KR101433910B1 - Oligonucleotide with skin lightening effect and skin lightening agent containing the same - Google Patents

Abstract

The present invention relates to an oligonucleotide having a whitening effect and a whitening agent containing the same as an effective ingredient. In particular, the present invention relates to an antisense oligonucleotide for mRNA of kinesin gene, which exhibits a whitening effect by inhibiting the movement of melanocytes from melanocytes to keratinocytes, Provides a whitening agent. The whitening agent according to the present invention can be applied as an anti-stain or freckle improving agent and as a skin whitening agent.

Kinesin, oligonucleotides, whitening agents

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an oligonucleotide having a whitening effect and a whitening agent containing the oligonucleotide,

The present invention relates to an oligonucleotide having a whitening effect and a whitening agent containing the same as an effective ingredient. In particular, the present invention relates to an antisense oligonucleotide for mRNA of kinesin gene, which exhibits a whitening effect by inhibiting the movement of melanosome from melanocyte to keratinocyte, Provides a whitening agent.

The skin color of a person is genetically determined by the concentration and distribution of melanin in the skin but is also influenced by environmental or physiological conditions such as sunlight, fatigue and stress. Melanin is produced in a kind of intracellular organelles called melanosomes in melanocytes through enzymatic or nonenzymatic oxidation from tyrosine. These melanomas containing melanin are located near the nucleus (perikaryon) where the melanosomes are generated by kinesin and dynein, the microtubule-associated motor proteins associated with microtubes, To the dendrites of the melanocytes is regulated. Melanomas result in melanosome transfer from the dendritic site of melanocytes to keratinocytes and keratinocytes containing melanosomes migrate to the skin surface through a keratinocyte differentiation (Lambert J et al., Traffic , vol.7, pp769-778, 2006). At this time, kinesin is responsible for the centripetal movement of melanomas from the nucleus of the melanocytes to the dendrites, while the dyneins are responsible for the centrifugal movement of melanomas from the dendrites to the nucleus (Okada Y et al., Cell , vol. 81, pp. 769-780, 1995).

The kinesin is composed of two heavy chains and two light chains. The N-terminal of the heavy chain is the motor site with ATPase activity, and the C-terminal of the heavy chain is the site binding to the melanosome. Kinesin binds to various types of intracellular organelles and is responsible for the centripetal migration of intracellular organelles along microtubules. In the case of the melanophore of frogs, it is known that the treatment of antibodies to kinesin inhibits the proliferation of melanophores (Lane JD et al., Mol Biol Cell , vol. 10, pp. 1909-1922, 1999).

Many of the whitening agents known so far focus on the mechanism of the melanin pigment production process, such as tyrosinase inhibitors and antioxidants. Examples include hydroquinone, ascorbic acid, kojic acid, and glutathione, which are irritating to the skin and have poor product stability, which limits their use and has a weak effect have.

Disclosure of the Invention The present invention has been conceived to solve the problems of the prior art, and it is an object of the present invention to provide a technique capable of suppressing the movement of melanoma containing melanoma to the skin surface, improving skin tone, and obtaining a whitening effect The purpose.

It is another object of the present invention to provide a whitening agent which is not irritating to the skin and has excellent product stability.

To this end, the present invention relates to an oligonucleotide having a whitening effect and a whitening agent containing the same as an active ingredient. In particular, the present invention relates to an antisense oligonucleotide for mRNA of kinesin gene, which exhibits a whitening effect by inhibiting the movement of melanocytes from melanocytes to keratinocytes, Provides a whitening agent. The whitening agent according to the present invention can be applied as an anti-stain or freckle improving agent and as a skin whitening agent.

In an embodiment of the present invention, the oligonucleotide may be at least one selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 8 below.

SEQ ID NO: 1: taattcccatgccttctgga

SEQ ID NO: 2: ttcccagaggatgtttgtcc

SEQ ID NO: 3: ttcccagaggatgtttgtcc

SEQ ID NO: 4: aattcccatgccttctggat

SEQ ID NO: 5: tccactcagcttttgtttccg

SEQ ID NO: 6: agcttcatccagcacagcac

SEQ ID NO: 7: gctctgtgcacccctttaca

SEQ ID NO: 8: tgagttggagaagctgctgg

Hereinafter, the present invention will be described in detail.

The present invention relates to oligonucleotides which inhibit the centrihe migration of melanosomes and their use as whitening agents by inhibiting the expression of kinesin, a motor protein in melanocytes, among the factors involved in pigment deposition.

The antisense oligonucleotide is an oligonucleotide having a nucleotide sequence complementary to the mRNA of the kinesin gene. The oligonucleotide length is not particularly limited, and is preferably 15 bp or more in order to effectively inhibit translation from mRNA. But it is not limited to 25 bp or less. For example, the antisense oligonucleotide for the mRNA of the kinesin gene is an oligonucleotide of 15 bp or more, preferably 15 bp to 25 bp complementary to the mRNA derived from the sequence described in the heavy chain gene of human kinesin (GeneBank Accession No. X65873) Lt; / RTI > More preferably, it is an oligonucleotide of 15 bp to 25 bp complementary to mRNA originating from a site from the 400th base to the 600th base of the heavy chain gene of the kinesin, and most preferably the oligonucleotide of SEQ ID NOS: 1 to 8 ≪ / RTI >

The antisense oligonucleotides of the present invention of the kinesin heavy chain gene may be chemically synthesized and synthesized in the form of phosphorothioate to further enhance in vivo stability.

The whitening agent of the present invention contains, as an active ingredient, an antisense oligonucleotide for the mRNA of the kinesin gene. The kinesin gene may be derived from a mammal, including a human, and preferably a known gene derived from a human, and may be a gene corresponding to a heavy chain.

The whitening agent according to the present invention can be formulated as a whitening agent, or as a whitening functional cosmetic composition.

The whitening agent may contain only one or more antisense oligonucleotides on the above-mentioned one, but may further include pharmacologically acceptable excipients and / or additives depending on the formulations and methods of use. The content of the antisense oligonucleotide as an active ingredient in the whitening agent or whitening functional cosmetic composition may be suitably adjusted according to the desired effect and the final formulation, and may be, for example, 0.00001 to 99.9% by weight, But it is not limited thereto. However, if the content of the active ingredient is less than 0.00001% by weight, the whitening effect may be insufficient. If the content is more than 10.0% by weight, the effect may be insufficient. More preferably, the content of the active ingredient may be 0.001 to 1.0% by weight. Examples of the above-mentioned excipients include, but are not limited to, glycerin, starch, lactose, water, alcohol, propylene glycol, salicylic acid, polyhydric acetic acid, and physiological saline.

The whitening agent may be used either orally or parenterally, and it is particularly preferable to use it for transdermal administration. Formulations of whitening agents may be suitably adjusted according to the method of use, for example, PLASTERS, GRANULES, LOTIONS, POWDERS, SYRUPS, LIQUIDS AND SOLUTIONS AEROSOLS, OINTMENTS, FLUIDEXTRACTS, EMULSIONS, SUSPESIONS, INFUSIONS, TABLETS, INJECTIONS, CAPSULES, And pillars (PILLS), but the present invention is not limited thereto.

The dose of the whitening agent is preferably determined in consideration of the purpose of use, site, method, age, sex, condition of the patient, absorption of the active ingredient in the body, inactivity and the drug used in combination. (Body weight) to 500 mg / kg (body weight) as a standard.

The above-mentioned cosmetic composition may contain, in addition to the above-mentioned effective ingredients, all kinds of ingredients usable in ordinary cosmetics such as excipients, diluents and the like.

The cosmetic composition of the present invention can be provided for use in basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, or shaving cosmetics. Examples of the basic cosmetics include a cream, a lotion, a pack, a massage cream, an emulsion, and an essence. Examples of the makeup cosmetics include a foundation, a makeup base, a lipstick, an eyeliner, an eyeliner, a mascara, Examples of the body cosmetics include soap, liquid cleansing agent, bathing agent, sunscreen cream, and sun oil. Examples of hair cosmetics include shampoo, conditioner, hair treatment, hair mousse, hair liquid, pomade, hair coloring agent, Toothpastes, and color rinses. Hair cosmetics include hair tonics and scarf treatments. Shaving cosmetics include aftershave and shaving creams.

As described above, the antisense oligonucleotide for the kinesin mRNA of the present invention inhibits the migration of melanosomes, thereby providing a remarkable whitening effect.

Hereinafter, examples of the present invention will be described. The following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Example  1-8: inhibiting melanin synthesis Oligonucleotide  synthesis

A total of eight oligonucleotides of SEQ ID NOS: 1 to 8 were synthesized by commissioning Bioneer Co., Ltd. and synthesized with phosphorothioate DNA to enhance stability in vivo. The oligonucleotides prepared were Examples 1 to 8, respectively.

SEQ ID NO: 1: taattcccatgccttctgga

SEQ ID NO: 2: ttcccagaggatgtttgtcc

SEQ ID NO: 3: ttcccagaggatgtttgtcc

SEQ ID NO: 4: aattcccatgccttctggat

SEQ ID NO: 5: tccactcagcttttgtttccg

SEQ ID NO: 6: agcttcatccagcacagcac

SEQ ID NO: 7: gctctgtgcacccctttaca

SEQ ID NO: 8: tgagttggagaagctgctgg

Experimental Example  One: Melano  Verification of migration inhibition effect

Each of the oligonucleotides of Examples 1 to 8 was added to the culture medium of co-culture of human normal kelatinocyte and keratinocyte to investigate the inhibitory effect of melanosomes on the movement of melanocytes to keratinocytes Respectively.

Human normal keratinocytes (Clonetics, Cat. No. CC-2503) were inoculated in a 6-well culture vessel twice at 2.5 × 10 ⁵ cells / well and cultured for 3 days to a density of about 30% , Human normal melanocytes (Clonetics, Cat. No. CC-2504) were added at a concentration of 5 x 10 ⁴ cells / well and co-cultured. The medium was supplemented with 0.1% L-glutamine (Invitrogen, Cat. No. 25030-081), 8% Chelex treated, heat inactivated-FBS (Invitrogen, Cat. No. 11380-037) , 0.2% Penicillin / Streptomycin (Invitrogen, Cat. No. 15070-02), 0.05 mM CaCl ₂ (Sigma, Cat. No. C7902) was used.

24 hours after the addition of melanocytes, the oligonucleotides of SEQ ID NOS: 1 to 8 obtained in Examples 1 to 8 were added to a final concentration of 100 uM, respectively, and cultured for a total of 96 hours. After the oligonucleotides of SEQ ID NOS: 1 to 8 were treated, the culture medium was discarded and the melanocytes were removed by treatment with 0.25% Trypsin / EDTA (Invitrogen, Cat. No. 25200-106) for 2 minutes. Was treated for 10 minutes or more to separate only keratinocytes. The keratinocytes were collected using a centrifuge and then dissolved in 5N NaOH. The amount of melanin in keratinocytes was measured at 562 nm using an ELISA reader. Co-cultures of melanocytes and keratinocytes without addition of oligonucleotides having the sequences of SEQ ID NOS: 1 to 8 were used as controls.

The measured value is the absorbance and the inhibition rate is calculated by the following formula 1, and the results are shown in Table 1 below.

[Equation 1]

Inhibition rate = (control - experimental group) / control X 100

(Table 1)

Example OD ₅₆₂ Melanin transfer inhibition (%) Control group 0.3823 ± 0.0033 - Example 1 0.2341 ± 0.0044 38.8 Example 2 0.3050 0.0032 20.2 Example 3 0.2843 ± 0.0025 25.6 Example 4 0.2342 + 0.0039 38.7 Example 5 0.2230 ± 0.0043 41.7 Example 6 0.2893 ± 0.0066 24.3 Example 7 0.2734 ± 0.0053 28.5 Example 8 0.3396 + 0.0083 11.2

As shown in Table 1, the oligonucleotides of Examples 1 to 8 inhibited melanosomal transfer from melanocytes to keratinocytes by 11.2 to 41.7% at a treatment concentration of 100 uM.

Example  9: Manufacture of external ointment for skin

The external ointment for skin was prepared with the composition shown in Table 2 (unit: wt%).

(Table 2)

Composition weight % Example 1
Diethyl sebacate
Nonsense
Polyoxyethylene oleyl ether phosphate
Sodium benzoate
vaseline 0.05
8
5
6
Suitable amount
to 100

Example  10: Cosmetics (Cream) manufacture

Creams were prepared according to the composition (unit: wt%) shown in Table 3 below.

(Table 3)

Composition weight % Example 2
Stearic acid
Cetanol
Phage-20 Sototalmonostearate
Sobutan monostearate
Mineral oil
Trioctanoate
Triethanolamine
Carbomer
glycerin
Propylene glycol
antiseptic
incense
Purified water 0.1
1.0
2.0
1.0
1.0
10.0
5.0
0.5
0.2
5.0
3.0
Suitable amount
Suitable amount
to 100

Example 11 : Cosmetics (Softening longevity) manufacturing

The softening longevity was calculated by the composition (unit: wt%) shown in Table 4 below.

(Table 4)

Composition weight% Example 3
ethanol
Polyoxyethylene hardened castor oil
Paraoxybenzoic acid methyl
glycerin
1,3-butylene glycol
incense
Pigment
Purified water 0.02
10.0
1.0
2
5.0
6.0
Suitable amount
Suitable amount
to 100

Example  12: Cosmetics (Essence) Manufacturing

The essence was prepared by the composition (unit: wt%) shown in Table 5 below.

(Table 5)

Composition weight% Example 4
Propylene glycol
glycerin
Sodium hyaluronate aqueous solution (1%)
ethanol
Polyoxyethylene hardened castor oil
Paraoxybenzoic acid methyl
Carbomer
Triethanolamine
incense
Purified water 0.2
10.0
10.0
5.0
5.0
1.0
0.1
0.3
0.4
Suitable amount
to 100

Example  13: Cosmetics (Pack) manufacturing

A pack was prepared with the composition (unit: wt%) shown in Table 6 below.

(Table 6)

Composition weight% Example 5
glycerin
Propylene glycol
Polyvinyl alcohol
ethanol
Polyoxyethylene hardened castor oil
Polyoxyethylene oleyl ether
Paraoxybenzoic acid methyl
incense
Pigment
Purified water 0.01
5.0
4.0
15.0
8.0
1.0
1.0
0.2
Suitable amount
Suitable amount
to 100

Example  14: Cosmetics (Nutrition lotion) manufacture

Nutrition lotion was prepared with the composition (unit: wt%) shown in Table 7 below.

(Table 7)

Composition weight% Example 6
Polyoxyethylene hardened castor oil
Paraoxybenzoic acid methyl
glycerin
1,3-butylene glycol
Carbomer
Triethanolamine
Propylene glycol
ethanol
Carboxyvinyl polymer
Pigment
incense
Purified water 0.03
1.0
Suitable amount
6.0
5.0
0.2
0.3
5.0
3.2
0.1
Suitable amount
Suitable amount
to 100

Comparative Example  1 to 6

Cream, softening water, essence, pack, and nutrition lotion were prepared in the same manner as in Examples 9 to 14 except that the oligonucleotides prepared in Examples 1 to 8 were not used, To 6. The detailed compositions (unit: wt%) thereof are shown in Tables 8 to 13 below.

(Table 8)

Comparative Example 1, external ointment for skin weight% Example 1
Diethyl sebacate
Nonsense
Polyoxyethylene oleyl ether phosphate
Sodium benzoate
vaseline -
8
5
6
Suitable amount
to 100

(Table 9)

Comparative Example 2, cream weight% Example 2
Stearic acid
Cetanol
Phage-20 Sototalmonostearate
Sobutan monostearate
Mineral oil
Trioctanoate
Triethanolamine
Carbomer
glycerin
Propylene glycol
antiseptic
incense
Purified water -
1.0
2.0
1.0
1.0
10.0
5.0
0.5
0.2
5.0
3.0
Suitable amount
Suitable amount
to 100

(Table 10)

Comparative Example 3, softening longevity weight% Example 3
ethanol
Polyoxyethylene hardened castor oil
Paraoxybenzoic acid methyl
glycerin
1,3-butylene glycol
incense
Pigment
Purified water -
10.0
1.0
2
5.0
6.0
Suitable amount
Suitable amount
to 100

(Table 11)

Comparative Example 4, essence weight% Example 4
Propylene glycol
glycerin
Sodium hyaluronate aqueous solution (1%)
ethanol
Polyoxyethylene hardened castor oil
Paraoxybenzoic acid methyl
Carbomer
Triethanolamine
incense
Purified water -
10.0
10.0
15.0
5.0
1.0
0.1
0.3
0.4
Suitable amount
to 100

(Table 12)

Comparative Example 5, Pack weight% Example 5
glycerin
Propylene glycol
Polyvinyl alcohol
ethanol
Polyoxyethylene hardened castor oil
Polyoxyethylene oleyl ether
Paraoxybenzoic acid methyl
incense
Pigment
Purified water -
5.0
4.0
15.0
8.0
1.0
1.0
0.2
Suitable amount
Suitable amount
to 100

(Table 13)

Comparative Example 6, Nutritional Lotion weight% Example 6
Polyoxyethylene hardened castor oil
Paraoxybenzoic acid methyl
glycerin
1,3-butylene glycol
Carbomer
Triethanolamine
Propylene glycol
ethanol
Carboxyvinyl polymer
Pigment
incense
Purified water -
1.0
Suitable amount
6.0
5.0
0.2
0.3
5.0
3.2
0.1
Suitable amount
Suitable amount
to 100

Experimental Example  3: Whitening effect verification

Forty healthy men were selected as subjects and divided into two groups. The upper part of the upper arm was covered with an aluminum foil having two rows of holes each having a size of 1.5 cm x 1.5 cm, and the position of each hole was indicated. Experiments of the first group were applied to Examples 9 to 11 on one row and Comparative Examples 1 to 3 on the other row for two weeks, twice a day. In addition, the second group was applied in Examples 12 to 14, and the other lines were coated in the same manner in Comparative Examples 4 to 6. After 2 weeks, the cells were washed well with 70% ethanol and irradiated with 120 mJ / ㎠ at 50 cm distance using a daylight irradiation system (ORIEL Solar Simulator 1000 W). After irradiation with ultraviolet light, the same sample was continuously applied to the same position twice a day for 4 weeks. After 4 weeks, the extent of pigmentation was compared visually with comparative examples. The criteria were evaluated in three stages: remarkable inhibitory effect, slight inhibitory effect, and no inhibitory effect. The results are shown in Table 14 below.

(Table 14)

sample Significant inhibitory effect (persons) Has a slight inhibitory effect (persons) No inhibitory effect (persons) Example 9 6 10 4 Comparative Example 1 0 4 16 Example 10 4 12 4 Comparative Example 2 One 5 14 Example 11 7 8 5 Comparative Example 3 One 3 16 Example 12 8 7 5 Comparative Example 4 0 5 15 Example 13 8 6 4 Comparative Example 5 One 3 16 Example 14 6 11 3 Comparative Example 6 One 6 13

From the results in Table 14, the whitening effect was verified in at least 14 subjects in 20 subjects compared to the respective comparative examples. In addition, it was confirmed that skin side effects were not observed in the subjects of the above-mentioned laboratory test, and thus it was a safe sample.

<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> OLIGONUCLEOTIDE WITH SKIN LIGHTENING EFFECT AND SKIN LIGHTENING          AGENT CONTAINING THE SAME <130> DPP20080013KR <160> 8 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide 1 against mRNA of kinesin gene <400> 1 taattcccat gccttctgga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide 2 against mRNA of kinesin gene <400> 2 ttcccagagg atgtttgtcc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide 3 against mRNA of kinesin gene <400> 3 ttcccagagg atgtttgtcc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide 4 against mRNA of kinesin gene <400> 4 aattcccatg ccttctggat 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide 5 against mRNA of kinesin gene <400> 5 tccactcagc ttttgtttcc g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide 6 against mRNA of kinesin gene <400> 6 agcttcatcc agcacagcac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide 7 against mRNA of kinesin gene <400> 7 gctctgtgca cccctttaca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense oligonucleotide 8 against mRNA of kinesin gene <400> 8 tgagttggag aagctgctgg 20

Claims (8)

A lightening agent comprising at least one oligonucleotide selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 1 to 8 as an active ingredient. The whitening agent according to claim 1, wherein the oligonucleotide is an oligonucleotide having a complementary base sequence to the mRNA at a site from the 400th base to the 600th base of the human kinesin heavy chain gene (GeneBank Accession No. X65873). delete delete The whitening agent according to claim 1, wherein the content of the oligonucleotide is 0.00001 to 10.0% by weight on a dry weight basis. 2. The whitening agent according to claim 1, wherein the oligonucleotide is a phosphorothioate oligonucleotide. A whitening functional cosmetic composition containing a whitening agent according to any one of claims 1, 2, 5, and 6. And having a nucleotide sequence selected from the group consisting of SEQ ID NOS: 1-8.