KR101430223B1 - Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property - Google Patents

Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property Download PDF

Info

Publication number
KR101430223B1
KR101430223B1 KR1020120111953A KR20120111953A KR101430223B1 KR 101430223 B1 KR101430223 B1 KR 101430223B1 KR 1020120111953 A KR1020120111953 A KR 1020120111953A KR 20120111953 A KR20120111953 A KR 20120111953A KR 101430223 B1 KR101430223 B1 KR 101430223B1
Authority
KR
South Korea
Prior art keywords
orf
seq
prrsv
represented
vaccine
Prior art date
Application number
KR1020120111953A
Other languages
Korean (ko)
Other versions
KR20140045774A (en
Inventor
김원일
최은진
김은주
이창희
송재영
Original Assignee
전북대학교산학협력단
대한민국(관리부서 : 농림축산식품부 농림축산검역본부)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 전북대학교산학협력단, 대한민국(관리부서 : 농림축산식품부 농림축산검역본부) filed Critical 전북대학교산학협력단
Priority to KR1020120111953A priority Critical patent/KR101430223B1/en
Publication of KR20140045774A publication Critical patent/KR20140045774A/en
Application granted granted Critical
Publication of KR101430223B1 publication Critical patent/KR101430223B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses

Abstract

본 발명은 면역유도능이 증가된 돼지생식기호흡기증후군 바이러스 및 이를 포함하는 돼지생식기호흡기 증후군 예방 또는 치료용 백신 조성물에 관한 것이다. 본 발명에 따른 CB11054의 ORF(open reading frame) 5 또는 ORF 7이 도입된 PRRSV는 TNF-α, INF-α, INF-β 및 IL-12 등 사이토카인의 생산을 증가시켜 면역 반응을 유도하는 효과가 우수하므로, 백신 접종 시 PRRSV에 대한 방어능이 우수하다.The present invention relates to a vaccine composition for preventing or treating porcine reproductive and respiratory syndrome virus having increased immunity-inducing ability and porcine reproductive-respiratory syndrome comprising the same. The ORF (open reading frame) 5 of CB11054 according to the present invention or the PRRSV into which ORF 7 is introduced has an effect of inducing an immune response by increasing the production of cytokines such as TNF- ?, INF- ?, INF- ?, and IL- Therefore, the vaccine has excellent protection against PRRSV.

Description

면역유도능이 증가된 돼지생식기호흡기증후군 바이러스{Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property}[0002] Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing ability [

본 발명은 면역유도능이 증가된 돼지생식기호흡기증후군 바이러스 및 이를 포함하는 돼지생식기호흡기 증후군 예방 또는 치료용 백신 조성물에 관한 것이다.The present invention relates to a vaccine composition for preventing or treating porcine reproductive and respiratory syndrome virus having increased immunity-inducing ability and porcine reproductive-respiratory syndrome comprising the same.

1987년 미국의 양돈지역을 중심으로 원인을 알 수 없는 새로운 돼지 질병의 발생이 보고되기 시작하였으며, 번식장애와 호흡기 감염이 복합적으로 나타나는 이 질병은 1988년과 1989년 여름에 폭발적으로 증가하였다. 미국 양돈업에 막대한 피해를 입힌 이 질병을 초기에는 '돼지 미스테리병'이라고 불렀으며, 이후 원인 바이러스가 분리되고 임상증상, 병원성 등에 대한 연구가 진행되면서 번식장애와 호흡기 감염이 함께 나타나는 임상증상의 특징을 따라 현재는 국제적으로 PRRS (Porcine Reproductive and Respiratory Syndrome; 돼지 생식기 호흡기 증후군) 라고 명명하고 있다. In 1987, a new pandemic outbreak began to be reported in the swine area of the United States. The disease, which is a combination of reproductive and respiratory infections, has exploded in the summer of 1988 and 1989. This disease, which has caused enormous damage to the US beef industry, was initially referred to as 'pig mystery disease'. Since then, the virus has been isolated and its clinical symptoms and pathogenicity have been studied. It is now known internationally as PRRS (Porcine Reproductive and Respiratory Syndrome).

우리나라에서는 이 질병과 유사한 증상의 유행보고는 없었으나 1992년부터 이 질병에 대한 연구를 시작하여 진단법을 확립하고, 국내 양돈장에 대한 역학조사를 실시하여 국내 유입을 확인하였으며 국내의 감염농장에서 원인 바이러스를 분리하였다. 아시아 지역에서는 우리나라 외에도 일본, 대만에서 발생의 확인 및 원인 바이러스의 분리를 보고하였다. In Korea, there have been no reports of epidemics similar to this disease. However, since 1992, the disease has been studied and established, and epidemiological studies on domestic pig farms have been carried out to confirm the inflow of domestic poultry. . In Asia, the occurrence of viruses was confirmed in Japan and Taiwan as well as in Korea.

PRRS는 발생 보고 이후에도 정확한 원인을 알 수 없어 양돈업계를 더욱 혼란에 빠뜨렸었는데, 1991년 6월 네덜란드 중앙수의연구소의 Wensvoort 박사가 돼지 폐포대식세포를 이용하여 원인 바이러스를 처음으로 분리하였다. 이 바이러스는 네덜란드 중앙수의연구소가 위치한 지명을 따서 Lelystad 바이러스라고 명명되었으며, 곧이어 미국을 비롯한 많은 나라에서 원인 바이러스를 분리하였고, 성상과 병원성 등을 조사한 결과 그 동안 미국과 유럽에서 번식장애와 호흡기 감염을 복합적으로 일으키던 새로운 돼지질병이 이 바이러스에 의한 것임이 밝혀졌다.In June 1991, Dr. Wensvoort of the Netherlands Center for Veterinary Research first isolated the causative virus using porcine alveolar macrophages. The virus was named Lelystad virus after being named by the Center for Veterinary Research in the Netherlands. Soon after isolating the causative virus in the United States and many other countries and investigating its characteristics and pathogenicity, It has been found that the new pig disease that has been caused by this virus is caused by the virus.

PRRS 바이러스는 외부 환경에는 그다지 강하지 못해서 산도 5 이하 또는 7 이상에서 바이러스 감염 역가가 90% 이상 감소되며, 37℃에서 10-24시간, 20℃에서는 6일 정도 경과하면, 감염 역가가 10배 이상 감소된다. 이 바이러스에 감염되었을 경우 병을 일으키는 정도는 매우 다양하여, 오직 혈청 검사에 의해서만 감염을 알 수 있을 정도로 임상 증상 및 경제적 손실이 전혀 없는 경우부터 농장의 생산에 20% 정도 손실을 입힐 정도로 심한 경우까지 있다.  The PRRS virus is not so strong in the external environment, so the virus infectivity is reduced by 90% or more at pH 5 or below or pH 7 or above, and the infectivity is decreased by 10 times or more at 10-24 hours at 37 ° C and 6 days at 20 ° C do. The severity of the disease is very variable, only if there is no clinical symptoms and economic loss to the extent that the infection can be detected only by serum tests, and if it is severe enough to cause 20% loss of farm production have.

PRRS 병명에서도 알 수 있듯이, PRRS 바이러스에 감염되면 번식장애와 호흡기 질환이 복합적으로 나타난다. PRRS 바이러스 감염에 의한 번식장애의 특징은 주로 임신 107일에서 113일 사이에 집중된 임신 말기 유산 또는 조산 태아 분만, 사산 및 미이라 자돈의 발생, 자돈의 이유 전 폐사율의 급증, 이유 후 폐사율의 증가, 발정 회귀의 지연 등이며 이 증상들은 감염된 모돈과 그 모돈에서 태어난 자돈들에 집중적으로 나타난다. PRRS 바이러스 감염에 의한 번식장애는 대부분 감염 초기부터 6개월 정도가 경과하면 감염 이전 상태로 회복되는 것으로 알려져 있다. PRRS 바이러스 감염에 의한 호흡기 질환은 전 일령에 나타날 수 있으며 특히 포유자돈과 이유자돈에서 집중적으로 나타난다. 이 경우 빠른 복식호흡이 관찰되고 안검부종, 결막염, 재채기, 설사 등이 관찰되며 짧은 기간의 체온상승이 있는 경우도 있고 드물게 신경증상을 보일 수도 있다. 호흡기 질환의 특징은 PRRS 바이러스 단독 감염의 경우보다는 세균성, 바이러스성 병원체의 2차 감염 및 복합감염이 많으며 그 경우 병원성이 훨씬 증폭된다. 그밖에 귀, 복부, 외음부 등에 청색 반점이 생기는 경우도 있어 영국에서는 청색귀병(Blue ear disease) 이라고 부르기도 한다. As can be seen from the PRRS pathology, infection with PRRS virus causes reproductive disorders and respiratory diseases. The characteristics of reproductive disorders due to PRRS virus infection are mainly in the late pregnancy lactation or preterm delivery fetuses that are concentrated between 107 days and 113 days of gestation, stillbirths and mummy piglets, rapid increase of pre-mortality rates of piglets, And delayed regression. These symptoms are concentrated in infected sows and piglets born from the sows. It is known that reproductive disorders due to PRRS virus infection are restored to their pre-infection state after 6 months from the initial stage of infection. Respiratory diseases caused by PRRS virus infection can occur at all ages, especially in piglets and weaned pigs. In this case, rapid abdominal respiration is observed, and eyelid edema, conjunctivitis, sneezing, diarrhea, etc. are observed. In some cases, there may be a rise in body temperature in a short period and rarely neurological symptoms. The characteristics of respiratory diseases are more prevalent in the case of bacterial, viral pathogens, secondary infections and multiple infections than in the case of PRRS virus alone. There are also blue spots on the ear, abdomen, and vulva, which are sometimes called blue ear disease in England.

이상의 임상증상들은 급성으로 심하게 진행되는 경우에 뚜렷하게 관찰할 수 있는 것들이며 준임상형 감염이나, 만성적으로 진행될 경우는 뚜렷하고 특징적인 임상증상을 거의 관찰할 수 없다. 만성적 감염은 이유 자돈과 육성비육 단계에서 주로 이루어지며, PRRS 바이러스의 공격을 받은 호흡기계에 세균 및 바이러스가 감염되어 비염과 폐렴을 일으킨다. 결과적으로 일일 평균 증체량이 저하되고, 사료 요구율은 더 증가하게 되며 이유 후 폐사율이 PRRS 바이러스 감염 전의 평균 폐사율보다 2배 가량 높아진다. PRRS 바이러스에 의한 호흡기 질환을 앓은 폐는 병리학적으로 특징적인 간질성 폐렴 소견을 나타낸다.The clinical manifestations are markedly evident when acute and severe progression occurs. Subclinical infections or chronic progression are evident and characteristic clinical symptoms are rarely observed. Chronic infections are mainly caused by infant piglets and breeding during the fattening stage. Infection with bacteria and viruses in the respiratory system attacked by the PRRS virus causes rhinitis and pneumonia. As a result, the average daily weight gain is lowered, the feed conversion rate is further increased, and the post-induction mortality rate is twice as high as the pre-PRRS virus pre-infection rate. The lungs with respiratory disease caused by the PRRS virus exhibit pathologically distinctive interstitial pneumonia.

PRRS 바이러스는 현재 유럽에서 최초로 분리된 Lelystad 바이러스(Wensvoort et al., 1991)와 북미에서 분리된 VR2332 바이러스(Benfield et al., 1992)가 각각 유럽주 (European strain)와 북미주 (North American strain)의 원형 (prototype)으로 분류되어 있으며, 이들 사이에는 염기서열 상동성이 약 55 ∼ 70% 정도로 매우 낮다(Gagnon and Dea, 1998; Kwang et al., 1994; Murtaugh et al., 1995). PRRS 바이러스는 현재 말 동맥염 바이러스(equine arteritis virus, EAV), 젖산탈수소화효소-증가 바이러스(lactate dehydrogenase-elevating virus, LDV), 원숭이 출혈열 바이러스(simian hemorrhagic fever virus, SHFV)와 더불어 니도비렐리스목(Nidovirales order), 아테리비리과(Arteriviridae family)에 속한다(Cavanagh, 1997). PRRS viruses are currently being detected in Europe (Wensvoort et al., 1991) and the VR2332 virus (Benfield et al., 1992) isolated from North America in the European strain and the North American strain, respectively, (Gagnon and Dea, 1998; Kwang et al., 1994; Murtaugh et al., 1995). The PRRS virus is currently being used in combination with equine arteritis virus (EAV), lactate dehydrogenase-elevating virus (LDV), simian hemorrhagic fever virus (SHFV) Nidovirales order, and Arteriviridae family (Cavanagh, 1997).

PRRS 바이러스는 인지질을 가진 매우 작은 엔벨롭 바이러스(enveloped virus)이며, 정다면체 형태의 뉴클레오캡시드 안에 약 15 kb 정도의 양성 극성의 단일가닥 RNA 게놈을 가지고 있다(Collins et al., 1992). 바이러스의 자가복제에 필요한 효소들로 구성된 비구조 단백질인 복제효소(replicase)를 인코딩하는 유전자들은 게놈 RNA의 5'-말단으로부터 약 80%를 차지하며, 게놈 RNA로부터 발현되는 서로 중첩되는 부위를 가진 ORF1a와 ORF1b에 의해서 만들어진다. 이 중에서 ORF1b는 ribosomal frameshift 기작에 의해 발현된다고 보고된 바 있다(Brierley et al., 1989). 바이러스의 구조 단백질들은 게놈 RNA의 3'-말단으로부터 약 20%를 차지하며, ORF2a, ORF2b에서부터 ORF7의 7개의 유전자로부터 발현된다. ORF2, ORF3, 및 ORF4는 각각 GP2, GP3 및 GP4인 당화된 막단백질을 생성하며 ORF5는 PRRS바이러스 중화력에 가장 중요한 역할을 하는 당단백질 GP5 엔벨롭 단백질, ORF6는 M (matrix), 그리고 ORF7은 N(nucleocapcide)을 생성한다(Meulenberg et al., 1995; Bastos et al., 2004). 이들은 감염된 세포 내에서 monocistronic subge-nomic mRNA의 5'-말단으로부터 발현된다(Meulenberg et al.,1993; Snijder et al.,1999). The PRRS virus is a very small enveloped virus with phospholipids and has a single-stranded RNA genome of about 15 kb positive polarity in a regular-shaped nucleocapsid (Collins et al., 1992). Genes that encode replicase, a non-structural protein composed of enzymes necessary for the replication of viruses, occupy about 80% from the 5'-end of genomic RNA and have overlapping regions expressed from genomic RNA It is made by ORF1a and ORF1b. Of these, ORF1b has been reported to be expressed by the ribosomal frameshift mechanism (Brierley et al., 1989). Viral structural proteins occupy about 20% from the 3'-end of genomic RNA and are expressed from seven genes from ORF2a, ORF2b to ORF7. ORF2, ORF3, and ORF4 produce glycated membrane proteins, GP2, GP3, and GP4, respectively, and ORF5 is a glycoprotein GP5 envelope protein that plays a major role in PRRS virus neutralization, ORF6 is M (matrix) N (nucleocapcide) (Meulenberg et al., 1995; Bastos et al., 2004). They are expressed from the 5'-end of monocistronic subgenomic mRNA in infected cells (Meulenberg et al., 1993; Snijder et al., 1999).

그러나, 아직까지 PRRS 바이러스의 구조 단백질뿐만 아니라 비구조 단백질을 포함한 대부분의 단백질에 대한 기능 및 분자생물학적 특성에 관한 연구 결과는 미미한 상태이다.However, the results of studies on functional and molecular biological properties of most proteins including non-structural proteins as well as structural proteins of PRRS virus are still insignificant.

따라서, PRRS 바이러스의 면역 유도 반응에서 가장 중요한 역할을 하는 유전자를 찾아내고, 이를 이용하여 면역반응을 효과적으로 유도할 수 있는 새로운 재조합 PRRS 바이러스와 백신 조성물에 관한 연구가 필요하다.Therefore, there is a need for research on novel recombinant PRRS viruses and vaccine compositions that can identify the most important genes in the immunity induction of PRRS viruses and effectively induce immune responses using them.

본 발명자들은 돼지생식기호흡기증후군 바이러스(Porcine Reproductive and Respiratory Syndrome Virus; 이하, PRRSV)의 유전자에 관하여 연구하던 중, 다른 돼지생식기호흡기증후군 바이러스에 비해 면역유도능이 높은 특정 PRRSV의 ORF(Open reading frame) 5, ORF 7 유전자가 사이토카인 분비 증가 등 면역 반응에서 핵심적인 역할을 함을 확인하고, 본 발명을 완성하였다.The present inventors investigated the genes of Porcine Reproductive and Respiratory Syndrome Virus (hereinafter, referred to as PRRSV), and found that ORF (Open reading frame) 5 of PRRSV, which has a higher immunoreactivity than other porcine reproductive and respiratory syndrome viruses , And that the ORF 7 gene plays a key role in the immune response, such as increased cytokine secretion, and completed the present invention.

본 발명의 목적은 돼지생식기호흡기증후군(PRRS)을 효과적으로 예방 또는 치료할 수 있는, 면역유능이 증가된 재조합 PRRSV 및 이를 포함하는 PRRS 예방 또는 치료용 백신 조성물을 제공하는 것이다.It is an object of the present invention to provide a vaccine composition for preventing or treating PRRS comprising recombinant PRRSV having increased immunity ability and effective for preventing or treating porcine reproductive and respiratory syndrome (PRRS).

상기와 같은 목적을 달성하기 위해서, 본 발명은 면역유도능이 증가된 돼지생식기호흡기증후군 바이러스(이하, PRRSV) 및 이를 포함하는 돼지생식기호흡기 증후군(이하, PRRS) 예방 또는 치료용 백신 조성물 제공한다.In order to achieve the above object, the present invention provides a vaccine composition for preventing or treating porcine reproductive and respiratory syndrome virus (hereinafter, referred to as PRRSV) and a porcine reproductive and respiratory syndrome (hereinafter referred to as PRRS)

또한 본 발명은, PRRSV의 면역유도능을 증가시키는 방법을 제공한다.The present invention also provides a method for increasing the immunoreactivity of PRRSV.

또한 본 발명은, 면역유도능이 증가된 PRRSV 또는 이의 항원을 포함하는 PRRS의 진단 키트를 제공한다.The present invention also provides a diagnostic kit for PRRS comprising PRRSV or an antigen thereof with increased immunogenicity.

또한 본 발명은, 면역유도능이 증가된 PRRSV 또는 이의 항원을 이용한 항원-항체 반응을 통해 감염될 또는 감염된 세포 내에서 PRRSV를 검출하는 것을 특징으로 하는, PRRSV의 검출방법을 제공한다.The present invention also provides a method for detecting PRRSV, characterized in that PRRSV is detected in infected or infected cells through an antigen-antibody reaction using PRRSV or its antigen with increased immunodetection ability.

또한 본 발명은, 상기 백신조성물을 돼지에 투여하여 PRRSV 감염 질환을 예방 또는 치료하는 방법을 제공한다.The present invention also provides a method for preventing or treating a PRRSV infection disease by administering the vaccine composition to pigs.

본 발명에 따른 CB11054의 ORF(open reading frame) 5 또는 ORF 7이 도입된 PRRSV는 TNF-α, INF-α, INF-β 및 IL-12 등 사이토카인의 생산을 증가시켜 면역 반응을 유도하는 효과가 우수하므로, 백신 접종 시 PRRSV에 대한 방어능이 우수하다.The ORF (open reading frame) 5 of CB11054 according to the present invention or the PRRSV into which ORF 7 is introduced has an effect of inducing an immune response by increasing the production of cytokines such as TNF- ?, INF- ?, INF- ?, and IL- Therefore, the vaccine has excellent protection against PRRSV.

도 1은 PRRSV 음성 폐포 대식세포에서 야외바이러스(VR2332, CB11054)와 변이바이러스(CBP5, CBP7, CBP567)의 사이토카인인 TNF-α, INF-α, IL-12 INF-γ(A), INF-β(B)의 발현량을 상대 정량법 (Relative quantification, RQ)을 통해 측정한 결과를 나타낸 도이다(*: p<0.05, **: p<0.01. ***: p<0.001).
도 2는 야외바이러스(VR2332, CB11054)와 변이바이러스(CBP5, CBP7, CBP567)를 접종하고 1 또는 3주 후, TNF-α, IL-2, IL-4, IL-12 발현을 ELISA를 이용하여 측정한 결과를 나타낸 도이다.FIG. 1 shows the expression of TNF-α, INF-α, IL-12 INF-γ (A), and INF-γ, which are cytokines of outdoor viruses (VR2332, CB11054) and mutant viruses (CBP5, CBP7, CBP567) (*: p <0.05, **: p <0.01. ***: p <0.001) of the expression level of β (B) by relative quantification (RQ).
FIG. 2 shows the expression of TNF-.alpha., IL-2, IL-4 and IL-12 in 1 or 3 weeks after inoculation with the outdoor viruses VR2332 and CB11054 and mutant viruses CBP5, CBP7 and CBP567 And Fig.

본 발명은 CB11054의 ORF(open reading frame) 5 또는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된, 면역유도능이 증가된 돼지생식기호흡기증후군 바이러스를 제공한다. The present invention provides a porcine reproductive and respiratory syndrome virus with an increased immunoreactivity, wherein at least one base sequence selected from ORF (open reading frame) 5 or ORF 7 of CB11054 is introduced.

또한 본 발명은, CB11054 PRRSV의 ORF5 또는 ORF7 중에서 선택된 1종 이상의 염기 서열을 PRRSV에 삽입하는 것을 특징으로 하는, PRRSV의 면역유도능을 증가시키는 방법을 제공한다.The present invention also provides a method for increasing the immunoreactivity of PRRSV, characterized in that at least one base sequence selected from ORF5 or ORF7 of CB11054 PRRSV is inserted into PRRSV.

상기 ORF 5 또는 ORF 7은 각각 또는 동시에 PRRSV에 도입될 수 있다. The ORF 5 or ORF 7 may be introduced into PRRSV, respectively, or simultaneously.

상기 ORF 5 또는ORF 7이 도입된 PRRSV는 각각 서열번호 1 또는 서열번호 2의 염기서열로 구성될 수 있다. The PRRSV into which ORF 5 or ORF 7 is introduced may be composed of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, respectively.

상기 CB11054의 ORF(open reading frame) 5 또는 ORF 7 중에서 선택된 1종 이상의 염기 서열은 다양한 종류의 PRRSV 에 도입될 수 있으나, VR2332 주에 도입되는 것이 바람직하다. The at least one base sequence selected from ORF (open reading frame) 5 or ORF 7 of CB11054 can be introduced into various kinds of PRRSV, but is preferably introduced into VR2332 strain.

본 발명에 따른 면역유도능이 증가된 PRRSV는, 개체 접종 시 야생형의 야외바이러스에 비하여 TNF-α, INF-α, INF-β 및 IL-12 사이토카인의 분비를 증가시키는 효과가 우수하다.
The immunoreactivity-enhanced PRRSV according to the present invention is superior to the wild-type outdoor virus at the time of individual inoculation, and has an effect of increasing secretion of TNF-α, INF-α, INF-β and IL-12 cytokine.

또한 본 발명은 CB11054의 ORF(open reading frame) 5 또는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된, 면역유도능이 증가된 PRRSV를 유효성분으로 포함하는 PRRS 예방 또는 치료용 백신 조성물을 제공한다. The present invention also provides a vaccine composition for the prevention or treatment of PRRS, which comprises as an active ingredient PRRSV having an increased immunoreactivity, wherein at least one base sequence selected from ORF (open reading frame) 5 or ORF 7 of CB11054 is introduced.

상기 백신은 면역유도능이 증가된 PRRSV를 포함하고 있어 접종 시 개체 내에서 TNF-α, INF-α, INF-β 및 IL-12 의 분비를 더욱 효과적으로 유도할 수 있다. Since the vaccine contains PRRSV having an increased immunity inducing ability, secretion of TNF-a, INF-alpha, INF-beta and IL-12 can be more effectively induced in a subject during inoculation.

본 발명의 백신은 추가로 약리학적으로 허용가능한 담체 또는 희석제를 포함한다. 백신에 적합한 담체는 기술분야의 당업자에게 공지되어 있으며, 단백질, 설탕 등을 포함하지만, 이로 한정되는 것은 아니다. 상기의 담체는 수용액 또는 비-수용액, 현탁액, 및 에멀전일 수 있다. 비-수용액 담체의 예는 프로필렌 글리콜, 폴리에틸렌 글리콜, 식용유 예컨대 올리브 오일, 및 주사가능한 유기 에스테르 예컨대 에틸 올리에이트를 들 수 있다. 수용액 담체는 식염수 및 완충배지를 포함하는, 물, 알콜/수용액, 에멀전 또는 현탁액을 포함한다. 비경구 담체는 염화나트륨 용액, 링거 덱스트로오스, 덱스트로오스 및 염화나트륨, 유산처리 링거 또는 고정 오일을 포함한다. 정맥주사용 담체는 예컨대 링거 덱스트로오스를 기본으로 하는 것과 같은 전해질 보충제, 액체 및 영양 보충제 등을 포함한다. 방부제 및 기타 첨가제 예컨대 예를 들면 항미생물제제, 항산화제, 킬레이트제, 불활성 가스 등과 같은 것이 추가로 존재할 수 있다. 바람직한 방부제는 포르말린, 티메로살, 네오마이신, 폴리믹신 B 및 암포테리신 B를 포함한다.The vaccine of the present invention further comprises a pharmacologically acceptable carrier or diluent. Suitable carriers for vaccines are known to those skilled in the art and include, but are not limited to, proteins, sugars, and the like. Such carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous carrier include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable organic ester such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral carriers include sodium chloride solution, Ringer &apos; s dextrose, dextrose and sodium chloride, lactic acid treatment linger or fixed oils. The intravenous carrier includes electrolyte supplements, liquids and nutritional supplements, such as those based on Ringer &apos; s dextrose. Preservatives and other additives such as antimicrobial agents, antioxidants, chelating agents, inert gases and the like may be additionally present. Preferred preservatives include formalin, thimerosal, neomycin, polyamicin B and amphotericin B.

또한, 상기 백신 조성물은 애쥬번트를 추가로 포함할 수 있다. In addition, the vaccine composition may further comprise an adjuvant.

상기 애주번트는 면역반응의 향상 및/또는 접종 후 흡수 속도를 촉진하는 화합물 또는 혼합물을 칭하는 것으로 임의의 흡수-촉진제를 포함한다. 허용가능한 애주번트는 프로인트 완전애주번트, 프로인트 불완전애주번트, 사포닌, 미네랄 젤 예컨대 수산화 알루미늄, 계면활성제 예컨대 리소레시틴, 플루론 폴리올, 다가음이온, 펩타이드, 오일, 탄화수소 에멀전, 키홀림펫 헤모시아닌, 디니트로페놀 등을 포함하나, 이로 제한되는 것은 아니다. 바람직한 애주번트는 Fort Dodge Animal Health의 METASTIM 애주번트이다.The adjuvant includes any absorption-promoting agent which refers to a compound or mixture that promotes an immune response and / or promotes the rate of absorption after inoculation. Acceptable adjuvants include, but are not limited to, Freund's complete adjuvant, Freund's incomplete adjuvant, saponin, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyvalent anions, peptides, oils, hydrocarbon emulsions, But not limited to, dinitrophenol and the like. The preferred adjuvant is the METASTIM adjuvant of Fort Dodge Animal Health.

상기 백신은 생백신, 약독화 백신 및 사독 백신으로 이루어진 군에서 선택된 1종의 백신일 수 있다.The vaccine may be a vaccine selected from the group consisting of a live vaccine, an attenuated vaccine, and a sadox vaccine.

본 발명의 목적을 위한 백신조성물의 투여량은 체중 1kg 당 0.02 ml 내지 0.2 ml 인 것이 바람직하다.The dose of the vaccine composition for the purposes of the present invention is preferably from 0.02 ml to 0.2 ml per kg of body weight.

본 발명의 백신 조성물은 근육, 피하, 복강, 정맥, 경구, 진피, 안구 및 뇌 내로 이루어진 군에서 선택된 1종 이상의 투여 경로를 통해 투여될 수 있으며, 본 발명에서는 경구 투여가 바람직하다.
The vaccine composition of the present invention may be administered through one or more routes selected from the group consisting of muscles, subcutaneous, intraperitoneal, intravenous, oral, dermal, ocular and intracerebral. In the present invention, oral administration is preferred.

또한 본 발명은, CB11054의 ORF(open reading frame) 5 또는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된, 면역유도능이 증가된 PRRSV 또는 이의 항원을 포함하는 PRRS 진단 키트를 제공한다.The present invention also provides a PRRS diagnostic kit comprising PRRSV or an antigen thereof with increased immunoreactivity, wherein at least one base sequence selected from ORF (open reading frame) 5 or ORF 7 of CB11054 is introduced.

상기 진단 키트는 당업계에서 통상적으로 사용되는 방법을 이용하여 제조될 수 있다.The diagnostic kit may be prepared using a method commonly used in the art.

이러한 진단 키트는 CB11054의 ORF(open reading frame) 5 또는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된, 면역유도반응이 개선된 PRRSV 또는 이의 항원뿐만 아니라 면역학적 분석에 사용되는 당 분야에서 일반적으로 사용되는 도구, 시약 등이 포함된다. 이러한 도구/시약으로는 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 용해제, 세정제, 완충제, 안정화제 등이 포함되나 이로 제한되지 않는다. 표지 물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다. 적합한 담체로는, 이에 한정되지는 않으나, 가용성 담체, 예를 들어 당 분야에 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS, 불용성 담체, 예를 들어 폴리스티렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로오스 및 이들의 조합일 수 있다.
These diagnostic kits are generally used in the art for the immunological analysis as well as PRRSV or its antigen with improved immunity induction reaction, in which at least one base sequence selected from ORF (open reading frame) 5 or ORF 7 of CB11054 is introduced Tools, reagents, etc. used. Such tools / reagents include, but are not limited to, suitable carriers, labeling substances capable of producing a detectable signal, solubilizers, cleaning agents, buffers, stabilizers, and the like. When the labeling substance is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction terminator. Suitable carriers include, but are not limited to, soluble carriers, e. G., Physiologically acceptable buffers such as PBS, insoluble carriers such as polystyrene, polyethylene, polypropylene, Polyacrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose and combinations thereof.

또한 본 발명은 CB11054의 ORF(open reading frame) 5 또는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된, 면역유도능이 증가된 PRRSV 또는 이의 항원을 이용한 항원-항체 반응을 통해 감염될 또는 감염된 세포 내에서 PRRSV를 검출하는 것을 특징으로 하는, PRRSV의 검출방법을 제공한다.The present invention also relates to a method for the detection of an infectious or infectious cell through an antigen-antibody reaction using PRRSV or an antigen thereof with increased immunity induction ability, into which at least one base sequence selected from ORF (open reading frame) 5 or ORF 7 of CB11054 has been introduced And detecting PRRSV in the PRRSV.

상기 항원-항체 반응은 조직면역염색, 방사능면역분석법(RIA), 효소면역분석법(ELISA), 웨스턴블럿(Western Blotting), 면역침전분석법(Immunoprecipitation Assay), 면역확산분석법(Immunodiffusion Assay), 보체고정분석법(Complement Fixation Assay), FACS(Fluorescence-activated cell sorter) 및 단백질칩(protein chip) 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법을 이용할 수 있다.
The antigen-antibody reaction can be assayed by immunohistochemical staining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assays, immunodiffusion assays, (Complement Fixation Assay), Fluorescence-activated cell sorter (FACS) and protein chip analysis.

또한 본 발명은 CB11054의 ORF(open reading frame) 5 또는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된, 면역유도능이 증가된 PRRSV 를 포함하는 백신 조성물을 돼지에 투여하여 PRRSV 감염 질환을 예방 또는 치료하는 방법을 제공한다.
The present invention also relates to a method for preventing or treating a PRRSV infectious disease by administering to a pig a vaccine composition comprising PRRSV having increased immunity induction ability into which at least one base sequence selected from ORF (open reading frame) 5 or ORF 7 of CB11054 is introduced . &Lt; / RTI &gt;

이하, 본 발명을 실시예 및 제제예에 의해 상세히 설명한다. 단, 하기 실시예 및 제제예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 제제예에 의해 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to Examples and Preparation Examples. However, the following examples and preparative examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following examples and preparative examples.

실시예 1. PRRSV 종류에 따른 상이한 방어면역 유도 확인Example 1. Identification of different defense immunity induction according to PRRSV type

대부분의 PRRSV는 감염된 돼지에서 면역반응을 억제하고, 중화항체 등의 방어면역 형성을 억제하는 것으로 알려져 있다. 그러나, 일부 PRRSV의 경우 높은 수준의 방어 면역을 형성하고 효과적인 교차 방어를 형성하는 것으로 알려져 있으므로, VR2332 및 CB11054 바이러스 주 사이에 중화항체 형성 효과의 차이가 있는지 여부를 확인하였다. VR2332는 2011년에 농림수산검역검사본부의 바이러스질병과에서 분양받았으며 CB11054는 2011년 전북대학교 동물질병진단센터에 접수된 가검물에서 분리한 야외바이러스주이다. Most PRRSVs are known to inhibit the immune response in infected pigs and to inhibit protective immunity such as neutralizing antibodies. However, since some PRRSVs are known to form high levels of protective immunity and form effective cross-over defenses, we have determined whether there is a difference in the effect of neutralizing antibody formation between VR2332 and CB11054 virus strains. In 2011, VR2332 was distributed to the Ministry of Agriculture, Forestry and Fisheries Quarantine Inspection Headquarters, and CB11054 was an outdoor virus strain isolated from the samples collected at the Animal Disease Diagnosis Center of Chonbuk National University in 2011.

결과를 표 1에 나타내었다. The results are shown in Table 1.

1stinoculum1 st inoculum 2ndinoculuma 2 nd inoculum a # of positive animal/ total # of animal (VN titer)*# of positive animal / total # of animal (VN titer) * 35 dpi35 dpi 42 dpi42 dpi 58dpib 58dpi b VR2332VR2332 nonenone 1/6 (1:4)1/6 (1: 4) 2/6 (1:2)2/6 (1: 2) 1/6 (1:2)1/6 (1: 2) VR2332VR2332 0/7 (NC)0/7 (N C ) 0/7 (N)0/7 (N) 1/7 (1:2)1/7 (1: 2) CB11054CB11054 nonenone 6/6 (1:4-8)6/6 (1: 4-8) 6/6 (1:4-32)6/6 (1: 4-32) 6/6 (1:4-32)6/6 (1: 4-32) CB11054CB11054 7/7 (1:2-8)7/7 (1: 2-8) 7/7 (1:4-8)7/7 (1: 4-8) 7/7 (1:4-64)7/7 (1: 4-64)

*VN antibody titer (바이러스 중화항체);aAt 44 days post 1stinoculation(dpi); bAt 14* VN antibody titer (virus neutralizing antibody); a At 44 days post 1 st inoculation (dpi); b At 14

표 1에 나타낸 바와 같이, CB11054 바이러스 주는 VR2332보다 빠르게 높은 수준의 중화 항체를 형성하는 것을 확인하였다.
As shown in Table 1, the CB11054 virus strain was found to form a higher level of neutralizing antibody faster than VR2332.

실시예Example 2. 변이  2. Variation PRRSV 의PRRSV 제작 making

두 가지 종류의 PRRSV인 VR2332와 CB11054를 사용하여 돌연변이 클론을 제작하였다. CB11054의 구조 단백질 유전자인 ORF(open reading frame) 5, 6, 7 의 방어 면역 형성과의 관계를 증명하기 위하여, CB11054의 ORF5, ORF7, 또는 ORFs 5-7를 VR2332 감염성 클론의 해당 유전자와 치환하여 생산한 CBP5, CBP7 또는 CBP567 등 3개의 변이 바이러스를 각각 생산하였다. 구조 단백질 유전자 변이 바이러스를 생산하기 위해서 먼저 VR2332의 구조단백질 유전자인 ORFs 2-7을 모두 가지고 있는 셔틀벡터를 제작하고 이를 이용하여 변이 PCR을 실시하였다. 즉, CB11054의 ORFs 5, 6 또는 7을 RT-PCR을 이용하여 각각 증폭하고 증폭된 PCR 증폭물을 프라이머로 사용하여 변이 PCR을 실시하였으며, 셔틀벡터의 ORF5, 6 또는 7를 CB11054의 유전자들로 치환하였다. CB11054의 유전자로 치환된 변이 셔틀벡터들은 VR2332 감염성클론과 셔틀벡터의 BsrGI과 HpaI 제한요소 시퀀스를 이용하여 변이 시퀀스를 가지고 있는 전체 구조 단백질 유전자를 감염성 클론으로 도입하였다.Two types of PRRSVs, VR2332 and CB11054, were used to generate mutant clones. In order to demonstrate the relationship of the structural protein genes of CB11054, ORF (open reading frame) 5, 6, 7 to protective immunity formation, the ORF5, ORF7, or ORFs 5-7 of CB11054 were replaced with the corresponding gene of the VR2332 infectious clone And produced three mutant viruses, CBP5, CBP7 and CBP567, respectively. In order to produce the structural gene mutated virus, first, a shuttle vector containing all ORFs 2-7, which is a structural protein gene of VR2332, was constructed and mutagenic PCR was performed using the shuttle vector. That is, ORFs 5, 6, or 7 of CB11054 were individually amplified using RT-PCR, and PCR amplification was performed using the amplified PCR amplification primers. The ORF5, 6 or 7 of the shuttle vector was amplified with the genes of CB11054 . The mutated shuttle vectors substituted with the CB11054 gene introduced the entire structural protein gene having the mutation sequence into the infectious clone using the VR2332 infectious clone and the BsrGI and HpaI restriction element sequences of the shuttle vector.

제작된 3개의 변이 바이러스를 표 2에 나타내었다. The three mutated viruses produced are shown in Table 2 .

이름name CBP5CBP5 CBP7CBP7 CBP567CBP567 치환 부위Substitution site ORF5ORF5 ORF7ORF7 ORFs 5-7ORFs 5-7

실시예Example 3. 야외 바이러스와 변이바이러스의 면역 반응 비교 3. Comparison of immune responses between outdoor and mutant viruses

3.1 3.1 PRRSVPRRSV 음성  voice PAMPAM 을 이용한 면역 반응 분석Analysis of immune response using

먼저 PRRS 바이러스 음성인 4-5주령의 돼지 6마리를 구입하여 각각의 돼지에서 PAM(Porcine alveolar macrophage)을 분리하였다. 각각의 돼지에서 분리한 PAM들은 1x106의 수로 맞추어 24-웰 플레이트에 24시간 동안 배양한 후 1x102 TCID50/100μl로 준비된 VR2332 및 CB11054 등의 야외바이러스와 CBP5, CBP7, CBP56, CBP567 등의 변이 바이러스를 각각 접종하였다. 음성 대조군(NT)으로 배지만을 접종한 군을 설정하였다. 바이러스 또는 배지를 접종한 뒤 24, 36, 48시간 후에 상층액을 모두 수거하고 세포들은 조직 용해 완충액(tissue lysis buffer, GeneAll)을 이용하여 처리한 후 수거하여 -80℃에 보관하였다. 면역반응을 측정하기 위한 사이토카인 분석을 위하여, 수거한 PAM들에서 총 RNA를 분리한 후 실시간 PCR 및 상대 정량법(Relative quantification, RQ)을 이용하여 TNF-α, INF-α, INF-β, INF-γ 및 IL-12의 mRNA의 발현 정도를 측정하였다. 내인성 대조군(Endogenous control)으로는 β-액틴을 사용하여 측정값을 표준화 하였다. First, six pigs aged 4-5 weeks, negative for PRRS virus, were purchased and PAM (Porcine alveolar macrophage) was isolated from each pig. PAM isolated from each pig are then cultured for 24 hours in 24-well plates according to the number of 1x10 6 1x10 2 mutations, such as TCID 50 / 100μl prepared in VR2332 and CB11054 such as viruses and outdoor CBP5, CBP7, CBP56, CBP567 Respectively. Negative control group (NT) was set up in the group inoculated with boars. After 24, 36 and 48 hours after inoculation with the virus or medium, all supernatants were collected and treated with tissue lysis buffer (GeneAll) and stored at -80 ° C. INF-.alpha., INF-.beta., .Beta.-INF, .beta., .Beta., .Beta., .Beta., .Beta., .Beta., .Beta. -γ and IL-12 mRNA expression levels were measured. As the endogenous control, β-actin was used to standardize the measurement values.

결과를 도 1에 나타내었다.The results are shown in Fig.

도 1에 나타낸 바와 같이, CB11054는 VR2332에 비해서 월등히 높은 수준의 TNF-α, INF-α, INF-γ 및 IL-12(A), INF-β(B)의 발현을 보였다. 특히 INF-β의 경우는 CB11054를 접종한 경우 VR2332에 비해 약 3만배 이상의 높은 발현량을 보였다. 변이바이러스 중에서는 CB11054의 ORF7 유전자를 가지고 있는 CBP7과 CBP567 변이 바이러스가 VR2332에 비해 월등히 높은 수준의 TNF-α, INF-α, INF-β 및 IL-12 발현을 보였다. 또한, CB11054의 ORF5 유전자를 가지고 있는 CBP5의 경우는 VR2332에 비해 높은 수준의 INF-α 및 INF-γ 발현을 보였다. 따라서 CB11054의 ORF5 및 ORF7 유전자가 CB11054의 높은 수준의 사이토카인 생산에 밀접하게 관련이 있는 것을 확인하였다. 이를 통해, 숙주의 면역반응을 억제하고 높은 수준의 방어면역을 유도하지 못하는 PRRSV에 CB11054의 ORF 5 또는 ORF7을 도입함으로써, 높은 수준의 면역유도능을 가진 PRRSV를 제조할 수 있음을 알 수 있다.As shown in Fig. 1, CB11054 showed significantly higher levels of TNF- [alpha], INF- [alpha], INF- [gamma] and IL-12 (A) and INF- [beta] (B) than VR2332. In the case of INF-β, the expression level of CB11054 was over 30,000 times higher than that of VR2332. Among the mutant viruses, the CBP7 and CBP567 mutant viruses carrying the ORF7 gene of CB11054 showed significantly higher levels of TNF-α, INF-α, INF-β and IL-12 expression than VR2332. In addition, CBP5 having the ORF5 gene of CB11054 showed higher levels of INF-α and INF-γ than VR2332. Thus, we confirmed that the ORF5 and ORF7 genes of CB11054 are closely related to the high level of cytokine production of CB11054. Thus, it can be seen that PRRSV having a high level of immunity inducing ability can be produced by introducing ORF 5 or ORF 7 of CB11054 into PRRSV which inhibits the host's immune response and does not induce a high level of protective immunity.

3.2 돼지를 이용한 면역 반응 분석3.2 Analysis of immune response using pig

PRRS 바이러스 음성인 4주령의 돼지 20마리를 구입하여 5개의 돈방에 4마리씩 나누어 사육하였다. 이 후 1x103 TCID50/ml로 준비된 VR2332 및 CB11054 등의 야외바이러스와 CBP5, CBP7, CBP56, CBP567 등의 변이 바이러스를 5개의 돈방에 각각 접종하였다. 바이러스 접종 1주 후부터 6주까지 매주 1회 혈액을 채취하여 혈청과 PBMC(peripheral blood mononuclear cells)를 분리하였고 바이러스 접종 후 6주 후에 모든 돼지들은 안락사시킨 후, 전혈을 수거하고 폐에서 PAM을 분리하였다. Twenty four-week-old pigs, which were negative for PRRS virus, were purchased and divided into four pigs. After that, 5 viruses such as VR2332 and CB11054 prepared with 1 × 10 3 TCID 50 / ml and mutant viruses such as CBP5, CBP7, CBP56, and CBP567 were inoculated into each of 5 pigs. Serum and PBMC (peripheral blood mononuclear cells) were separated from the blood every week from 1 week to 6 weeks after virus inoculation. After 6 weeks of virus inoculation, all pigs were euthanized, and whole blood was collected and PAM was isolated from the lungs .

실시간 PCR을 이용하여 혈청에서 혈중바이러스 역가를 측정하였고, ELISA 항체가와 바이러스 중화항체가를 측정하였다. 혈중바이러스 역가와 ELISA 항체가를 분석한 결과 야외바이러스를 접종한 돼지들이 변이 바이러스를 접종한 돼지들보다 훨씬 빠르고 높은 수준의 혈중바이러스 역가와 ELISA 항체가를 보임을 확인하였다. 이를 통해, 야외바이러스가 돼지에서 훨씬 효과적으로 증식하며 높은 수준의 병원성을 보이는 것을 알 수 있었다. 바이러스 중화항체가를 VR2332와 CB11054에 대하여 각각 측정한 결과 CB11054를 접종한 돼지는 바이러스 접종 후 4-6주간 CB11054 바이러스에 대하여 1:4-64의 중화항체가를 보인반면 VR2332를 접종한 돼지는 같은 기간 동안 VR2332에 대하여 1:2-8의 중화항체가를 보였다. CB11054의 ORF7 유전자를 도입한 CBP7 변이바이러스는 VR233에 대해 VR2332를 접종한 돼지들과 비슷한 수준의 중화항체가인 1:4-8의 중화항체가를 보였다. Serum viral titer was measured using real - time PCR and ELISA antibody and viral neutralizing antibody were measured. Analysis of serum viral titer and ELISA antibody showed that the pigs inoculated with the outdoor virus showed a much faster and higher level of blood viral titer and ELISA antibody than the pigs inoculated with the mutated virus. Through this, we can see that the outbreak viruses grow more effectively in pigs and have a high level of virulence. As a result of measuring the virus neutralizing antibody value against VR2332 and CB11054, the pigs inoculated with CB11054 showed a neutralizing antibody value of 1: 4-64 against CB11054 virus for 4-6 weeks after the inoculation of virus, while the pigs vaccinated with VR2332 Showed neutralizing antibody titers of 1: 2-8 for VR2332. The CBP7 mutant virus introduced CB11054 ORF7 gene showed a neutralizing antibody titer of 1: 4-8, which is similar to that of pigs vaccinated with VR2332 against VR233.

분리한 PBMC는 1x106의 수로 맞추어 24-well 플레이트에 분주하고 VR2332와 CB11054 바이러스들을 0.01 m.o.i로 PBMC에 각각 접종하여 24시간 동안 PBMC를 감작시켰다. 음성 대조군으로는 배지를 접종하였다. 24시간 배양 후에 상층액과 세포는 원심 분리하여 각각 수거하여 -80℃에 보관하였다. 수거한 상층액은 ELISA를 이용하여 TNF-α, IL-2, IL-4, IL-12 발현의 측정하였다. The separated PBMCs were dispensed into 24-well plates at a ratio of 1 × 10 6 , and PBMCs were sensitized for 24 hours by inoculating PBMC with 0.01 moi of VR2332 and CB11054 viruses, respectively. As a negative control, medium was inoculated. After 24 hours of culture, the supernatant and cells were collected by centrifugation and stored at -80 ° C. TNF-α, IL-2, IL-4 and IL-12 expression were measured by ELISA in the supernatants collected.

결과를 도 2에 나타내었다.The results are shown in Fig.

도 2에 나타낸 바와 같이, CB11054의 ORF5 또는 ORF7, ORF 5 내지 7 이 도입된 변이 바이러스들은 야외 바이러스인 VR2332 및 CB11054 접종군과 비교하여, 접종 3주 후 TNF-α, IL-2, IL-4, IL-12의 발현이 야외 바이러스 접종군과 비슷하거나 더욱 높은 것을 확인하였다. 따라서, 숙주의 면역반응을 억제하고 높은 수준의 방어면역을 유도하지 못하는 PRRSV에 CB11054의 ORF 5 또는 ORF7을 도입함으로써, 높은 수준의 면역유도능을 가진 PRRSV를 제조할 수 있음을 알 수 있다.
As shown in Fig. 2, the mutant viruses into which ORF5 or ORF7 and ORF5 to 7 of CB11054 were introduced were compared with the wild-type VR2332 and CB11054 inoculation groups, and TNF-α, IL-2 and IL-4 , IL-12 was found to be similar to or higher than that of the outdoor virus inoculation group. Thus, it can be seen that by introducing ORF 5 or ORF 7 of CB11054 into PRRSV which inhibits the host immune response and does not induce a high level of protective immunity, PRRSV with high immunogenicity can be produced.

실시예Example 4.  4. 면역유도능이Immunity induction ability 증가된Increased , 재조합 , Recombinant PRRSV 의PRRSV 서열분석 Sequencing

높은 면역 반응을 유도하는 것으로 확인된 재조합 바이러스인 CBP5 및 CBP7의 서열을 분석하고 분석 결과를 표 3에 나타내었다. The sequences of CBP5 and CBP7, which are confirmed to induce high immune responses, were analyzed and the results are shown in Table 3.

염기서열Base sequence ORF5의 염기서열The nucleotide sequence of ORF5 atgttggggagatgcttgaccgcgggctgttgctcgcgattgctttctttgtggtgtatcgtgccattttgttttgctgcgctcgtcaacgccaacagcaacagcagctctcatcttcagttgatttacaacttgacgctatgtgagctgaatggcacagattggctgaaagacaaatttgattgggcagtggagacttttgtcatctttcccgtgttgactcacattgtctcatatggtgcactcaccactagccatttccttgacacagtcggtctggttactgtgtctaccgccgggttctaccacgggcggtatgttctgagtagcatctacgcggtctgcgctctggccgcattgatttgcttcgtcattaggcttgcgaagaactgcatgtcctggcgctactcttgtaccagatatactaacttccttctggacactaagggcagactctatcgctggcggtcgcccgttatcatagagaaagggggtaaggttgaggtcgaaggtcacctgatcgacctcaaaagagttgtgcttgatggttccgtggcaacccctttaaccagagtttcagcggaacaatggggtcgtctttag(603bp)atgttggggagatgcttgaccgcgggctgttgctcgcgattgctttctttgtggtgtatcgtgccattttgttttgctgcgctcgtcaacgccaacagcaacagcagctctcatcttcagttgatttacaacttgacgctatgtgagctgaatggcacagattggctgaaagacaaatttgattgggcagtggagacttttgtcatctttcccgtgttgactcacattgtctcatatggtgcactcaccactagccatttccttgacacagtcggtctggttactgtgtctaccgccgggttctaccacgggcggtatgttctgagtagcatctacgcggtctgcgctctggccgcattgatttgcttcgtcattaggcttgcgaagaactgcatgtcctggcgctactcttgtaccagatatactaacttccttctggacactaagggcagactctatcgctggcggtcgcccgttatcatagagaaagggggtaaggttgaggtcgaaggtcacctgatcgacctcaaaagagttgtgcttgatggttccgtggcaacccctttaaccagagtttcagcggaacaatggggtcgtctttag (603bp) 서열번호1SEQ ID NO: 1 ORF7의 염기서열The nucleotide sequence of ORF7 atgccaaataacaacggcaagcagcaaaagaaaaagagggggaatggccagccagtcaatcagctgtgccagatgctgggtaagatcatcgcccagcaaaaccagtccagaggcaagggaccggggaagaaaattaagaataaaaacccggagaagccccattttcctctagcgactgaagatgacgtcaggcatcacttcacccctagtgagcggcaattgtgtctgtcgtcgatccagactgcctttaaccagggcgctggaacctgtaccctatcagattcaggtaggataagttacactgtggagtttagtttgccgacgcatcatactgtgcgcctgatccgcgtcacagcgccatcatcagcgtaa(372bp)atgccaaataacaacggcaagcagcaaaagaaaaagagggggaatggccagccagtcaatcagctgtgccagatgctgggtaagatcatcgcccagcaaaaccagtccagaggcaagggaccggggaagaaaattaagaataaaaacccggagaagccccattttcctctagcgactgaagatgacgtcaggcatcacttcacccctagtgagcggcaattgtgtctgtcgtcgatccagactgcctttaaccagggcgctggaacctgtaccctatcagattcaggtaggataagttacactgtggagtttagtttgccgacgcatcatactgtgcgcctgatccgcgtcacagcgccatcatcagcgtaa (372bp) 서열번호2SEQ ID NO: 2

<110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property <130> 1-120 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 603 <212> DNA <213> Artificial Sequence <220> <223> open reading frame 5(ORF 5) <400> 1 atgttgggga gatgcttgac cgcgggctgt tgctcgcgat tgctttcttt gtggtgtatc 60 gtgccatttt gttttgctgc gctcgtcaac gccaacagca acagcagctc tcatcttcag 120 ttgatttaca acttgacgct atgtgagctg aatggcacag attggctgaa agacaaattt 180 gattgggcag tggagacttt tgtcatcttt cccgtgttga ctcacattgt ctcatatggt 240 gcactcacca ctagccattt ccttgacaca gtcggtctgg ttactgtgtc taccgccggg 300 ttctaccacg ggcggtatgt tctgagtagc atctacgcgg tctgcgctct ggccgcattg 360 atttgcttcg tcattaggct tgcgaagaac tgcatgtcct ggcgctactc ttgtaccaga 420 tatactaact tccttctgga cactaagggc agactctatc gctggcggtc gcccgttatc 480 atagagaaag ggggtaaggt tgaggtcgaa ggtcacctga tcgacctcaa aagagttgtg 540 cttgatggtt ccgtggcaac ccctttaacc agagtttcag cggaacaatg gggtcgtctt 600 tag 603 <210> 2 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> open reading frame 7(ORF 7) <400> 2 atgccaaata acaacggcaa gcagcaaaag aaaaagaggg ggaatggcca gccagtcaat 60 cagctgtgcc agatgctggg taagatcatc gcccagcaaa accagtccag aggcaaggga 120 ccggggaaga aaattaagaa taaaaacccg gagaagcccc attttcctct agcgactgaa 180 gatgacgtca ggcatcactt cacccctagt gagcggcaat tgtgtctgtc gtcgatccag 240 actgccttta accagggcgc tggaacctgt accctatcag attcaggtag gataagttac 300 actgtggagt ttagtttgcc gacgcatcat actgtgcgcc tgatccgcgt cacagcgcca 360 tcatcagcgt aa 372 <110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Porcine Reproductive and Respiratory Syndrome Virus having          enhanced immune-inducing property <130> 1-120 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 603 <212> DNA <213> Artificial Sequence <220> <223> open reading frame 5 (ORF 5) <400> 1 atgttgggga gatgcttgac cgcgggctgt tgctcgcgat tgctttcttt gtggtgtatc 60 gtgccatttt gttttgctgc gctcgtcaac gccaacagca acagcagctc tcatcttcag 120 ttgatttaca acttgacgct atgtgagctg aatggcacag attggctgaa agacaaattt 180 gattgggcag tggagacttt tgtcatcttt cccgtgttga ctcacattgt ctcatatggt 240 gcactcacca ctagccattt ccttgacaca gtcggtctgg ttactgtgtc taccgccggg 300 ttctaccacg ggcggtatgt tctgagtagc atctacgcgg tctgcgctct ggccgcattg 360 atttgcttcg tcattaggct tgcgaagaac tgcatgtcct ggcgctactc ttgtaccaga 420 tatactaact tccttctgga cactaagggc agactctatc gctggcggtc gcccgttatc 480 atagagaaag ggggtaaggt tgaggtcgaa ggtcacctga tcgacctcaa aagagttgtg 540 cttgatggtt ccgtggcaac ccctttaacc agagtttcag cggaacaatg gggtcgtctt 600 tag 603 <210> 2 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> open reading frame 7 (ORF 7) <400> 2 atgccaaata acaacggcaa gcagcaaaag aaaaagaggg ggaatggcca gccagtcaat 60 cagctgtgcc agatgctggg taagatcatc gcccagcaaa accagtccag aggcaaggga 120 ccggggaaga aaattaagaa taaaaacccg gagaagcccc attttcctct agcgactgaa 180 gatgacgtca ggcatcactt cacccctagt gagcggcaat tgtgtctgtc gtcgatccag 240 actgccttta accagggcgc tggaacctgt accctatcag attcaggtag gataagttac 300 actgtggagt ttagtttgcc gacgcatcat actgtgcgcc tgatccgcgt cacagcgcca 360 tcatcagcgt aa 372

Claims (14)

VR2332에 서열번호 1로 표시되는 ORF(open reading frame) 5 및 서열번호 2로 표시되는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된, 면역유도능이 증가된 돼지생식기호흡기증후군 바이러스 (Porcine Reproductive and Respiratory Syndrome Virus; PRRSV).Porcine Reproductive and Respiratory Viruses (VR2332), in which at least one base sequence selected from ORF (open reading frame) 5 represented by SEQ ID NO: 1 and ORF7 represented by SEQ ID NO: 2 is introduced into VR2332, Syndrome Virus; PRRSV). 삭제delete 삭제delete 제1항에 있어서,
상기 VR2332에 서열번호 1로 표시되는 ORF(open reading frame) 5 및 서열번호 2로 표시되는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된 면역유도능이 증가된 PRRSV는 사이토카인의 분비를 증가시키는 바이러스임을 특징으로 하는,면역유도능이 증가된 PRRSV.The method according to claim 1,
The PRRSV with increased immunoreactivity and at least one base sequence selected from ORF (open reading frame) 5 represented by SEQ ID NO: 1 and ORF 7 represented by SEQ ID NO: 2 is introduced into VR2332 is a virus that increases cytokine secretion Lt; RTI ID = 0.0 &gt; PRRSV. &Lt; / RTI &gt; VR2332에 서열번호 1로 표시되는 ORF5 및 서열번호 2로 표시되는 ORF 7 중에서 선택된 1종 이상의 염기 서열을 도입하는 단계를 포함하는 것을 특징으로 하는, PRRSV의 면역유도능을 증가시키는 방법.Introducing at least one base sequence selected from ORF5 represented by SEQ ID NO: 1 and ORF7 represented by SEQ ID NO: 2 into VR2332. 삭제delete 제1항의 서열번호 1로 표시되는 ORF(open reading frame) 5 및 서열번호 2로표시되는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된 VR2332를 유효성분으로 포함하는, 돼지 생식기호흡기 증후군(PRRS) 예방용 백신 조성물.(PRRS) comprising, as an active ingredient, VR2332 having at least one base sequence selected from ORF (open reading frame) 5 represented by SEQ ID NO: 1 and ORF7 represented by SEQ ID NO: 2, Vaccine composition. 제7항에 있어서,
상기 백신 조성물은 약리학적으로 허용가능한 담체, 희석제, 애주번트로 이루어진 군으로부터 선택된 1종 이상을 추가로 포함하는, 돼지 생식기호흡기 증후군(PRRS) 예방용 백신 조성물.8. The method of claim 7,
Wherein the vaccine composition further comprises at least one member selected from the group consisting of a pharmacologically acceptable carrier, diluent, and adjuvant. 제8항에 있어서,
상기 애주번트는 프로인트 완전애주번트, 프로인트 불완전애주번트, 사포닌미네랄 젤, 계면활성제, 플루론 폴리올, 다가음이온, 펩타이드, 오일, 탄화수소 에멀전, 키홀림펫 헤모시아닌 및 디니트로페놀로 이루어진 군으로부터 선택된 1종 이상인 것을 특징으로 하는, 돼지 생식기호흡기 증후군(PRRS) 예방용 백신 조성물.9. The method of claim 8,
The adjuvant may be selected from the group consisting of Freund's complete adjuvant, Freund's imperfect adjuvant, saponin mineral gel, surfactant, pluronic polyol, polyvalent anion, peptide, oil, hydrocarbon emulsion, keyhole limpet hemocyanin and dinitrophenol (PRRS) vaccine composition according to claim 1 or 2, wherein the vaccine composition is at least one selected from the group consisting of: 제7항에 있어서,
상기 백신은 생백신, 약독화 백신 및 사독 백신으로 이루어진 군에서 선택된 1종의 백신인 것을 특징으로 하는, 돼지 생식기호흡기 증후군(PRRS) 예방용 백신 조성물.8. The method of claim 7,
Wherein the vaccine is a vaccine selected from the group consisting of a live vaccine, an attenuated vaccine, and a sadox vaccine. 제1항의 VR2332에 서열번호 1로 표시되는 ORF(open reading frame) 5 및 서열번호 2로 표시되는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된 면역유도능이 증가된 PRRSV 또는 이의 항원을 포함하는 PRRS의 진단 키트.A PRRSV having increased immunoreactivity or an antigen thereof, wherein at least one base sequence selected from ORF (open reading frame) 5 represented by SEQ ID NO: 1 and ORF 7 represented by SEQ ID NO: 2 is introduced into VR2332 of claim 1; Of the diagnostic kit. 제1항의 VR2332에 서열번호 1로 표시되는 ORF(open reading frame) 5 및 서열번호 2로 표시되는 ORF 7 중에서 선택된 1종 이상의 염기 서열이 도입된 면역유도능이 증가된 PRRSV 또는 이의 항원을 이용한 항원-항체 반응을 통해 감염될 또는 감염된 세포 내에서 PRRSV를 검출하는 단계를 포함하는 것을 특징으로 하는, PRRSV의 검출방법.An antigen-presenting cell using PRRSV or its antigen with increased immunodetection ability introduced with at least one base sequence selected from ORF (open reading frame) 5 represented by SEQ ID NO: 1 and ORF 7 represented by SEQ ID NO: 2 in VR2332 of claim 1, And detecting PRRSV in the infected or infected cells through an antibody reaction. 제12항에 있어서, 상기 항원-항체 반응은 조직면역염색, 방사능면역분석법 (RIA), 효소면역분석법 (ELISA), 웨스턴블럿(Western Blotting), 면역침전분석법 (Immunoprecipitation Assay), 면역확산분석법(Immunodiffusion Assay), 보체고정분석법(Complement Fixation Assay), FACS(Fluorescence-activated cell sorter) 및 단백질칩(protein chip) 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법을 이용하여 수행하는 것을 특징으로 하는, PRRSV의 검출방법.The method of claim 12, wherein the antigen-antibody reaction is selected from the group consisting of tissue immunostaining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assay, immunodiffusion assay Wherein the detection is carried out using at least one method selected from the group consisting of Assay, Complement Fixation Assay, Fluorescence-activated cell sorter (FACS) and protein chip analysis. Way. 제7항의 백신 조성물을 돼지에 투여하여 PRRSV 감염 질환을 예방하는 방법.A method for preventing a PRRSV infection disease by administering the vaccine composition of claim 7 to a pig.
KR1020120111953A 2012-10-09 2012-10-09 Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property KR101430223B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120111953A KR101430223B1 (en) 2012-10-09 2012-10-09 Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120111953A KR101430223B1 (en) 2012-10-09 2012-10-09 Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property

Publications (2)

Publication Number Publication Date
KR20140045774A KR20140045774A (en) 2014-04-17
KR101430223B1 true KR101430223B1 (en) 2014-09-25

Family

ID=50653069

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120111953A KR101430223B1 (en) 2012-10-09 2012-10-09 Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property

Country Status (1)

Country Link
KR (1) KR101430223B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110894243A (en) * 2019-12-16 2020-03-20 中国农业大学 Porcine reproductive and respiratory syndrome virus chimeric antigen and colloidal gold immunochromatographic test strip for detecting porcine reproductive and respiratory syndrome virus antibody

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102276341B1 (en) * 2020-01-29 2021-07-12 주식회사 바이오포아 Method for producing European porcine reproductive and respiratory syndrome virus and use thereof
WO2021154055A1 (en) * 2020-01-29 2021-08-05 주식회사 바이오포아 Mutant strain of european porcine reproductive and respiratory syndrome virus and vaccine composition comprising same

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010012337A (en) * 1997-05-06 2001-02-15 스티칭 디엔스트 랜드보위쿤디그 온데조에크 Prrsv antigenic sites identifying peptide sequences of prrs virus for use in vaccines or diagnostic assays
KR20070086084A (en) * 2004-11-19 2007-08-27 인터벳 인터내셔널 비.브이. Porcine reproductive and respiratory syndrome virus strains and compositions
KR20110068980A (en) * 2008-08-25 2011-06-22 베링거잉겔하임베트메디카인코퍼레이티드 Vaccine against highly pathogenic porcine reproductive and respiratory syndrome (hp prrs)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010012337A (en) * 1997-05-06 2001-02-15 스티칭 디엔스트 랜드보위쿤디그 온데조에크 Prrsv antigenic sites identifying peptide sequences of prrs virus for use in vaccines or diagnostic assays
KR20070086084A (en) * 2004-11-19 2007-08-27 인터벳 인터내셔널 비.브이. Porcine reproductive and respiratory syndrome virus strains and compositions
KR20110068980A (en) * 2008-08-25 2011-06-22 베링거잉겔하임베트메디카인코퍼레이티드 Vaccine against highly pathogenic porcine reproductive and respiratory syndrome (hp prrs)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF GENERAL VIROLOGY. 1998, Vol. 79, pp. 989-999. *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110894243A (en) * 2019-12-16 2020-03-20 中国农业大学 Porcine reproductive and respiratory syndrome virus chimeric antigen and colloidal gold immunochromatographic test strip for detecting porcine reproductive and respiratory syndrome virus antibody
CN110894243B (en) * 2019-12-16 2021-07-13 中国农业大学 Porcine reproductive and respiratory syndrome virus chimeric antigen and colloidal gold immunochromatographic test strip for detecting porcine reproductive and respiratory syndrome virus antibody

Also Published As

Publication number Publication date
KR20140045774A (en) 2014-04-17

Similar Documents

Publication Publication Date Title
Lunney et al. Porcine reproductive and respiratory syndrome virus (PRRSV): pathogenesis and interaction with the immune system
Weesendorp et al. Comparative analysis of immune responses following experimental infection of pigs with European porcine reproductive and respiratory syndrome virus strains of differing virulence
Frydas et al. Different clinical, virological, serological and tissue tropism outcomes of two new and one old Belgian type 1 subtype 1 porcine reproductive and respiratory virus (PRRSV) isolates
US20110117129A1 (en) Vaccine Against Highly Pathogenic Porcine Reproductive and Respiratory Syndrome (HP PRRS)
CZ412797A3 (en) Vaccines of vital prrs virus exhibiting low pathogenity and process for preparing such vaccines
KR101502360B1 (en) Novel domestic-type porcine reproductive and respiratory syndrome virus
US8906385B2 (en) Interferon-inducing porcine reproductive and respiratory syndrome virus isolate
Beura et al. Identification of amino acid residues important for anti-IFN activity of porcine reproductive and respiratory syndrome virus non-structural protein 1
Gomez-Laguna et al. Changes in lymphocyte subsets and cytokines during European porcine reproductive and respiratory syndrome: increased expression of IL-12 and IL-10 and proliferation of CD4− CD8high
KR101430223B1 (en) Porcine Reproductive and Respiratory Syndrome Virus having enhanced immune-inducing property
Sun et al. Attempts to enhance cross-protection against porcine reproductive and respiratory syndrome viruses using chimeric viruses containing structural genes from two antigenically distinct strains
Fontanella et al. An interferon inducing porcine reproductive and respiratory syndrome virus vaccine candidate elicits protection against challenge with the heterologous virulent type 2 strain VR-2385 in pigs
Oh et al. Comparison of 4 commercial modified-live porcine reproductive and respiratory syndrome virus (PRRSV) vaccines against heterologous Korean PRRSV-1 and PRRSV-2 challenge
Ren et al. Enhanced immune responses in pigs by DNA vaccine coexpressing GP3 and GP5 of European type porcine reproductive and respiratory syndrome virus
Senthilkumar et al. Pathogenic characterization of porcine reproductive and respiratory syndrome virus of Indian origin in experimentally infected piglets
MXPA02007198A (en) Recombinant attenuation of prrsv.
김한진 Pathological and Immunological Evaluation of Porcine Reproductive and Respiratory Syndrome Modified-Live Virus and Subunit Vaccines
SINN PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS IN AUSTRIA–CHARACTERIZATION OF CURRENT FIELD STRAINS
KR20240051388A (en) Korean Porcine reproductive and respiratory syndrome virus and uses thereof
Madapong et al. Safety of PRRSV-2 Vaccines Vaccination via Intramuscularly or Intradermally Routes and Evaluation of PRRSV Transmission and the Induction of Immune Response Between Needle-Free and Conventional Needle
Madapong Porcine reproductive and respiratory syndrome virus: genetic diversity, pathogenesis and modified-live vaccines
강희석 Comparative Efficacy of Two PRRSV and PCV2 Vaccines
Mebumroong The effect of maternally-derived antibodies against antibody production in vaccinated piglets with modified-live porcine reproductive and respiratory syndrome virus vaccines
Mötz Porcine Reproductive and Respiratory Syndrome Virus CD8⁺ T cell epitopes and recombination mechanisms
Zakhartchouk et al. Porcine Reproductive and Respiratory Syndrome Virus

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
FPAY Annual fee payment

Payment date: 20170719

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180717

Year of fee payment: 5