KR101435443B1 - Novel marker and primer to identify cultivar discrimination in Brassica napus L. and use thereof - Google Patents

Abstract

The present invention relates to a rapeseed-cultivar-specific marker, a primer and a use thereof, and more particularly to a marker for distinguishing rapeseed cultivars, a PCR primer set for discrimination, and uses thereof. Accordingly, the present invention is effective in discriminating rapeseed cultivars by providing a marker, a primer set, a discriminating method using the primer set, and a discriminating kit for discriminating rapeseed cultivars.

Description

≪ Desc / Clms Page number 2 > Novel marker and primer to identify cultivar discrimination in Brassica napus L. and use thereof.

The present invention relates to a rapeseed-cultivar-specific marker, a primer and a use thereof, and more particularly to a marker for distinguishing rapeseed cultivars, a PCR primer set for discrimination, and uses thereof.

A large amount of genetic resources are being collected every year from most major crops and materials used for breeding. On the other hand, the evaluation of genetic resources is not enough. Rapid identification of interspecies and subspecies of collected genetic resources is very important for the management and protection of accurate genetic resources. In addition to identification of varieties, identification and classification of genotypes of genotypes and identification of their relationship are very important for preservation of genetic resources, creation of new varieties and improvement of crops.

Recent advances in molecular biology have led to the development of markers for the detection of various DNA polymorphisms that enable the study of bio-diversity at the DNA level. Through this, it is possible to perform simple and rapid search of useful traits, identification of species of organisms, classification and identification of cultivars, and flexible relationship analysis of group populations with little effect on external environments. Markers for polymorphic detection developed so far include randomly amplified polymorphic DNA (RAPD) markers, amplified fragment length polymorphic DNA (AFLP) markers, microsatellite markers, and SSR (simple sequence repeat) markers.

Transposable elements (TEs) are DNA fragments that can move from one place to another in a genome. They are transferred from one chromosome to another by transposition, so they have genetic diversity. It is an important factor to cause. Transcription factors are also called transposons, which range in length from hundreds to thousands of nucleotides. Each transfection factor has a transposase gene capable of cleaving and ligating the DNA necessary for its movement, and each transfection factor has a DNA sequence that is recognized by the transgene. Some transcription factors have a gene (ampR, terR) encoding an enzyme that inactivates antibiotics such as ampicillin or tetracycline. In addition, certain transcription factors have a transcriptional promoter that, when the transcription factor is inserted near a particular gene in the chromosome, can alter the amount of expression of the gene located near the insertion site or allow expression of the gene under certain conditions .

Transition factors are classified into class 1 (class 1) and class 2 (class 2), where electron-related transfer factors are inserted into the host's chromosome through RNA intermediates (Kumar A., and JL Benntzen. . Rev. Genet., 33: 479-532, 1999), the latter transferring factors are inserted into the host chromosome through DNA mediators. Among the class 1 transcription factors are retrotransposons, short interspersed nuclear elements (SINEs) and long interspersed nuclear elements (LINEs), which are present in the genome with a very high copy number. Transition factors belonging to class 2 are divided into autonomous elements such as Ac and Spm and nonautonomous elements such as Ds and dSpm depending on their transposability. Voluntary factors can themselves transition because they encode all the elements needed for transposition. However, since involuntary factors are mostly deletion derivatives of spontaneous factors or because important regulatory sequences are genetically inactivated by methylation, the presence of spontaneous factors in the genome is essential for metastasis (Wessler, SR, et al., Science, 242: 399-405, 1988). Transition factors belonging to class 2 are characterized by having a short terminal inverted repeat (TIR) regardless of their ability to transfer, and because they are transferred through a DNA mediator by a conserved mechanism, (Usually < 100 copies per genome haplotype).

Brassica napus, also known as rapeseed, is an important oil crop in the world. B. napus (2n = 4x = 38, AACC) is an alloteotraploid derived from the crossing of B. rapa (2n = 2x = 20, AA) and B. oleracea (2n = 2x = 18, CC) .

The limit of fossil fuel production has attracted high scientific interest in rapeseed oil as diesel fuel. Due to its importance in agronomy and industry, the genome of rapeseed has been sequenced by the Multinational Brassica Genome Project (MBGP), and genomic information is available on the web (http://www.brassica.info/).

Since rapeseed is a cross-pollinating plant, pollen pollution has become a problem in developing new varieties and maintaining the genetic purity of already-developed varieties. Therefore, a genetic marker of a variety is desperately needed.

Accordingly, the present inventors developed the Ti-SCAR markers of Korean rapeseed varieties using the sequence of CACTA transposon in order to develop Ti-SCAR (Transposon insertion sequence characterized amplified region) using transposon display.

Accordingly, an object of the present invention is to provide a marking marker for Brassica napus L. cv. Tamra, which is composed of at least one polynucleotide selected from the group consisting of nucleotides of SEQ ID NO: 23 and complementary polynucleotides thereof .

Another object of the present invention is to provide a PCR primer set for discriminating rapeseed varieties (Brassica napus L. cv. Tamra) having the nucleotide sequence shown in SEQ ID NO: 15 and SEQ ID NO:

It is another object of the present invention to provide a method for detecting DNA comprising: (a) separating DNA from a sample; (b) performing PCR using the separated DNA as a template and using the primer set; And (c) confirming the amplified PCR product of step (b) by electrophoresis. The present invention also provides a method for distinguishing Brassica napus L. cv.

Another object of the present invention is to provide a kit for distinguishing Brassica napus L. cv. Tamra comprising the primer set.

In order to accomplish the object of the present invention, the present invention provides a rapeseed breed variety (Brassica napus L. cv) comprising at least one polynucleotide selected from the group consisting of a polynucleotide represented by SEQ ID NO: 23 and a polynucleotide having a sequence complementary thereto Tamra) identification markers.

In order to accomplish another object of the present invention, there is provided a PCR primer set for discriminating rapeseed variety (Brassica napus L. cv. Tamra) having the nucleotide sequence shown in SEQ ID NO: 15 and SEQ ID NO:

In order to accomplish another object of the present invention, the present invention provides a method for producing a DNA fragment comprising the steps of: (a) separating DNA from a sample; (b) carrying out PCR using the separated DNA as a template and using the primer set of claim 2; And (c) confirming the amplified PCR product of step (b) by electrophoresis. The present invention also provides a method for distinguishing Brassica napus L. cv.

In order to accomplish another object of the present invention, the present invention provides a kit for distinguishing a Brassica napus L. cv. Tamra comprising the primer set.

Hereinafter, the present invention will be described in detail.

The present invention provides a marking marker for Brassica napus L. cv. Tamra, consisting of at least one polynucleotide selected from the group consisting of nucleotides of SEQ ID NO: 23 and complementary polynucleotides thereof.

In order to produce the markers, the Transposon Display (TD) method was used in the present invention. The TD (Transposon Display) method is a modification of the existing AFLP (Amplified Fragment Length Polymorphism) method for analyzing insertion and removal polymorphism of a TE (Transposable element). A schematic diagram of this method is shown in Fig.

1, the production method of the present invention is described by separating gDNA from rapeseed, digesting with a restriction enzyme commonly used in AFLP, and then ligation of the adapter. Thereafter, a primary PCR reaction was performed with a primer (P1 primer of [Figure 1]) that specifically recognizes rapeseed CACTA transcription factor specifically, a primer containing part or all of the adapter (P2 primer of Figure 1) Go ahead. The first PCR product is subjected to secondary PCR using P1 primer and P3 primer. The P3 primer is characterized in that it is upstream in comparison with the P2 primer. The sequences other than the P3 sequence in the nucleotide sequence of the secondary PCR reaction product are the markers of the present invention.

In the present invention, B-CAC-TIR1 (SEQ ID NO: 15), P2 primer, KRMP-0 (SEQ ID NO: 3) and KRMP-TCA (SEQ ID NO: 4) are used as P1 primers for producing marker for discriminating rapeseed cultivars, )to be. Also, the marker for distinguishing rapeseed cultivars is a polynucleotide of SEQ ID NO: 23 or a polynucleotide sequence having a complementary sequence.

The marker for distinguishing the rapeseed cultivars is specifically detected only in rapeseed cultivars, and can not be detected in other rapeseed cultivars and other cultivars, and thus can be used as an effective marker for the rapeseed cultivar discrimination. This can be confirmed in [Fig. 2].

The present invention provides a PCR primer set for discriminating rapeseed varieties (Brassica napus L. cv. Tamra) having the nucleotide sequences of SEQ ID NO: 15 and SEQ ID NO: 17.

In the present invention, "primer" means a short nucleic acid sequence which can form a base pair with a complementary template and serves as a starting point for template strand copying.

The primer set of the present invention is designed so as to increase the specificity of the strain or strain from the base sequence of the marker after producing the marker for identification. Among the above primer sets, the primer represented by SEQ. ID. NO. 15 is the primer P1 of FIG. 1, and the primer represented by SEQ ID NO: 17 is the primer P4. As a result of carrying out PCR with the primer set of the present invention, it is confirmed in Fig. 4 that specific detection of the oilseed rape varieties is possible.

The primer set for discriminating rapeseed cultivars provided in the present invention can be used for detecting CACTA transgenes in oilseed rape varieties and for selection of fingerprinting and breeding programs for rapeseed varieties. Also, since the oilseed rape varieties can be identified using the set of primers set forth in the present invention, the genetic resources of the oilseed rape varieties can be efficiently evaluated and preserved.

(A) separating DNA from a sample; (b) performing PCR using the separated DNA as a template and using the primer set; And (c) confirming the amplified PCR product of step (b) by electrophoresis. The present invention also provides a method for distinguishing Brassica napus L. cv.

The step of separating DNA from the sample in the step (a) may be performed using phenol / chloroform extraction method or SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990) (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980) or commercially available DNA extraction kits.

Also, in the step (b), the PCR may be performed using a PCR reaction mixture containing various components known in the art necessary for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer solution and water (dH 2 O) in addition to the genomic DNA extracted from the rapeseed cultivar to be analyzed and the rapeseed cultivar discriminant primer set provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl2, KCl, and the like. At this time, MgCl ₂ concentration greatly affects amplification specificity and yield. Preferably in the range of 1.5-2.5 mM. Generally, if an excess of the Mg ^{2 +} increase the non-specific PCR amplification products, and reduce the yield of a PCR product if the Mg ^{2 +} insufficient. The PCR buffer solution may further contain an appropriate amount of Triton X-100. Also, PCR was performed by denaturing the template DNA at 94-95 ° C, followed by denaturation; Annealing; Followed by a cycle of amplification and extension followed by final elongation at 72 ° C. In the above, denaturation and amplification can be performed at 94-95 ° C and 72 ° C, respectively, and the temperature at the time of binding can be varied depending on the type of the primer. Preferably 52-57 占 폚, and more preferably 55 占 폚. The time and number of cycles in each step can be determined according to the conditions commonly practiced in the art. The optimal reaction conditions for PCR using the set of primers according to the present invention were as follows: the template DNA was denatured at 94 ° C for 10 minutes, and then 94 ° C for 1 minute; 1 min at 55 [deg.] C; And 72 ° C for 1 minute, followed by final reaction at 72 ° C for 10 minutes.

PCR amplification results were analyzed by agarose gel, polyacrylamide gel electrophoresis or ABI prism 3100 genetic analyzer-electropherogram to determine whether amplified specific band of rapeseed cultivars (Step (c)). At this time, in order to use the fluorescence analyzer, PCR is performed in the step (b) using a primer set with a fluorescent dye known in the art. The result of PCR is preferably confirmed by agarose gel. After electrophoresis, electrophoresis results can be analyzed by silver staining. Preferably, the electrophoresis results can be analyzed with a UV transilluminator. Methods for performing general PCR and analyzing the results are well known in the art.

In addition, the present invention provides a rapeseed breed bottle caps kit comprising a rapeseed tamarace identification primer set, a DNA polymerase, and a PCR reaction buffer solution according to the present invention. The composition of the PCR reaction buffer solution is as described above.

The present invention also provides a kit for the identification of Brassica napus L. cv. Tamra comprising the primer set of the present invention.

In the kit of the present invention, various reagents necessary for the detection (for example, PCR) and the results necessary for detecting the oilseed rape variety using the primer set of the present invention, for example, PCR composition, restriction enzyme, agarose, A buffer solution necessary for electrophoresis, and the like may be further included.

In addition, the kit may further include a DNA polymerase and a PCR reaction buffer solution having the above composition in order to facilitate the PCR reaction, and a kit for performing electrophoresis, May be further included in the kit of the present invention.

The present invention is effective in discriminating rapeseed cultivars by providing a marker, a primer set, a discriminating method using the primer set, and a discriminating kit for discriminating rapeseed cultivars.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram of a method for producing a marker and a primer set of the present invention. FIG.
FIG. 2 shows electrophoretic results obtained by selecting the markers for distinguishing rapeseed cultivars according to the present invention.
FIG. 3 is a DNA sequence of an electrophoretic band including the marker of the present invention indicated by a red arrow in FIG.
Fig. 4 shows the result of electrophoresis with the primer set of the present invention.

Hereinafter, the present invention will be described in detail with reference to examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

DNA extraction by rapeseed variety

Rural Development Administration Six representative rapeseed varieties developed by the National Institute of Biotechnology Bioenergy Crop Center (Muan) and four kinds of stationary lines cultivated were used. The six types of rapeseed cultivars used in this study are Nammi, Tamna, Halla, Inhan, Jeonnam, and Youngsan. The four fixed lines are Mokpo 68, Mokpo 111, Mokpo 113, and Mokpo 114. Genomic DNA was extracted from young seedlings using DNeasy Plant Mini Kit (Qiagen, USA).

≪ Example 2 >

CACTA transposon Primer design for excavation and transposon display

There are three classes of CACTA transposons (Bot-1, Bot-2, Bot-3) in Brassica species (Aix et al., Plant J 56: 1030-1044, 2008). The 500 bp nucleotide sequence located at the 3'end of each factor (Bot-1, Bot-2, and Bot-3) was used as a querier for the blsatn program provided by NCBI and the cutoff value was set to E x 10-4. We have identified Brassica CACTA elements present in the Brassica database. The final selection of CACTA elements was limited to the complete terminal inverted repeat, and the same sequence was excluded from the analysis. Bot sequence was finally narrowed down to 58 elements, and 500bp sequence was extracted from 3'end of each factor to reveal the conserved region.

A 22 bp degenerated primer sequence was designed from the conseved region of the transcription factor containing the CACTA motif and located at the 3 'end. The sequence of the primer (B-CAC-TIR1) is ATMCCGMTGTTTTCTTGTAGTG and M is A or C (see Table 1).

The designed primers are shown in Table 1 below.

The primer sequence used Primer name Sequences SEQ ID NO: Mse I-adapter MA-1 5- GACGATGAGTCCTGAG - 3 One MA-2 5- TACTCAGGACTCAT-3 2 Anchored Mse I-adapter primers KRMP-0 5- GACGATGAGTCCTGAGTAA - 3 3 KRMP-TCA 5- GACGATGAGTCCTGAGTAATCA - 3 4 KRMP-TCT 5- GACGATGAGTCCTGAGTAATCT - 3 5 KRMP-TCG 5- GACGATGAGTCCTGAGTAATCG - 3 6 KRMP-TCC 5-GACGATGAGTCCTGAGTAATCC-3 7 KRMP-CGA 5- GACGATGAGTCCTGAGTAACGA - 3 8 KRMP-CGT 5- GACGATGAGTCCTGAGTAACGT - 3 9 KRMP-CGG 5- GACGATGAGTCCTGAGTAACGG - 3 10 KRMP-CGC 5- GACGATGAGTCCTGAGTAACGC - 3 11 KRMP-GTG 5- GACGATGAGTCCTGAGTAAGTG - 3 12 KRMP-GTC 5- GACGATGAGTCCTGAGTAAGTC - 3 13 KRMP-CAT 5- GACGATGAGTCCTGAGTAACAT - 3 14 CACTA transposon specific primer B-CAC-TIR1 5 - ATMCCGMTGTTTTCTTGTAGTG - 3
(M = A or C) 15

< Example  3>

Transposon display

Genomic DNA (100 ng) was digested with 2.5 units of MseI (Invitrogen, USA) and ligated with 15 picomol adapter cassette using T4 DNA ligase (Invitrogen, USA). The ligated template DNA was diluted 4-fold and then diluted 4 times with CACTA transfer gene specific primer (SEQ ID NO: 15, see Table 1) and adapter specific primer KRMP-0 (SEQ ID NO: 3, see Table 1) .). The PCR amplification was carried out at 94 ° C for 10 minutes, followed by amplification for 1 minute at 94 ° C, 1 minute at 55 ° C, and 1 minute at 72 ° C for 20 cycles and 72 ° C for 10 minutes.

The PCR products were diluted 100-fold and 3 ul were selectively amplified with IRD-700 labeled CACTA transposon specific primer (B-CAC-TIR1, SEQ ID NO: 15) and 11 adapter primers (SEQ ID NOS: 4-14). The PCR conditions are the same as above. The heavy products were electrophoresed at 1800 volts for 2 hours with Li-Cor (LiCor, USA) automation equipment and 6% denaturing PAGE gel. Separated DNA was identified by silver staining with a silver staining kit (Promega, USA) for a computer imaging instrument for Li-Cor and PAGE gels.

Among the primers shown in Table 1, there were found sets which can be used for discrimination of some varieties or strains. Among them, primers B-CAC-TIR1 (SEQ ID NO: 15) and KRMP-TCA (SEQ ID NO: It was confirmed that the primer set can be used for the selection of the breeding variety. The results are shown in Fig. 2, and it can be confirmed that when the PCR reaction is carried out with the primers B-CAC-TIR1 and KRMP-TCA, there is a specific band only in the rapeseed varieties (FIG. 2) ).

< Example  4>

Sequencing, SCAR primer  design, PCR  Amplification and come  Electrophoresis

In the electrophoresis results of Example 3, the band portion (polymorphic DNA fragment) showing specificity for each strain or strain was separated from the gel and sequenced by ABI3730xl (Life Technology, USA). Based on the sequence results, Primer3 The SCAR primer was designed as a program (see Table 2).

As a result of sequencing analysis, the sequence analysis results of the PCR product using the primer B-CAC-TIR1 (SEQ ID NO: 15) and the primer KRMP-TCA (SEQ ID NO: 4) specific for rapeseed cultivar in Example 3, Respectively. The nucleotide sequence from the primer B-CAC-TIR1 (SEQ ID NO: 15) to the SCAR primer in the nucleotide sequence of FIG. 3, namely, the gene marker (SEQ ID NO: 23) is Ti-SCAR2 in the following Table 2, The SCAR primer derived from -SCAR2 has the nucleotide sequence of SEQ ID NO:

50 ng of template genomic DNA of the cultivars and strains used in the experiments were incubated with the 10 picomol primer KRMP-0 (SEQ ID NO: 3) and the SCAR primer of Table 2 at 94 ° C for 20 seconds, 58 ° C to 60 ° C for 20 seconds, 72 ° C And amplified at a PCR condition of 40 seconds. The amplified product was separated on 1% agarose gel for 1 hour and observed with a UV transilluminator.

Variant-specific SCAR primers Marker name polymorphism
Kinds Primer name, sequence number and
sequences (5 to 3 directions) Annealing
Temperature Amplification product
size Target variety Ti-SCAR1 Presence / absence GTG2-1: SEQ ID NO: 16:
ACAATAGCCTCTAACATCCTGAGC 60 237 bp Cold weather Ti-SCAR2 Presence / absence TCA4-2: SEQ ID NO: 17:
CAAGAATGAGACAACATGTCAGG 56 183 bp Tamna Ti-SCAR3 Presence / absence GTC4-1: SEQ ID NO: 18:
GAAATCTAACCACTCTTTAGCACCA 60 233 bp Tamna Ti-SCAR4 Presence / absence CGG6-1: SEQ ID NO: 19:
ATTGGCCCATCTTATTGTCTCTT 60 175 bp Halla Ti-SCAR5 Presence / absence CGT7-1: SEQ ID NO: 20:
CTGCACCTAAGTTTCTTGATCGTA 60 330 bp Mokpo 68 Ti-SCAR6 Presence / absence CGT7-2: SEQ ID NO: 21:
GAACTCTAGCTTCTTCGGCTCTT 60 240 bp Mokpo 68 Ti-SCAR7 Presence / absence CAT7-1: SEQ ID NO: 22:
GAGATGCGTGTGAACTCTAGCTT 60 251 bp Mokpo 68

As a result of the observation, it was confirmed that a marker capable of specifically discriminating rapeseed cultivars was obtained by the method of the present invention, and a primer capable of specifically amplifying the marker could be produced. As a result of amplification with primer B-CAC-TIR1 (SEQ ID NO: 15) and primer TCA4-2 (SEQ ID NO: 17) in FIG. 4, it can be confirmed that it is specific to rapeseed cultivars.

As described above, the present invention relates to a rapeseed-cultivar-specific marker, a primer and a use thereof, and more particularly to a marker for distinguishing rapeseed cultivars, a PCR primer set for discrimination, and uses thereof. The present invention can be used for effectively discriminating oilseed rape varieties by providing a marker, a primer set, a discriminating method using the primer set, and a discriminating kit for discriminating oilseed rape varieties.

<110> KNU-Industry Cooperation Foundation <120> Novel marker and primer to identify cultivar discrimination in          Brassica napus L. and use thereof <130> NP12-0092 <160> 23 <170> Kopatentin 2.0 <210> 1 <211> 16 <212> DNA <213> MA-1 <400> 1 gacgatgagt cctgag 16 <210> 2 <211> 14 <212> DNA <213> MA-2 <400> 2 tactcaggac tcat 14 <210> 3 <211> 19 <212> DNA <213> KRMP-0 <400> 3 gacgatgagt cctgagtaa 19 <210> 4 <211> 22 <212> DNA <213> KRMP-TCA <400> 4 gacgatgagt cctgagtaat ca 22 <210> 5 <211> 22 <212> DNA <213> KRMP-TCT <400> 5 gacgatgagt cctgagtaat ct 22 <210> 6 <211> 22 <212> DNA <213> KRMP-TCG <400> 6 gacgatgagt cctgagtaat cg 22 <210> 7 <211> 22 <212> DNA <213> KRMP-TCC <400> 7 gacgatgagt cctgagtaat cc 22 <210> 8 <211> 22 <212> DNA <213> KRMP-CGA <400> 8 gacgatgagt cctgagtaac ga 22 <210> 9 <211> 22 <212> DNA <213> KRMP-CGT <400> 9 gacgatgagt cctgagtaac gt 22 <210> 10 <211> 22 <212> DNA <213> KRMP-CGG <400> 10 gacgatgagt cctgagtaac gg 22 <210> 11 <211> 22 <212> DNA <213> KRMP-CGC <400> 11 gacgatgagt cctgagtaac gc 22 <210> 12 <211> 22 <212> DNA <213> KRMP-GTG <400> 12 gacgatgagt cctgagtaag tg 22 <210> 13 <211> 22 <212> DNA <213> KRMP-GTC <400> 13 gacgatgagt cctgagtaag tc 22 <210> 14 <211> 22 <212> DNA <213> KRMP-CAT <400> 14 gacgatgagt cctgagtaac at 22 <210> 15 <211> 22 <212> DNA <213> B-CAC-TIR1 <400> 15 atmccgmtgt tttcttgtag tg 22 <210> 16 <211> 24 <212> DNA <213> GTG2-1 <400> 16 acaatagcct ctaacatcct gagc 24 <210> 17 <211> 23 <212> DNA <213> TCA4-2 <400> 17 caagaatgag acaacatgtc agg 23 <210> 18 <211> 25 <212> DNA <213> GTC4-1 <400> 18 gaaatctaac cactctttag cacca 25 <210> 19 <211> 23 <212> DNA <213> CGG6-1 <400> 19 attggcccat cttattgtct ctt 23 <210> 20 <211> 24 <212> DNA <213> CGT7-1 <400> 20 ctgcacctaa gtttcttgat cgta 24 <210> 21 <211> 23 <212> DNA <213> CGT7-2 <400> 21 gaactctagc ttcttcggct ctt 23 <210> 22 <211> 23 <212> DNA <213> CAT7-1 <400> 22 gagatgcgtg tgaactctag ctt 23 <210> 23 <211> 183 <212> DNA <213> Ti-SCAR2 <400> 23 atcccgatgt tttcttgtag tggcagctgg ggagttctgt cctctaattc aggttgttct 60 gctcataaca acatttgcgc ttacactcaa tatggggatg gaagtggaac ctcagggttc 120 ttcgtctttg atgtcttgca gttcgaacga tgactcttgg cctgacatgt tgtctcattc 180 ttg 183

Claims (4)

(Brassica napus L. cv. Tamra) discrimination marker consisting of at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NO: 23 and complementary polynucleotides thereof.
A set of PCR primers for discriminating rapeseed varieties (Brassica napus L. cv. Tamra) consisting of the nucleotide sequences shown in SEQ ID NO: 15 and SEQ ID NO: 17.
(a) separating DNA from a sample;
(b) carrying out PCR using the separated DNA as a template and using the primer set of claim 2; And
(c) identifying the amplified PCR product of step (b) by electrophoresis. 2. The method according to claim 1, wherein the amplified PCR product is selected from the group consisting of Brassica napus L. cv.
(Brassica napus L. cv. Tamra) discrimination kit comprising the primer set of claim 2.

Images