog IL -15 expression vector production

PCR was carried out using the primers of SEQ ID NOS: 4 and 5 prepared in Example 1, using the pGEMT-cIL15 obtained in Example 2 as a template and a PCR Thermal Cycler device manufactured by TAKARA. 1 μl of the pGEMT-cIL15 diluted 200 times with sterilized water, 1 μl each of the primers of SEQ ID Nos. 4 and 5 dissolved in 10 pmoles / μl and 17 μl of sterilized water were suspended in PCR PreMix of Bioneer Inc., The suspension was subjected to an initial denaturation at 95 ° C for 5 minutes in a PCR Thermal Cycler apparatus manufactured by TAKARA Inc. and then amplification was performed at 94 ° C for 30 seconds, at 53 ° C for 30 seconds, and at 72 ° C for 1 minute ) Was repeated 30 times, and the final amplification (final extension) was carried out at 72 ° C for 15 minutes. The amplification product of 392 bp was obtained by the above-mentioned PCR. The amplified DNA amplified product was electrophoresed on 1% agarose gel at 100 V for 45 minutes, then ethidium bromide (EtB) For 15 minutes, and the band was observed on a UV-illuminator. The phenomenon was photographed and shown in FIG.

In FIG. 2, M is a 100 bp size marker of Bioneer, and lines 1 and 2 are the amplified DNA fragments.

The amplified products were purified using QIAquick PCR Purification kit of QIAGEN according to the corresponding manual, digested with NdeI and SalI restriction enzymes (TAKARA), and purified using QIAquick PCR Purification kit of QIAGEN. In addition, the pET30a (+) vector (Novagen) was digested with NdeI and XhoI (bound to SalI) restriction enzyme (TAKARA), purified using QIAquick PCR Purification kit of QIAGEN, . After ligation, E. coli BL21 (DE3) was prepared and transformed into 20 colonies, and 5 ml of LB-kanamycin medium (LB; BD Biosciences, DIFCOTM LB Broth, kanamycin; final concentration 50 mu g / ml, Sigma). The cells were inoculated into a 15 ml conical tube (15 ml coronal tube). The inoculated colonies were shake-cultured at 37 ° C for 11 hours in an NB-205V apparatus of N-BIOTEC. Plasmid DNA was purified according to the corresponding manual using a DNA-spin plasmid DNA purification kit from Intron (iNtRON) Were asked to carry out sequence analysis.

As a result of the above base sequence analysis, two dog mature IL-15 hematopoietic vectors carrying an entire sequence free of mutations in the E. coli expression vector were obtained, and the present inventors named it pET30cIL15CH6 (see FIG. 2).

Example  4. Recombination IL -15 Induction induction

In order to express the recombinant canine IL-15 protein, two pET30cIL15CH6 clones prepared in Example 3 were transformed into E. coli BL-21 (DE3) (Novagen), which is a protein expression strain, by the same method as in Example 2 Recombinant canine IL-15 expressing clones were prepared. One colony showing resistance to kanamycin (Sigma) was selected from the recombinant open IL-15 expression clones, and 10 ml of LB-kanamycin medium (LB; BD Biosciences, DIFCOTM LB Broth, Kanamycin; / Ml, Sigma), and incubated at 37 ° C for 8 hours with shaking culture in NB-205V apparatus of N-BIOTEC Inc., and a final concentration of 0.25 mM isopropyl-1 -TO-β-D-galactopyranoside (IPTG, Promega) was added to induce the expression of recombinant open IL-15.

After the shaking culture, 200 μl of the culture solution and 50 μl of the culture solution were precipitated with a centrifuge (Eppendorf, Centrifuge 5415R) before the induction of the expression, and the resulting cells were subjected to SDS-PAGE dyes (Thermo SCIENTIFIC, Fermentas 4X SDS-PAGE sample loading buffer) and 15 증 of distilled water. Then, the cells were boiled at 100 ° C for 5 minutes, and then electrophoresed on a 15% SDS-PAGE gel using a BIO-RAD Tris / Glycine / SDS premixed electrophoresis buffer buffer and a MiniPROTEAN Tetra Cell apparatus for 90 minutes at 100 V for expression of IL-15 Respectively. The electrophoresis result is shown in FIG.

In FIG. 3, M is a protein size marker of BIO-RAD, line 1 is the result of electrophoresis of a cell lysate not induced by IPTG, and lines 2 and 3 are results of IPTG-induced transformed pET30cIL15CH6 This is the result of electrophoresis of the cell lysate of the clone.

As shown in FIG. 3, it was confirmed that the expression of IL-15 was well induced, and 6 histidine His-tag was attached at 12.8 kDa, which is the expected mature protein size, and recombinant IL-15 fusion with a size of about 13.8 kDa Protein was expressed.

Example  5. Recombination IL -15 mass expression and purification

15 ml of the recombinant open IL-15 expression clone was transfected into LB-kanamycin medium (LB; BD Biosciences) in Example 4 in order to mass-express the recombinant open IL-15 protein in the recombinant open IL- (50 ml conical tube) of SPL Co., Ltd., containing 50 μg / ml of final concentration, DIFCOTM LB Broth, kanamycin, Sigma) and incubated at 37 ° C for 11 hours with NB-205V device Lt; / RTI > 2 ml of the liquid phase prior to the shaking culture was transferred to a 1 L triangular glass flask containing 200 ml of LB-kanamycin medium (LB; BD Biosciences, DIFCOTM LB Broth, kanamycin; final concentration 50 μg / ml, Sigma) Product) and further shake-cultured at 37 ° C for 3 hours in an N-BIOTEC NB-205V apparatus. Then, 0.1 ml of 0.5 M IPTG was added to the final 0.25 mM concentration at an absorbance of 0.7 at a wavelength of 600 nm, and the mixture was shake cultured in an NB-205V apparatus of N-BIOTEC for 7 hours at 37 ° C to obtain a large amount of recombinant IL- Expression was induced.

After completion of the shaking culture, the culture solution was kept on ice for 30 minutes and cooled. Then, the cells were precipitated with a centrifuge (Beckman Coulter, Allegra X-15R) at 4 ° C to remove the supernatant, washed with cold saline, The supernatant was removed by centrifugation (Beckman Coulter, Allegra X-15R). The washed cells were resuspended by mixing 20 ml of a lysis buffer pH 8.0 (20 mM Tris-Cl, 500 mM NaCl, 10 mM Imidazole, Sigma) per 200 ml of the culture, Triton X-100 (Sigma) was added to a final concentration of 1%, followed by reaction at 4 ° C for 20 minutes.

Then, the cells were disrupted at 4 ° C for 20 minutes using an ultrasonic disintegrator (Sonics & Materials, VCX 500 Vibra-Cell ™, ultrasonic processor), and the disrupted solution was transferred to a microcentrifuge tube (Axygen) After centrifugation (Eppendorf, Centrifuge 5415R) at 4 ° C, only the supernatant was collected. Protein purification was performed according to the manufacturer's manual using a column (BIO-RAD, Econo-Pac Chromatography Columns) containing 2 ml of Ni-NTA agarose (QIAGEN) in the supernatant.

In order to confirm whether the recombinant canine IL-15 protein was purified in the protein obtained from the protein purification, 1.5 ml of elution buffer (8.0, 20 mM Tris-Cl, 150 mM NaCl, 500 mM Imidazole, Sigma) 20 μl of the sample obtained from the protein purification was subjected to electrophoresis on 15% SDS-PAGE. The electrophoresis results are shown in FIG.

In FIG. 4, M is a protein size marker of BIO-RAD, and lines 1 and 2 are the electrophoresis results of the recombinant open IL-15 protein.

As can be seen in Fig. 4, it was confirmed that the recombinant open IL-15 protein was successfully purified.

Example  6. Recombination IL -15 refinement and removal of inflammatory substances

The recombinant proteins expressed and purified in Escherichia coli carried out in Examples 1 to 5 always contain endotoxin and lipid polysaccharide which are lipid components of Escherichia coli in the purification process. However, since endotoxin and lipid polysaccharide are strong inflammatory substances, they must be removed after protein purification if they are intended for biomedical injection. Therefore, after purification of the purified recombinant IL-15 protein in a large amount in Example 5, endotoxin A and lipopolysaccharide (LPS), which are inflammation inducing substances, were removed.

In order to remove the endotoxin, the endogenous toxin was removed from the recombinant canine IL-15 protein prepared in Example 5 using the Pierce High-Capacity Endotoxin Removal Resin of Thermo SCIENTIFIC, according to the manufacturer's manual Recombinant canine IL-15 protein samples were prepared.

In order to remove the imidazole component and the buffer Tris component from the protein sample and then to replace the buffer solution (hereinafter referred to as "liquid phase") in the protein sample with physiological saline, VIVASPIN 20-VS2001 10,000 MWCO PES (sartorius stedim biotech The buffer exchange operation was carried out using the above-mentioned buffer solution.

Specifically, 15 ml of the recombinant purified IL-15 protein sample from which the endotoxin was removed was added to the VIVASPIN 20 column and centrifuged (Beckman Coulter, Allegra X-15R) at 4 ° C for 100 minutes at 3000 rpm After the liquid phase was removed from the bottom of the filter in the column, 20 ml of sterilized physiological saline was added to the column, and then the centrifuge was operated again. After repeating the above procedure three times, 2 ml of physiological saline was added at the last step to recover the recombinant canine IL-15 protein from which the endotoxin was removed on the filter. The recombinant open-label IL-15 protein from which the endotoxin has been removed has a molecular weight of 13.8 kDa and is present on the filter because it does not pass through a 10K-size column and stagnates on the filter membrane.

To determine the concentration of the recovered recombinant IL-15 protein recovered thereafter, the concentration of the protein was determined with BIOADAD's Bradford reagent and 110 μg physiological saline per 1 ml of the recovered recombinant IL-15 protein was added Diluted recombinant canine IL-15 protein was prepared. Then, sterilized recombinant canine IL-15 protein was prepared by sterilization by passing through a sterilized 0.2 mu m syringe filter (PALL) for use as an injection.

20 μl of the sterilized recombinant canine IL-15 protein was mixed with 5 μl of a dye for SDS-PAGE (Thermo SCIENTIFIC, Fermentas 4X SDS-PAGE sample loading buffer), boiled at 100 ° C. for 5 minutes, and then subjected to 15% SDS- Electrophoresis was performed at 100 V for 90 minutes in RAD's Tris / Glycine / SDS premixed electrophoresis buffer buffer and MiniPROTEAN Tetra Cell device. The electrophoresis results are shown in FIG.

M in Fig. 5 is a protein size marker of BIO-RAD, and line 1 and line 2 are electrophoresis results of sterilized recombinant canine IL-15 protein.

As shown in FIG. 5, no physico-chemical transformation such as decomposition of proteins was induced in the process of removing endotoxin and replacement with physiological saline on 15% SDS-PAGE, and a pure recombinant canine IL-15 protein was obtained .

Experiment Preparation Example . Recombinant IL -15 protein administration

The sterilized recombinant canine IL-15 protein prepared in Example 6 was administered to dogs. FIG. 6 is a schematic diagram showing the method and schedule of recombinant open IL-15 administration. The dog breed used in the experiment was 'beagle', and the sterilized recombinant canine IL-15 protein was administered.

The sterilized recombinant canine IL-15 protein administration method was intravenously injected with 20 μg of sterilized recombinant canine IL-15 protein per kg of dog, and was administered once a day for a total of 8 days.

In order to confirm whether the sterilized recombinant canine IL-15 protein increased the number of NK cells in the peripheral blood and enhance the efficiency of the in vitro amplification, the cells were pretreated 2 days, 4 days, 6 days, 8 days, 11 days, 18 days On the first day, blood samples were collected.

Experimental Example  1. Analysis of leukocyte distribution in peripheral blood

In the experimental preparation example, peripheral blood drawn before and after the sterilized recombinant canine IL-15 protein was collected into an ethylenediaminetetraacetic acid (EDTA) tube, and the tube was shaken evenly. 50 μl of the peripheral blood was added to 5 ml of a flow cytometry analysis tube (manufactured by BD Biosciences), and 5 ml of Polystyrene Round-Bottom Tube (BD Biosciences, Inc.) was loaded with a red blood cell hemolysis buffer VersaLyse (BECKMAN COULTER 1 ml) was added and red blood cells were hemolyzed at room temperature for 20 minutes. And then analyzed by flow cytometry analyzer FACSCalibur (BD Biosciences). The results of the analysis are shown in Figure 7 for the percentage of lymphocyte counts in total cell counts of granulocytes (denoted by blue ellipses), monocytes (denoted by purple ellipses) and lymphocytes (denoted by red ellipses) .

As can be seen in FIG. 7, it was confirmed that the lymphocytes gradually increased with the sterilized recombinant canine IL-15 protein administration 3 days after the completion of administration, that is, 11 days after the first administration. Thus, the sterilized recombinant canine IL-15 protein has an effect of increasing the number of lymphocytes in peripheral blood of dogs after administration of the biomarkers.

Experimental Example  2. Analysis of phenotypic changes of monocytes in peripheral blood

Peripheral blood was drawn into heparin tubes (BD Biosciences, Vacutainer Sodium Heparin) before and after sterilized recombinant canine IL-15 protein administration. Thereafter, 20 ml of saline was added to 10 ml of the peripheral blood, and the mixture was homogeneously mixed using a pipette (manufactured by BD Biosciences). A 50 ml conical tube containing 15 ml of Lymphoprep (Axis-Shield Co.) having a specific gravity of 1.077 g / (SPL Lifesciences, 50 ml Cornical Tube) so that the layers were not mixed. After centrifugation at 2300 rpm for 25 minutes with a brake without Beckman Coulter's Allegra X-15R, only the buffy coat layer on the Lymphoprep was carefully taken, washed with saline and centrifuged (Beckman Coulter, Allegra X-15R ) And suspended in saline. 10 μl of the cell suspension was collected with a micropipette (Gilson), dispensed into a Neubauer Chamber slide of a hematopoietic cell counter of Paul Marienfeld GmbH, placed on a cover slide (Microscope Cover Glasses, Paul Marienfeld) Leica Microsystem) to count the number of cells per ml. The recovered cells were dispensed into 96-well round bottom plates (SPL, 96-well Cell Culture Plate U-type) at 100,000 units and centrifuged at 2000 rpm for 3 minutes using a centrifuge (Beckman Coulter, Allegra X-15R ) Apparatus and the supernatant was removed with a pipette (Gilson). The cells were then suspended in 100 [mu] l of a flow cytopathic buffer to a cell pellet. The flow cytopathic buffer was prepared by mixing 100 ml of saline and 1 g of bovine serum albumin (Bio Products).

3 μl of the FITC-CD3 antibody (seroTec, MOUSE ANTIDOG CD3: FITC) and 3 μl of the APC-CD5 antibody (SeroTech, RAT ANTIDOG CD5: APC) were added to all the suspended wells and mixed. (SeroTech Inc., RAT ANTIDOG CD4: RPE), PE-dog CD8 antibody (SeroTech Inc., RAT ANTIDOG CD8: RPE) and PE-dog CD21 antibody (SeroTech Inc., MOUSE ANTI CANINE CD21: RPE) was added to each well, and the mixture was mixed with Micropipette (Gilson) and cultured at 4 占 폚 for 20 minutes. The supernatant was then removed by centrifugation at 2000 rpm for 3 minutes using a centrifuge (Allegra X-15R from Beckman Coulter). Then, 100 μl of paraformaldehyde solution prepared by suspending 2 g paraformaldehyde (Sigma, paraformaldehyde) in 100 ml of saline was added, and the cells were suspended and fixed. Then, the fixed cells were transferred to a flow cytometry tube (BD Biosciences, 5 ml Polystyrene Round-Bottom Tube), 500 μl of the fixative was added and suspended in an even solution. And then analyzed by flow cytometry analyzer FACSCalibur (BD Biosciences). The results of the analysis are shown in FIGS. 8 to 9.

FIG. 8 shows the results of analysis of phenotypes of CD3, CD4 and CD8 among cell surface receptor molecules of lymphocytes. FIG. 9 shows the results of analysis of phenotypes of CD21, TCRαβ and TCRγδ among cell surface receptor molecules of lymphocytes. And the expression of CD11c and CD11d in cell surface receptor molecules. In addition, the ellipses of Figs. 8 to 10 represent the CD5 ^low cell group.

As shown in FIGS. 8 to 10, the CD5 ^low cell population known as NK cell characteristics increased to the highest level on day 8 after the recombinant canine IL-15 administration, and on the 18th day after discontinuation of administration, But it was confirmed that many CD5 ^low cell clusters remained.

Thus, it was found that the recombinant canine IL-15 protein of the present invention has an effect of increasing the population of CD5 ^low cell clusters known to be characteristic of NK cells in the peripheral blood of dogs after administration of the biomarkers.

Experimental Example  3. Investigation of gene expression changes

NK cells are characterized by the presence of specific receptor proteins such as CD16, NKG2D, NKp30, NKp44, NKp46, and Ly49 on the cell surface and perforin (Pfr) and granzyme B (GZB) And thus can be used to compare the production of NK cells in allogeneic species.

Increased number of NK cells in the peripheral blood would increase the expression of NK cell-related genes. In order to confirm that the number of NK cells in the peripheral blood was increased by in vivo administration of the recombinant IL-15 protein in allogeneic individuals, -15 Protein samples were collected from peripheral blood before and after administration, and mononuclear cells were isolated using discontinuous density gradients .

Separation of mononuclear cells in the peripheral blood before and after the administration of recombinant IL-15 was carried out by density gradient gradient Phycol-HiPark method. Purification of total RNA and cDNA synthesis were carried out in the same manner as in Example 2 above.

The concentration-density gradient Pycol-HiPark method was used to collect 50 ml of peripheral blood in a heparin tube (BD Biosciences, Vacutainer Sodium Heparin) before and after sterilized recombinant canine IL-15 protein administration in the experimental preparation example. Then, the peripheral blood was diluted 1: 2 (v / v) with PBS buffer (phosphate-buffered saline buffer, WEL GENE, DPBS) to prepare diluted peripheral blood. Then 20 ml of the diluted peripheral blood was carefully raised on the discontinuous density gradients solution, and the mononuclear cells were separated by centrifugation at 400 x g for 25 minutes at room temperature using Beckman Coulter's Allegra X-15R . The discontinuous density gradient solution was prepared by adding 100% Lymphoprep (specific gravity 1.077 g / ml, Axis-Shield, Lymphoprep ^TM ) to a 10 ml solution of Histopaque (specific gravity 1.119 g / ml, Sigma, HISTOPAQUEⓡ- 5 ml and 10 ml of Lymphoprep (final specific gravity 1.058 g / ml, Axis-Shield, Lymphoprep ^TM ) diluted to 76% were prepared by carefully and sequentially superposing the layers so that they were not mixed with each other

The separated mononuclear cells were washed with saline, and the washed cells were purified with a Trizol solution of TAKARA in accordance with the corresponding manual. The RNA molecules were ligated with oligo dT primer (base sequence: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT) and Promega's reverse transcriptase (ImProm-II Reverse Transcriptase) according to the corresponding manual and using TAKARA's PCR Thermal Cycler device Were synthesized. The changes in the expression of genes related to NK cells were then analyzed by real-time reverse transcription-polymerase chain reaction (RT-PCR).

NK cell-related genes such as CD16, NKG2D, NKp30, NKp44, NKp46, Ly49, perforin (Pfr) and Grasnzyme B (GZB) which are specifically expressed in NK cells in mononuclear cells isolated from peripheral blood gene was performed by real-time RT-PCR for the expression analysis of primers shown in Table 3 below.

Genes (accession number ^a ) Primer Nucleotide sequence (5'-3 ') Region ^b (nt) Size
(bp) Sequence Listing Number Beta-actin
(Z70044) cActin-F ACCAACTGGGACGACATGGAGA 165-186 205 SEQ ID NO: 6 cActin-R AGGCATACAGGGACAGGACAG 349-369 SEQ ID NO: 7 CD16
(XM_536141) cCD16-F ACAGTGTGACTCTGAAATGCCAG 119-141 188 SEQ ID NO: 8 cCD16-R GACTTCTAGCTGCACCGGGTCA 285-306 SEQ ID NO: 9 NKG2D
(XM_849013) cNKG2D-F GTTATTGTGGTCCGTGTCCTAA 188-209 222 SEQ ID NO: 10 cNKG2D-R ACTGCCAGGATCCATTTGTTGG 388-409 SEQ ID NO: 11 NKp30
(DQ003484) cNKp30-F CTTCTTGCCGTGTTCCTTCAA 51-71 236 SEQ ID NO: 12 cNKp30-R CCAGAACCTCCACTCTGCACA 266-286 SEQ ID NO: 13 NKp44
(XM_846203) cNKp44-F ACCAGGTTAGTCAGCAGCTCCA 229-250 205 SEQ ID NO: 14 cNKp44-R CTGGAGACACTGCCAGATAGAAT 411-433 SEQ ID NO: 15 NKp46
(XM_849055) cNKp46-F TATGATACGCCCACTCTCTCCGTT 361-384 217 SEQ ID NO: 16 cNKp46-R ATCCAAAACATCTGTACGTCCCTC 554-577 SEQ ID NO: 17 Ly49
(AY191818) cLy49-F GATTCTTGGGATCCTGTGTTTACT 300-323 236 SEQ ID NO: 18 cLy49-R GTAAATCCTGTTCCTTTTTCTGCTG 511-535 SEQ ID NO: 19 Perforin
(FJ973622) cPerforin-F ACAGGTACAGCTTCAGCACTGAC 494-515 189 SEQ ID NO: 20 cPerforin-R CCATGGACCGGATGAAGTGGGT 661-682 SEQ ID NO: 21 Granzyme B
(XM_547752) cGZB-F GGAGAGATCATCGGGGGACATGA 448-470 195 SEQ ID NO: 22 cGZB-R CTCCTGTTCCTTGATGTTGTGG 621-642 SEQ ID NO: 23

In Table 3, a is the accession number of the Genbank, and b is the number of digits from the first nucleotide of the gene.

In real-time PCR, 1 μl of the synthesized cDNA and 1 μl of each primer for each of the corresponding genes dissolved in 10 pmoles / μl, 9.5 μl of sterilized water, and 12.5 μl of QuantiTect SYBR Green PCR Kits (200) Reactants were mixed in QIAGEN PCR tubes (Strip Tubes and Caps, 0.1 ml), and the samples were placed in a Rotor-Gene 3000 (QIAGEN) and reacted. The real-time PCR reaction was carried out by repeating the amplification process consisting of 30 sec at 94 ° C, 30 sec at 53 ° C and 30 sec at 72 ° C for 45 times after activation of Taq polymerase at 95 ° C for 15 min, Gt; C to < RTI ID = 0.0 > 99 C. < / RTI >

The results of the real-time PCR reaction were plotted on a graph of relative expression of beta-actin.

As shown in Fig. 11, the expression of activated receptor genes (CD16; 3.5 times, NKG2D: 2 times, NKp30: 4.4 times, NKp44: 2 times, NKp46, 4.5 times and Ly49: 5.3 times), and gene expression of protein molecules (perforin: 2.8 times, Granzyme B: 4.4 times) essential for cancer cell toxicity was also increased.

Therefore, it was confirmed that the recombinant canine IL-15 protein of the present invention has an effect of increasing NK cell populations in peripheral blood mononuclear cells and enhancing the expression of protein molecules essential for NK cell-related activation receptor and cancer cell toxicity.

Experimental Example  4. CTAC Cancer cell  About Cytoxin performance  evaluation

One of the characteristics that NK cells have as effector cells is the direct cytotoxicity to cancer cell lines, so that the frequency or activation level of NK cells in allogeneic species can be compared. Monocytes were isolated from peripheral blood before and after the administration of recombinant canine IL-15 protein in order to determine whether the population of NK cells increased in peripheral blood by in vivo administration of recombinant canine IL-15 protein in allogeneic individuals. The cytotoxicity of canine thyroid adenocarcinoma (CTAC), which is a cancer cell-susceptible cancer cell line, was evaluated.

Specifically, the mononuclear cells were isolated from the allogeneic peripheral blood before the administration of the recombinant canine IL-15 protein and at the eighth day after the administration in the same manner as in Experimental Example 3. After washing with saline, the cells were washed twice with RPMI1640 and 10% FBS (Invitrogen) And suspended in RPMI1640 (Invitrogen) medium (450 ml of RPMI1640 + 50 ml of FBS) to produce effector cells. The number of cells in the mononuclear cells of the effector cells was then calculated. The cell count was calculated by dividing 10 μl of the above cell suspension into a Neubauer Chamber slide of a blood cell counter of Paul Marienfeld GmbH by Micropipette (Gilson), placing it on a cover slide (Microscope Cover Glasses, Paul Marienfeld) , Leica Microsystem), and the number of cells per ml was calculated.

Target cells of CTAC (pre-sale from ATCC, American Type Culture Collection) is dispensed before the experiment 96-well flat plate (SPL four, 96-well Cell Culture Plate flat -type) 1 × 10 4 cells per well (well) on And cultured for 24 hours. On the day of the analysis, the medium was removed with a micropipette (Gilson) and contacted at a ratio of 20: 1, 10: 1, 5: 1 and 2.5: 1, respectively, to the number of effector cells: CTAC cells. 100 [mu] l of the mononuclear cell suspension containing the cell numbers in the respective proportions was dispensed into each well of a 96-well plate plate cultured with CTAC as a target cell with a micropipette (Gilson) and centrifuged at 1500 rpm for 3 minutes (Beckman Coulter, Inc., Allegra X-15R) is operated to contact the cancer cell line. Then, the cells were placed in a carbon dioxide-incubator (MCO-175, manufactured by Sanyo) and cultured at 37 ° C under 5% CO ₂ for 3 hours. After the above cultivation, 10 μl of WST-1 chromogenic reagent was added according to the manual of EZ-CyTox kit (Daewoil Laboratories) and further incubated at 37 ° C and 5% CO ₂ for 1 hour. After the additional incubation, the mixture was centrifuged at 2,000 rpm for 3 minutes with Allegra X-15R manufactured by Beckman Coulter, and 90 μl of the supernatant was collected with a micropipette (Gilson) and dispensed into the same new plate of SPL Co., Lt; RTI ID = 0.0 > infinite < / RTI > M200 pro. Then, the cytotoxicity was calculated by the following equation (1).

At this time, the value of A ₄₅₀ is the absorbance at 450 nm.

The results of the cytotoxicity are shown in FIG.

As shown in FIG. 12, it was confirmed that direct cytotoxic effect on CTAC cancer cell line was increased in monocytes at 8 days after administration of recombinant IL-15.

As a result, it was found that the recombinant canine IL-15 protein of the present invention increases the number of NK cells in the peripheral blood mononuclear cells and activates these cells, thereby directly enhancing the cytotoxicity against cancer cells.

Experimental Example  5. NK Evaluation of in vitro amplification efficiency of cells

Mononuclear cells were isolated from peripheral blood before and after the administration of recombinant canine IL-15 protein in allografts to compare whether the cells increased by in vivo administration of the recombinant canine IL-15 protein had an effect on the enhancement of in vitro amplification efficiency.

Mononuclear cells were isolated from peripheral blood samples collected before and after the administration of recombinant IL-15 protein and peripheral blood samples collected after 8 days of administration in the same manner as in Experimental Example 3. The separated mononuclear cells were placed in a 24-well flight (BD Biosciences, Tissue Culture Plate 24-Well) at 3 × 10 ⁶ cells / well. K562 cells were plated at 0.5 × 10 ⁶ cells / well in the 24- In addition, the cells were cultured in a 5% CO ₂ incubator (MCO-175, manufactured by Sanyo) at 37 ° C for 21 days to amplify NK cells in vitro. The culture was carried out by adding 100 IU / ml of human IL-2 protein (PeproTec, Recombinant Human IL) to RPMI1640 medium (RPMI1640 450 ml + FBS 50 ml) containing 10% bovine serum (FBS, Invitrogen) -2) and 5 ng / ml human IL-15 protein (PeproTec, Recombinant Human IL-15) or 5 ng / ml of the sterilized recombinant canine IL-15 protein prepared in Example 6 The culture medium was changed every 2 days and cultured for a total of 21 days.

Then, the number of cells was examined at 2 weeks and 3 weeks from the start of the culture, and the methods were as follows.

Specifically, after incubating the canine NK cells cultured in a well with a micropipette (Gilson), 10 μl of the cell suspension was dispensed into a Neubauer Chamber slide, a cell counter of Paul Marienfeld GmbH, and a cover slide , And the number of cells per ml was calculated by directly counting the number of cells in an optical microscope (Leica Microsystem, Leica). Cell suspensions 100,000 cells were plated on a cytospin slide (manufactured by Paul Marienfeld GmbH), stained with May-Grunwald-Giemsa, and then stained with 500 cells (Leica Microsystem) using a microscope The number of cells having the characteristics of the individual NK cells was counted and divided by 500 to calculate the purity. The calculation result graph is shown in FIG.

As shown in FIG. 13, it was confirmed that the amplification rate of NK cells amplified in peripheral blood on the eighth day after the administration of the recombinant open IL-15 protein was remarkably increased. In particular, the sterilized recombinant canine IL- 15 protein showed higher NK cell amplification efficiency than the conventional human IL-15 protein.

As a result, it was found that the recombinant canine IL-15 protein of the present invention increased the number of NK cells in canine peripheral blood, thereby remarkably improving the extracorporeal amplification efficiency.

Experimental Example  6. Amplified NK Cell Cytoxin performance  evaluation

To examine whether the NK cells derived from the dogs amplified in Experimental Example 5 were functioning as effector cells, the cytotoxicity of the cell line to the same cell line as that of the CTAC cell line of Experimental Example 4 was evaluated by the same method as that of Experimental Example 4 Respectively. The results of the cytotoxicity assay are shown in FIG.

As can be seen from FIG. 14, the NK cells amplified in Experimental Example 5 showed significantly higher cytotoxicity against CTAC cancer cell line than the monocyte, and the sterility of the human IL-15 protein prepared in Example 6 The cytotoxicity of NK cells amplified with the recombinant canine IL-15 protein was improved.

As a result, it was found that the recombinant canine IL-15 protein of the present invention has an effect of enhancing not only the NK cell amplification rate but also the cytotoxicity of NK cells amplified by the copper protein to the CTAC cancer cell line.

Experimental Example  7. Amplified NK Interferon-gamma of cells interferon -γ) Production evaluation

Interferon-gamma (interferon-gamma) is a cytokine that plays a very important role in anticancer function. Another feature that NK cells have as effector cells in addition to cytotoxicity is the production of interferon-gamma by direct reaction with cancer cell lines. In order to investigate whether the NK cells derived from the dogs amplified in Experimental Example 5 perform anticancer functions, the interferon-gamma production ability of the same cell line as the CTAC cell line of Experimental Example 4 was analyzed.

Specifically, the canine NK cells cultured in the 2 to 3 wells of Example 5 were suspended in a micropipette (Gilson) and washed with saline to completely remove cytokine components remaining in the culture medium. Then, 10% FBS (450 ml of RPMI1640 + 50 ml of FBS) containing RPMI1640 (Invitrogen, Inc) to prepare effector cells. Then, 10 μl of the cell suspension was dispensed into a Neubauer Chamber slide of Paul Marienfeld GmbH, and microscope (Leica Microsystem) was placed on a cover slide (Microscope Cover Glasses, Paul Marienfeld) The number of cells per ml was counted.

On the day before the experiment, CTAC (ATCC, marketed by American Type Culture Collection) was used to dispense 2 x 10 ⁴ cells per well into a 96-well plate culture plate (SPL, 96-well Cell Culture Plate flat- And cultured for 24 hours. On the day of the analysis, the medium was removed with a micropipette (Gilson) and contacted at a ratio of 10: 1 to the number of effected cells: CTAC cells. The contact was performed by dispensing 100 μl of NK suspension containing 2 × 10 ⁵ cells of the effector cell into each well of a 96-well plate plate cultured with CTAC as a target cell, using a micropipette (Gilson) A centrifuge (Beckman Coulter, Inc., Allegra X-15R) is operated to contact the cancer cell line. Then, the cells were placed in a carbon dioxide-incubator (MCO-175, manufactured by Sanyo) and cultured at 37 ° C and 5% CO ₂ for 24 hours. After the culture, the culture supernatant was centrifuged at 2,000 rpm for 5 minutes with Allegra X-15R manufactured by Beckman Coulter, and the culture supernatant was carefully collected with a micropipette (Gilson) to measure the degree of interferon-gamma production using BD OptEIATM SetCanine Kit (BD Biosciences) And analyzed by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's manual. The interferon-gamma production capacity evaluation result graph is shown in FIG.

As can be seen in FIG. 15, the NK cells amplified in Experimental Example 5 showed a significantly higher interferon-gamma production ability in the CTAC cancer cell line than the monocyte, and compared with NK cells amplified with human IL-15 protein , It was confirmed that the NK cells amplified with the sterilized recombinant canine IL-15 protein prepared in Example 6 had improved interferon-gamma production ability.

As a result, it was found that the recombinant canine IL-15 protein of the present invention significantly enhances the interferon-gamma production ability of NK cells amplified from CTAC cancer cells.

Experimental Example  8. Amplified dogs NK In a cell NK Identification of expression of cell-related genes

In order to investigate the expression changes of NK-related genes in the NK cells derived from the dogs amplified in Experimental Example 5, the NK cells amplified in Experimental Example 5 were washed with saline and then subjected to real- Real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR) was performed. The results of the real-time PCR reaction were plotted on a graph of relative expression to beta-actin and shown in FIG.

As can be seen from FIG. 16, the NK cells amplified with sterilized recombinant canine IL-15 showed a higher correlation with the protein molecules essential for cancer cell toxicity (1.8-fold) and granules (1.2 times) gene expression was increased.

Thus, the recombinant canine IL-15 protein of the present invention promotes the expression of perforin and granzyme B gene, which plays an important role in cancer cell death in canine NK cells, compared with human NK cells amplified with human IL-15 It was found that there was an effect of improving cytotoxicity.

<110> KONGJU NATIONAL UNIVERSITY INDUSTRY-UNIVERSITY COOPERATION FOUNDATION <120> Specific primers for external amplification of dog          interleukin-15, uce thereof, and method of manufacturing          recombination dog interleukin-15 using the same <130> 1039840 <160> 23 <170> Kopatentin 2.0 <210> 1 <211> 1020 <212> RNA <213> canine interleukin <400> 1 agaaacgttc gtgttgaaaa gccgagcggc ttccgttcca ggagacgcac ccccagagcc 60 cgtgagagcc ccctcgcgtg ctgcgtggcc gccttggctg tgaccgtgac ccgaagccac 120 ccgaagcctg tcactgcagc cgcggcctgg acaaaggaag tattctggat ggatggctgc 180 tggaaaccca ttgccatagc cagctcttct tcaatactta aggatttacc ctgcattgag 240 taatgagaat ttcgaaacca catttgagaa gtacttccat ccagtgctac ttgtgtttac 300 ttctgaacag tcattttcta actgaggctg gcattcatgt cttcattttg ggctgtatca 360 gcgcaggtct tcccaaaaca gaggcaaatt ggcaggacgt gatacttgat ttggaaaaaa 420 ttgacaatct tattcaatct atacatatgg ataccactct gtatactgaa agtgatgtgc 480 atcccagttg caaagtaacc gcgatgaagt gctttctcct ggagttaggt gttatctcgc 540 tcgagtccgg cagtcatccc attaaggaag cagtagagaa cctcatcatc ctcgcaaaca 600 gtgatctgtc ttcgaagggg aatataactg aaacgggatg caaagaatgt gaagaactgg 660 aggaaaagag tattaaggag tttttgcaga gtttcgtgca tatcgtacaa atgttcatca 720 actcctcttg atggcaaagg atctgcttcg gcatttctgc gattaaccag cgtcttccca 780 cggctcgaag gccgtgaaac cctctgcagg tcgttcgggc cgcctgaacg aatttttcta 840 acgagaagat gatccggaat ctcgggtcgg atgaactctt agaaactgaa ggcagaaaaa 900 tggcatcgag ggacgtgtcc gtgaactgtc ctcgtgctga ttttgttcat ttattcttaa 960 tttattaccg acgttgtaca tatctgtagc atactataga gcattgaata aaatcgtgta 1020                                                                         1020 <210> 2 <211> 33 <212> RNA <213> canine interleukin <400> 2 aaagaattca tgagaatttc gaaaccacat ttg 33 <210> 3 <211> 33 <212> RNA <213> canine interleukin <400> 3 aaactgcagt caagaggagt tgatgaacat ttg 33 <210> 4 <211> 36 <212> RNA <213> canine interleukin <400> 4 gaagaattcc atatgaattg gcaggacgtg atactt 36 <210> 5 <211> 56 <212> RNA <213> canine interleukin <400> 5 tttttgtcga ctcaatgatg atgatgatgg tggccagagg agttgatgaa catttg 56 <210> 6 <211> 22 <212> RNA <213> canine <400> 6 accaactggg acgacatgga ga 22 <210> 7 <211> 21 <212> RNA <213> canine <400> 7 aggcatacag ggacaggaca g 21 <210> 8 <211> 23 <212> RNA <213> canine <400> 8 acagtgtgac tctgaaatgc cag 23 <210> 9 <211> 22 <212> RNA <213> canine <400> 9 gacttctagc tgcaccgggt ca 22 <210> 10 <211> 22 <212> RNA <213> canine <400> 10 gttattgtgg tccgtgtcct aa 22 <210> 11 <211> 22 <212> RNA <213> canine <400> 11 actgccagga tccatttgtt gg 22 <210> 12 <211> 21 <212> RNA <213> canine <400> 12 cttcttgccg tgttccttca a 21 <210> 13 <211> 21 <212> RNA <213> canine <400> 13 ccagaacctc cactctgcac a 21 <210> 14 <211> 22 <212> RNA <213> canine <400> 14 accaggttag tcagcagctc ca 22 <210> 15 <211> 23 <212> RNA <213> canine <400> 15 ctggagacac tgccagatag aat 23 <210> 16 <211> 24 <212> RNA <213> canine <400> 16 tatgatacgc ccactctctc cgtt 24 <210> 17 <211> 24 <212> RNA <213> canine <400> 17 atccaaaaca tctgtacgtc cctc 24 <210> 18 <211> 24 <212> RNA <213> canine <400> 18 gattcttggg atcctgtgtt tact 24 <210> 19 <211> 25 <212> RNA <213> canine <400> 19 gtaaatcctg ttcctttttc tgctg 25 <210> 20 <211> 23 <212> RNA <213> canine <400> 20 acaggtacag cttcagcact gac 23 <210> 21 <211> 22 <212> RNA <213> canine <400> 21 ccatggaccg gatgaagtgg gt 22 <210> 22 <211> 23 <212> RNA <213> canine <400> 22 ggagagatca tcgggggaca tga 23 <210> 23 <211> 22 <212> RNA <213> canine <400> 23 ctcctgttcc ttgatgttgt gg 22

Claims (12)

A primer set comprising the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 3; And
A primer set comprising the nucleotide sequence of SEQ ID NO: 4 and SEQ ID NO: 5;
Lt; RTI ID = 0.0 &gt; interleukin-15 &lt; / RTI &gt; delete delete (Interleukin-15) having an amino acid residue position 49 to an amino acid position 162 of an interleukin-15 derived from a dog and having an average molecular weight of 10 to 15 kDa. delete A composition for preventing or treating cancer or viral diseases in dogs comprising the recombinant canine interleukin-15 of claim 4. A recombinant anti-cancer agent comprising interleukin-15 of claim 4. A recombinant anti-interleukin-15 cell treatment agent according to claim 4. A step of separating RNA by superimposing blood collected from a dog on a concentration density gradient;
And a second step of preparing a DNA fragment by performing reverse transcription-polymerase chain reaction (RT-PCR) using the RNA isolated in step 1 and a primer set comprising the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 3 ;
A step of ligation of an E. coli-derived cloning vector to the DNA fragment, a step of adding a reactant obtained by a ligation reaction to E. coli and inducing transformation to produce a recombinant cloning vector;
4) performing a polymerase chain reaction using a primer set containing the nucleotide sequences of SEQ ID NOS: 4 and 5 using the recombinant cloning vector as a template; And
Ligation reaction and transformation of the amplification product and an expression vector derived from Escherichia coli to prepare a mature interleukin-15 expression vector;
Lt; RTI ID = 0.0 &gt; interleukin-15 &lt; / RTI &gt; expression vector. 10. The method according to claim 9, wherein the density gradient of the first step is a density gradient of Ficoll-Hypaque concentration and the specific gravity of Ficoll-Hypaque is 1.0 to 1.2 g / ml. Lt; RTI ID = 0.0 &gt; interleukin-15 &lt; / RTI &gt; expression vector. delete Adding the mature interleukin-15 expression vector of claim 9 or 10 to E. coli and transforming to obtain a transformed E. coli; And
Inducing recombinant interleukin-15 expression by mixing the transformed Escherichia coli with isopropyl-1-thio- beta -D-galactopyranoside (isopropyl-1-thio- beta -D-galactopyranoside);
Lt; RTI ID = 0.0 &gt; interleukin-15. &Lt; / RTI &gt;

Images