KR101411788B1 - Construction method of bacterial host for producing functional protein - Google Patents

Abstract

The present invention provides a method for producing a strain library for producing a functional protein, a strain library for producing a functional protein prepared using the library, and a method for producing a functional protein using the library. The library prepared by the method for producing a strain library for producing a functional protein of the present invention provides various DNA translation initiation and / or elongation rates, It is expected to be able to be used for the mass production of various functional proteins using the above-mentioned library, since it is possible not only to solve the problems of inclusion body formation, but also to increase the protein production amount. In particular, Since the functional protein is produced without changing the primary structure, it is expected to be a source technology that can be applied to mass production of biosimilar drugs because it does not cause stability problem due to protein structural change.

Description

TECHNICAL FIELD The present invention relates to a method for producing a microorganism host cell for producing a functional protein,

The present invention provides a method for producing a strain library for producing a functional protein, a strain library for producing a functional protein prepared using the library, and a method for producing a functional protein using the library.

By the development of genetic engineering, it became possible to produce recombinant insulin from E. coli in the mid-1980s. Since then, it has been able to mass-produce recombinant proteins that could not be obtained only by extracting directly from nature. .

Escherichia coli has a faster growth rate than other host cells for recombinant protein production and is well known for its genetic information, making it easy to genetically modify and utilize. In addition, since it is easy to scale up, it has been widely used for production of recombinant medicinal proteins such as insulin and growth hormone. However, when a complex pharmaceutical protein is produced using Escherichia coli, the protein is folded in E. coli and is produced in the form of an inclusion body or a post-transformation modification such as glycosylation ) Does not occur, and it is often impossible to acquire an active protein. Because of these problems, recombinant medicinal proteins are produced using mammalian cells, which have low protein productivity and relatively high culture unit price, instead of cheap and easily available coliforms.

Basically, in Escherichia coli, there is no post-translational modification such as glycation reaction. Therefore, problems associated with late modification can not be solved. However, since only a large number of pharmaceutical proteins that do not require late modification are present, It is expected that mass production will be possible at a lower cost than a method of producing protein using animal cells. Therefore, various attempts have been made to solve the protein folding problem, but it is still not enough to be used industrially.

Protein folding is the formation of thermodynamically synthesized polypeptides that stabilize through the folding structure into a low energy state and eventually become active. Protein production is accomplished through a translation process in which the amino acids corresponding to the codon sequence of the RNA are sequenced in a ribosome to form a polypeptide chain. During the translation process, the exogenously exposed portion of the polypeptide is synthesized from the ribosome and folded for stabilization. The folding structure at this time is the number of peptides involved in folding, the time taken for folding, and the effect of forming the polypeptide It is known to be determined by the materials that can be found. However, the ability to produce proteins with the same folding structure in spite of the large number of proteins, DNA, and RNA as well as a wide variety of other substances in a very tight space inside the cell can be translated rather than other external factors (or substances) It is believed that the peptide involved in the folding, or the time given when the peptide forms the folding structure in the process itself, will be more important. Ultimately, these factors are related to the rate of synthesis of the protein. Therefore, the folding structure of the protein will be determined according to the rate at which the ribosome binds to the RNA, moves through the RNA, and produces the polypeptide (hereinafter, this process is referred to as ribosome traffic). Accordingly, the present inventors have made efforts to regulate the initiation and elongation speed of translation by regulating ribosomal trafficking, thereby forming a folding structure of the recombinant protein, thereby making it possible to produce a functional recombinant protein using Escherichia coli.

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made in order to solve the problems of the prior art as described above, and it is an object of the present invention to provide a method for producing a library of functional proteins for regulating ribosome traffic in E. coli, And a method for producing a functional protein using the library, and the like.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

A) inserting a cI repressor gene into an E. coli chromosome; b) removing the fusA gene in the inserted E. coli chromosome to prepare a mutant strain; c) transforming said mutant strain with a first vector comprising a lambda promoter, a fusA gene tagged with an SsrA protein, and a lacI gene to produce a transforming strain; d) transforming the transformed strain with a second vector comprising a fusA gene having at least one mutation of a Lac promoter and a base sequence; And e) transforming the strain transformed with the first vector and the second vector with a third vector comprising a promoter comprising a 5 'UTR (UnTranslated Region) sequence and a gene encoding a functional protein , A method for producing a strain library for producing a functional protein is provided.

In one embodiment of the present invention, the step of inserting the cI repressor gene is characterized in that the Lac operon in the E. coli chromosome is converted into a cI transcription repressor gene.

In another embodiment of the present invention, the cI repressor gene is characterized in that the cI repressor gene comprises the nucleotide sequence of SEQ ID NO: 17.

In another embodiment of the present invention, the fusA gene is characterized by coding a mutation elongation factor G. [

In another embodiment of the present invention, the fusA gene is characterized by comprising the nucleotide sequence of SEQ ID NO: 18.

In another embodiment of the present invention, the lacI gene is characterized in that it comprises the nucleotide sequence of SEQ ID NO: 20.

In yet another embodiment of the present invention, the 5 'UTR sequence is characterized by comprising the nucleotide sequence of SEQ ID NO: 14.

In another embodiment of the present invention, the 5 'UTR sequence is characterized in that the nucleotide sequence of SEQ ID NO: 14 is one or more mutated.

In another embodiment of the present invention, the SsrA protein is a proteolytic marker, and the SsrA protein is encoded by DNA consisting of the nucleotide sequence of SEQ ID NO: 21.

In still another embodiment of the present invention, the functional protein is a protein obtained by culturing and isolating and purifying a strain for industrial or medical purposes.

In another embodiment of the present invention, the functional protein is selected from the group consisting of etanercept, epoetin alpha, infliximab, interferon alpha, insulin lispro, Filgrastim, already imiglucerase, glatiramer acetate, rituximab, pegfilgrastim, insulin gratim, adalimumab, ), Trastuzumab, bevacizumab, ranibizumab, insulin, growth hormone, tumor necrosis factor-alpha, interleukin-7, -7), insulin-like growth factor 2, interferon gamma, interferon alpha, interleukin-2, osteogenic protein, The recombinant plasminogen activator ), Bone morphogenetic protein 2, antifungal peptide, tissue plasminogen activator, immunoglobulin G, erythropoietin, granulocyte colony stimulating factor Granulocyte-macrophage stimulating factor, granulocyte-colony stimulating factor, muromomab, abciximab, daclizumab, basiliximab, Palivizumab, ibritumomab, omalizumab, efalizumab, tositumomab, cetuximab, natalizumab, alkalinity, and the like. (LFT), cellulose binding domain, cholera toxin B, organophosphohydrolase, and phosphatidylserine (LPS), which are known to be involved in the pathogenesis of cancer. , Calcio Is characterized in that it is selected from the group consisting of calcitonin, blood coagulation factors, hirudin, and monoclonal antibody 5T4.

The present invention also provides a strain library for producing a functional protein, wherein the strain comprises a first vector comprising a lambda promoter, a fusA gene and a lacI gene, a Lac promoter and a fusA gene having at least one mutated base sequence A fusA gene in the chromosome, which is transformed with a third vector comprising a second vector comprising a gene and a gene encoding a promoter and a functional protein comprising a 5 'UTR (UnTranslated Region) sequence, Wherein the Escherichia coli is a Escherichia coli inserted with a factor gene.

The present invention also provides a strain library for producing a functional protein, wherein the strain comprises a first vector comprising a lambda promoter, a fusA gene and a lacI gene, a Lac promoter and a fusA gene having at least one mutated base sequence A second vector comprising a gene and a 5 ' UTR (UnTranslated Region) sequence having at least one base sequence mutated, and a third vector comprising a gene encoding a functional protein, a chromosomal fusA gene Is removed, and the cI transcription repressor gene is inserted into E. coli.

In one embodiment of the present invention, the strain library for producing a functional protein can regulate the initiation and / or elongation rate of translation by regulating ribosome traffic so that the folding structure of the recombinant protein And the like.

The present invention also provides a method for producing a functional protein using the strain library for producing the functional protein.

The library prepared by the method for producing a strain library for producing a functional protein of the present invention provides various DNA translation initiation and / or elongation rates, It is expected to be able to be used for the mass production of various functional proteins using the above-mentioned library, since it is possible not only to solve the problems of inclusion body formation, but also to increase the protein production amount. In particular, Since the functional protein is produced without changing the primary structure, it is expected to be a source technology that can be applied to mass production of biosimilar drugs because it does not cause stability problem due to protein structural change.

FIG. 1 is a schematic diagram showing a genetic circuit of a functional protein production method through ribosome traffic regulation.
Fig. 2 is a schematic diagram showing a vector map of the fusA mutant gene library.
3 is a schematic diagram showing a vector map of a 5'UTR mutant gene library in a simplified manner.
4 is a graph showing a result of measuring the growth rate with the IPTG treatment time.
5 is a graph showing a result of measuring the growth rate according to the IPTG treatment concentration.
FIG. 6 is a graph showing the results of measurement of the amount of protein expression when the rate of initiation was controlled. FIG.
FIG. 7 is a graph showing the results of measuring the amount of protein expression when ribosomal traffic is regulated. FIG.
8 is a graph showing the results of measurement of the amount of protein expression when ribosomal traffic was regulated.

The present inventors have completed the present invention by studying a method for producing a functional protein by controlling the ribosome traffic of E. coli so that the production cost of the functional protein can be reduced and mass production can be achieved.

A) inserting a cI repressor gene into an E. coli chromosome; b) removing the fusA gene in the inserted E. coli chromosome to prepare a mutant strain; c) transforming said mutant strain with a first vector comprising a lambda promoter, a fusA gene tagged with an SsrA protein, and a lacI gene to produce a transforming strain; d) transforming the transformed strain with a second vector comprising a fusA gene having at least one mutation of a Lac promoter and a base sequence; And e) transforming the strain transformed with the first vector and the second vector with a third vector comprising a promoter comprising a 5 'UTR (UnTranslated Region) sequence and a gene encoding a functional protein A method for producing a strain library for producing a functional protein is provided.

The functional protein is any protein having specific functions such as plasma protein, muscle protein, enzyme, antibody, and hormone, and is not limited as long as it is a protein used for a specific purpose such as industrial or medical. Preferably it is a protein that does not require modification. More preferably at least one selected from the group consisting of etanercept, epoetin alpha, infliximab, interferon alpha, insulin lispro, filgrastim, paclitaxel, imiglucerase, glatiramer acetate, rituximab, pegfilgrastim, insulin gratim, adalimumab, trastuzumab, It has been shown to be effective in the treatment of diabetic retinopathy, such as bevacizumab, ranibizumab, insulin, growth hormone, tumor necrosis factor-alpha, interleukin-7, insulin-like growth factor 2, interferon gamma, interferon alpha, interleukin-2, osteogenic protein, recombinant plasminogen activator ), Bone morphogenetic protein 2 (Bone morphogenetic protein 2, an antifungal peptide, tissue plasminogen activator, immunoglobulin G, erythropoietin, granulocyte-macrophage stimulating factor, , Granulocyte-colony stimulating factor, muromomab, abciximab, daclizumab, basiliximab, palivizumab, evei, A drug such as ibritumomab, omalizumab, efalizumab, tositumomab, cetuximab, natalizumab, alkaline phosphatase (PhoA ), Levan fructotransferase (LFT), cellulose binding domain, cholera toxin B, organophosphohydrolase, calcitonin, blood coagulation factor (blood coagulation factors, hirudin, monoclonal antibody 5T4, and the like.

The translation process consists largely of initiation, elongation, and termination stages. The initiation and extension stages affect the formation of polypeptides during translation and the formation of folding structures. Therefore, the present inventors made a strain library for the production of functional proteins capable of regulating the rate of initiation and elongation of Escherichia coli to produce Escherichia coli suitable for the production of each functional protein. However, since the initiation and extension steps of the translation process are influenced by various molecules present in E. coli and are very precisely controlled, it is very difficult to control the initiation and extension rates as desired, Because libraries have a very stable structure, library production is not easy.

Therefore, in order to solve the above problems, the present inventors have found that the fusA gene (SEQ ID NO: 18) coding for the elongation factor G (EF-G) in the E. coli chromosome is removed and the The ssrA gene (SEQ ID NO: 21) was tagged to the fusA gene so that the normal extension factor G could be easily degraded. Thus, the strain library for production of functional bandages of the present invention was prepared so as to be regulated by initiation and / or elongation rate converted by mutation.

In addition, the 5'UTR sequence (SEQ ID NO: 14) was used to regulate ribosomal traffic in the initiation process. The 5'UTR sequence forms a specific RNA secondary structure in the initiation step, affecting the ribosome binding to the RNA. Since the RNA secondary structure of the 5'UTR is modified by the sequence, a library having different initiation rates can be prepared by applying various sequences. Therefore, the present inventors produced a third vector library containing a mutated 5 ' UTR sequence in which a normal 5 ' UTR sequence or at least one base sequence was mutated using a polymerase chain reaction (PCR). There is no limitation on the method of preparing the mutated 5 ' UTR sequence. Also, there is no limit to the position, number, and / or type of the base sequence mutation, since the RNA secondary structure may be modified to change the initiation rate if at least one of the optional base sequences of the 5'UTR is mutated.

The fusA gene (SEQ ID NO: 18) encoding the elongation factor G (EF-G) was used to regulate the ribosome traffic during the extension process. The extension factor G is a factor that helps the ribosome in the extension step to bind the new amino acid to the existing polypeptide chain and move to the next codon sequence. Therefore, the present inventors produced various fusA mutant libraries through error prone PCR to produce extension factor G mutants having different extension rates. In order to regulate ribosomal traffic using mutant EF-G, the original EF-G present in Escherichia coli should be removed. Since E. coli is an essential protein necessary for survival, when Escherichia coli is grown through a genetic circuit, When EF-G was expressed and the recombinant protein was produced, a system was designed to control the expression of mutant EF-G. The first vector was prepared by tagging the protein degradation marker SsrA with the fusA gene encoding EF-G and introducing it into a vector whose expression was regulated by a lambda promoter. A second vector was prepared by introducing a fusA mutant gene in which at least one base sequence was mutated into a vector whose expression was regulated by a Lac promoter. There is no limitation on the method for producing the fusA mutant gene. There is also no restriction on the position, number, and / or species of the base sequence mutation, since the elongation rate can be changed if at least one of the base sequences of the fusA gene is mutated. Then, the original fusA gene on the E. coli chromosome was removed, and the cI transcription inhibitor gene was transformed into the first vector, the second vector and the third vector by preparing an inserted mutant strain . The strain produced by this method is able to regulate the expression rate of the fusA normal gene by IPTG (isopropyl beta-D-1-thiogalactopyranoside), and the fusA mutant gene can be expressed instead to regulate the extension rate. The cI transcription repressor gene may be inserted into the E. coli chromosome by substituting for a gene encoding a protein that is not essential for survival in the E. coli chromosome, or may be inserted at an arbitrary position. Preferably, the Lac operon in the E. coli chromosome can be converted into a cI transcription inhibitory factor gene.

In addition, a gene encoding a functional protein may be added to a vector having various initiation speeds in the library having various extension rates to transform the functional protein through ribosome traffic regulation with various initiation and / A strain library for production can be prepared. A schematic diagram of a genetic circuit of the strain library for the production of the functional protein is shown in FIG.

In one embodiment of the present invention, it has been confirmed that the rate of initiation of DNA translation can be increased to increase the yield of functional protein (see Example 3). In another embodiment, the initiation and / (See Example 4). ≪ tb > < TABLE >

Through the above-mentioned results, it was found that when the above-mentioned library was introduced into Escherichia coli to construct a production system having various rates of initiation and elongation, the recombinant protein produced in the form of the inclusion body of the present invention, It is expected to be available as a production system. Accordingly, the present invention provides a strain library for producing a functional protein, wherein the strain comprises a first vector comprising a lambda promoter, a fusA gene, and a lacI gene, a lac promoter and a fusA gene having at least one mutated base sequence A promoter comprising a 5 ' UTR (UnTranslated Region) sequence in which at least one of a normal 5 ' UTR (UnTranslated Region) sequence or a base sequence is mutated, and a gene encoding a functional protein 3 vector, wherein the fusA gene in the chromosome is removed, and the cI transcription repressor gene is inserted into the E. coli. The present invention also provides a method for producing a functional protein using the strain library for producing the functional protein.

Also, by using the method for producing a functional protein-producing strain library of the present invention, a gene coding for extension factor G (elongation factor G, EF-G) and / or 5 ' Since it is possible to prepare a strain library for the production of a functional protein that regulates translation initiation and / or elongation rate by modulating ribosome traffic through alteration of the UTR sequence, There is no limitation on the kind of the host cell, but it is preferably Escherichia coli.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Example  1. Preparation of E. coli for functional protein production

1-1. cI repressor  Introduction of genes into chromosomes

The cI transcription repressor gene ( cI ), which regulates the expression of the lambda promoter repressor gene, SEQ ID NO: 17) was introduced into the chromosome of Escherichia coli by amplifying and amplifying the cI repressor gene by PCR (polymerase chain reaction) in a lambda phage, Lac promoter) sequence (SEQ ID NO: 1) and the KpnI and SacI restriction enzymes (restriction enzyme primer (Plac_cI_F that contains the recognition sequence of a): ACATATGATAAATGTGAGCGGATAACATTGACATTGTGAGCGGATAACAAGATACTGAGCACATCAGCAGGACGCACTGACCaaagaggagaaaatgagcacaaaaaagaaaccattaacacaagagc (SEQ ID NO: 2), Plac_cI_B: using ACTCGAGtcagccaaacgtctcttcaggcca (SEQ ID NO: 3)) again Respectively. The amplified DNA was introduced into pGEM T easy vector (Promega). The introduced gene was confirmed by DNA sequencing and then a primer (Lac_cI_F: gcggtatggcatgatagcgcccggaagagagtcaattcagggtggtgaatgcgatctgtctatttcgttcatccgaatat (SEQ ID NO: 4) having a homologous sequence at the position of the Lac operon on the E. coli BL21 (DE3) ), Lac_cI_R: Agagctcaaaaaaaaccccgccctgtcaggattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgc (SEQ ID NO: 5)). The amplified DNA was introduced into the E. coli chromosome using the Red / ET recombination system.

1-2. Production of recombinant vector

Using (TTCGACTTAAGCATTATGCGGCCGCAAGCTTGTCGACCTGCAGGC GCGCCGAGCTCGAATTCGGATCCTGGcaggagtcgcataagggagagcgtcgagatc (SEQ ID NO: 7) pACYC_RE_P_F:: ATACATATGGCAGATCTCAATTGGATATCGGCCGGCCACGC GATCGCTGACGTCGGTACCCTCGAGTCTGccggtaaaccagcaatagacataagcggcta (SEQ ID NO: 6), pACYC_RE_P_B) to produce a vector newly produced by MCS (Multiple cloning ste) primer is the sequence containing the regulated by the lambda promoter The pACYC Duet vector (Novagen) was amplified and isolated except for the T7 promoter and MCS (multiple cloning site) region. The amplified DNA was subjected to blunt end ligation to construct a recombinant vector (pACYC Duet-1). The recombinant vector containing the lambda promoter was constructed by subcloning the prepared vector (pACYCDuet-1) with the kanamycin gene containing the lambda promoter (SEQ ID NO: 19) using BamHI and NotI restriction enzymes.

Using (ggccgagctccgggttactgatgatgaacatggtaccgctgccaccgctgagcaataactagcataa (SEQ ID NO: 9) placF:: ttccGGTCAGT GCGTCCTGCTGATGTGCTCAGTATCTTGTTATCCGCTCACAATGTCAATGTTATCCGCTCACATTTATaatgtaagttagctcactcattaggcaccg (SEQ ID NO: 8), placR) to produce a vector, the primer on the pCDF Duet vector (Novagen) contains the Lac promoter sequence which is controlled by the lock promoter Except for the T7 promoter and MCS (multiple cloning site) region. The amplified DNA was subjected to blunt end ligation to construct a recombinant vector (pCDF Duet-1). Each vector was identified by sequencing.

1-3. fusa  Gene pACYC Duet -1 introduction

In order to control the expression of fusA gene by the lambda promoter, a primer that is the fusA gene contains a recognition sequence for a pET23b UTR sequence and the KpnI and SacI restriction enzymes (Sac1_UTR_fusA_F: agggGAGCTCTCTGTCCCAAGAAGGAGATATTACTatggctcgtacaaca cccatcgcac (SEQ ID NO: 10), Kpn1_UTR_fusA_R: AgtgGGTACCttatttaccacgggcttcaattacggcctg (SEQ ID NO: 11)) was used for amplification from E. coli. The amplified DNA was tagged with the gene encoding the SsrA protein (SEQ ID NO: 21) as a proteolytic marker and inserted into pGEM T easy vector (Promega), followed by sequencing. After cutting with KpnI and SacI restriction enzymes, fusA / pACYC Duet-1 vector was prepared by introducing into pACYC Duet-1 prepared by the method of Example 1-2.

1-4. fusa  Genetic mutation strain production

To prepare a mutant strain in which the fusA gene was removed from the chromosome, the mutant strain in which the cI gene prepared by the method of Example 1-1 was introduced into the chromosome was transformed with the vector prepared by the method of Example 1-3. And the FRT sequence and a kanamycin resistance gene (kanamycin resistance gene) to mold a primer that contains a similar sequence of fusA gene ends of the chromosome using a (Sac1_UTR_fusA_F: AgtgGGTACCttatttaccacgggcttcaattacggcctg (SEQ ID NO: 13): agggGAGCTCTCTGTCCCAAGAAGGAGATATTACTatggctcgtacaacacccatcgcac (SEQ ID NO: 12), Kpn1_UTR_fusA_R) PCR was performed to amplify the DNA. The fusA gene (SEQ ID NO: 18) of the E. coli chromosome was removed using the Red / ET recombination system using the amplified DNA to prepare a fusA gene mutant strain (E. coli BL21 (DE3) cIΔfusA). The fusA mutant strain thus prepared was deposited with the accession number KCTC 12185BP in a Korean collection for type cultures (KCTC).

1-5. fusa  Mutant gene library production

To construct a fusA mutant gene library for regulating the elongation rate of translation, a pGEM T easy vector into which the fusA gene prepared in Example 1-3 was introduced was used as a template and a random mutagenesis kit ( stratagen). The amplified DNA was introduced into pCDF Duet-1 prepared by the method of Example 1-2 after cutting with KpnI and SacI restriction enzymes. The constructed vectors were transformed into Mach T1 cells, and plasmids were extracted to construct the fusA mutant gene library as shown in FIG.

1-6. 5 ' UTR  Mutant gene library production

In order to construct a 5 'UTR (tttaactttaagaagagatatacc (SEQ ID NO: 14)) mutant gene library for regulating the initiation rate of translation, a green fluorescent protein (GFP) gene was inserted into pQE80L, with the primer that contains a UTR sequence randomly and T7 promoter sequences as (random) synthesis (RandomUTR_GFP_F: agagtaatacgactcactataggggaattgtgagcggataacaattttta actttaagaaggagNNNNNNNatggtgagcaagggcgaggag (SEQ ID NO: 15), RandomUTR_PQE_GFP_R: Aagacgaaagggcctcgtgatacg (SEQ ID NO: 16)) to perform a PCR using a 5 'UTR A mutant gene library was constructed. The T7 promoter sequence containing the 5 'UTR mutant gene was inserted into the pQE80L vector into which the GFP gene was inserted to construct a library as shown in FIG.

Example  2. fusa  Measurement of growth rate of E. coli into which a gene is introduced

The E. coli BL21 (DE3) cIΔfusA strain prepared by the method of Example 1-4 was transformed with fusA / pACYC Duet-1 to measure the growth rate of E. coli with fusA gene. The transformed strains were cultured in LB liquid medium for 16 hours and then subcultured at an absorbance of 0.05. The absorbance was measured every 30 minutes with a BioscreenC instrument. At this time, experiments were conducted under various conditions by adjusting IPTG treatment concentration (0, 0.01, 0.05, 0.1, 0.5, and 1 mM) and treatment time (1.5, 2, 2.5, 3 and 3.5 hours). As a control, Escherichia coli BL21 (DE3) strain into which cI gene was introduced was used. The results are shown in Fig. 4 and Fig.

As shown in FIG. 4, in the case of the strain in which the fusA gene was removed from the chromosome, the expression of the fusA gene of the vector was inhibited by IPTG, and the growth rate was decreased as compared with the control. In addition, IPTG was treated irrespective of IPTG treatment time, and growth rate was inhibited from two hours later. The above results indicate that treatment with IPTG results in the expression of cI gene, inhibiting the expression of fusA gene by the produced cI repressor, and decreasing the number of EF-G in the cell after 2 hours and inhibiting growth.

Also, as shown in FIG. 5, it was confirmed that the growth rate was changed according to the IPTG treatment concentration. The strain with the fusA gene removed showed a higher inhibition of growth rate than the control, and the growth rate was further inhibited with increasing IPTG treatment concentration. Also, although not shown in the figure, inhibition of the same growth rate was observed at 0.5 mM or more.

Through the above results, it was confirmed that the expression of the fusA gene can be regulated using IPTG.

Example  3. Construction of mutant strain library with various initiation rates

To construct a mutant strain library having various initiation rates, the fusA / pACYC Duet-1 vector, the fusA mutant gene library, and the normal 5 'UTR and GFP sequences were added to the fusA gene mutant strain prepared by the method of Example 1-4 Were inserted into the LB liquid medium at a ratio of 1/50, cultured for 3 hours, treated with IPTG, and cultured for 6 hours. As a control group, strains containing fusA normal genes were used. The cells were washed twice with phosphate buffered saline buffer (1 mL) and diluted with PBS buffer solution to an absorbance value of 0.05. The diluted cells were screened for strains exhibiting fluorescence within the upper 10% by using FACS instrument, and the selected cells were cultured in the presence of ampicillin (50 ug / mL), streptomycin (50 ug / mL), and chloramphenicol / mL) was obtained by inoculation on LB solid medium. Four strains of the obtained strains were randomly selected and cultured in LB medium, and fluorescence was measured. The results are shown in Fig.

As shown in FIG. 6, it was confirmed that the fluorescence value of the mutant fusA gene was twice or more higher than that of the normal fusA gene used as the control (c). From the above results, it was confirmed that the production of functional protein can be increased by using a mutant strain library having various initiation rates.

Example  4. Production of mutant strain library with various translation speed

To construct a system for producing a functional protein, the fusA / pACYC Duet-1 vector, the fusA mutant gene library, and the 5 'UTR mutant gene library were transfected into the fusA mutant strain produced by the method of Example 1-4 To prepare a functional protein production system having various initiation and elongation process rates. As a control, E. coli BL21 (DE3) was transformed with a pQE80L vector into which a T7 promoter and a GFP gene were inserted. The strains were inoculated in LB liquid medium at 1/50 and cultured for 3 hours, then treated with IPTG and incubated for 6 hours. The cells were washed twice with phosphate buffered saline buffer (1 mL) and diluted with PBS buffer solution to an absorbance value of 0.05. The diluted cells were screened for strains exhibiting fluorescence within the upper 10% by using FACS instrument, and the selected cells were cultured in the presence of ampicillin (50 ug / mL), streptomycin (50 ug / mL), and chloramphenicol / mL) was obtained by inoculation on LB solid medium. The above procedure was repeated twice to isolate strains having high fluorescence values. Since the strains with high fluorescence values decreased the growth rate in media supplemented with IPTG, 66 strains were randomly selected using BioscreenC instrument and cultured in LB medium before fluorescence was measured. The results are shown in Fig.

As shown in FIG. 7, it was confirmed that about 30% or more of the strains increased the production of GFP compared with the control (c), and the nine strains were selected and ampicillin (50 ug / mL), streptomycin streptomycin 50 ug / mL), and chloramphenicol (chloramphenicol 34 ug / mL) for 3 hours, and IPTG was treated for 6 hours, and fluorescence was measured using a Victor apparatus. The results are shown in Fig.

As shown in FIG. 8, it was confirmed that the production of the protein was increased by at least 3.5 times in the mutant strain library having various translation rates as compared with the control group. Through the above results, it was confirmed that the production of various functional proteins can be increased by controlling the ribosomal traffic.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the embodiments described above are in all respects illustrative and not restrictive.

Korea Biotechnology Research Institute KCTC12185BP 20120405

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Construction method of bacterial host for producing functional          protein <130> PB11-09890 <160> 21 <170> Kopatentin 2.0 <210> 1 <211> 75 <212> DNA <213> Escherichia coli Lac promoter <400> 1 ataaatgtga gcggataaca ttgacattgt gagcggataa caagatactg agcacatcag 60 caggacgcac tgacc 75 <210> 2 <211> 128 <212> DNA <213> Artificial Sequence <220> <223> Plac_cI_F <400> 2 acatatgata aatgtgagcg gataacattg acattgtgag cggataacaa gatactgagc 60 acatcagcag gacgcactga ccaaagagga gaaaatgagc acaaaaaaga aaccattaac 120 acaagagc 128 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Plac_cI_B <400> 3 actcgagtca gccaaacgtc tcttcaggcc a 31 <210> 4 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Lac_cI_F <400> 4 gcggtatggc atgatagcgc ccggaagaga gtcaattcag ggtggtgaat gcgatctgtc 60 tatttcgttc atccgaatat 80 <210> 5 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Lac_cI_R <400> 5 agagctcaaa aaaaaccccg ccctgtcagg attccacaca acatacgagc cggaagcata 60 aagtgtaaag cctggggtgc 80 <210> 6 <211> 101 <212> DNA <213> Artificial Sequence <220> <223> pACYC_RE_P_F <400> 6 atacatatgg cagatctcaa ttggatatcg gccggccacg cgatcgctga cgtcggtacc 60 ctcgagtctg ccggtaaacc agcaatagac ataagcggct a 101 <210> 7 <211> 102 <212> DNA <213> Artificial Sequence <220> <223> pACYC_RE_P_B <400> 7 ttcgacttaa gcattatgcg gccgcaagct tgtcgacctg caggcgcgcc gagctcgaat 60 tcggatcctg gcaggagtcg cataagggag agcgtcgaga tc 102 <210> 8 <211> 109 <212> DNA <213> Artificial Sequence <220> <223> placF <400> 8 ttccggtcag tgcgtcctgc tgatgtgctc agtatcttgt tatccgctca caatgtcaat 60 gttatccgct cacatttata atgtaagtta gctcactcat taggcaccg 109 <210> 9 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> placR <400> 9 ggccgagctc cgggttactg atgatgaaca tggtaccgct gccaccgctg agcaataact 60 agcataa 67 <210> 10 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Sac1_UTR_fusA_F <400> 10 aggggagctc tctgtcccaa gaaggagata ttactatggc tcgtacaaca cccatcgcac 60                                                                           60 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Kpn1_UTR_fusA_R <400> 11 agtgggtacc ttatttacca cgggcttcaa ttacggcctg 40 <210> 12 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Sac1_UTR_fusA_F <400> 12 aggggagctc tctgtcccaa gaaggagata ttactatggc tcgtacaaca cccatcgcac 60                                                                           60 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Kpn1_UTR_fusA_R <400> 13 agtgggtacc ttatttacca cgggcttcaa ttacggcctg 40 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> pET vector 5 'UTR <400> 14 tttaacttta agaaggagat atacc 25 <210> 15 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> RandomUTR_GFP_F <400> 15 agagtaatac gactcactat aggggaattg tgagcggata acaattttta actttaagaa 60 ggagnnnnnn natggtgagc aagggcgagg ag 92 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RandomUTR_PQE_GFP_R <400> 16 aagacgaaag ggcctcgtga tacg 24 <210> 17 <211> 714 <212> DNA <213> Bacteriophage cI repressor gene <400> 17 atgagcacaa aaaagaaacc attaacacaa gagcagcttg aggacgcacg tcgccttaaa 60 gcaatttatg aaaaaaagaa aaatgaactt ggcttatccc aggaatctgt cgcagacaag 120 atggggatgg ggcagtcagg cgttggtgct ttatttaatg gcatcaatgc attaaatgct 180 tataacgccg cattgcttgc aaaaattctc aaagttagcg ttgaagaatt tagcccttca 240 atcgccagag aaatctacga gatgtatgaa gcggttagta tgcagccgtc acttagaagt 300 gagtatgagt accctgtttt ttctcatgtt caggcaggga tgttctcacc tgagcttaga 360 acctttacca aaggtgatgc ggagagatgg gtaagcacaa ccaaaaaagc cagtgattct 420 gcattctggc ttgaggttga aggtaattcc atgaccgcac caacaggctc caagccaagc 480 tttcctgacg gaatgttaat tctcgttgac cctgagcagg ctgttgagcc aggtgatttc 540 tgcatagcca gacttggggg tgatgagttt accttcaaga aactgatcag ggatagcggt 600 caggtgtttt tacaaccact aaacccacaga tacccaatga tcccatgcaa tgagagttgt 660 tccgttgtgg ggaaagttat cgctagtcag tggcctgaag agacgtttgg ctga 714 <210> 18 <211> 2115 <212> DNA <213> Escherichia coli fusA gene <400> 18 atggctcgta caacacccat cgcacgctac cgtaacatcg gtatcagtgc gcacatcgac 60 gccggtaaaa ccactactac cgaacgtatt ctgttctaca ccggtgtaaa ccataaaatc 120 ggtgaagttc atgacggcgc tgcaaccatg gactggatgg agcaggagca ggaacgtggt 180 attaccatca cttccgctgc gactactgca ttctggtctg gtatggctaa gcagtatgag 240 ccgcatcgca tcaacatcat cgacaccccg gggcacgttg acttcacaat cgaagtagaa 300 cgttccatgc gtgttctcga tggtgcggta atggtttact gcgcagttgg tggtgttcag 360 ccgcagtctg aaaccgtatg gcgtcaggca aacaaatata aagttccgcg cattgcgttc 420 gttaacaaaa tggaccgcat gggtgcgaac ttcctgaaag ttgttaacca gatcaaaacc 480 cgtctgggcg cgaacccggt tccgctgcag ctggcgattg gtgctgaaga acatttcacc 540 ggtgttgttg acctggtgaa aatgaaagct atcaactgga acgacgctga ccagggcgta 600 accttcgaat acgaagatat cccggcagac atggttgaac tggctaacga atggcaccag 660 aacctgatcg aatccgcagc tgaagcttct gaagagctga tggaaaaata cctgggtggt 720 gaagaactga ctgaagcaga aatcaaaggt gctctgcgtc agcgcgttct gaacaacgaa 780 atcatcctgg taacctgtgg ttctgcgttc aagaacaaag gtgttcaggc gatgctggat 840 gcggtaattg attacctgcc atccccggtt gacgtacctg cgatcaacgg tatcctggac 900 gacggtaaag acactccggc tgaacgtcac gcaagtgatg acgagccgtt ctctgcactg 960 gcgttcaaaa tcgctaccga cccgtttgtt ggtaacctga ccttcttccg tgtttactcc 1020 ggtgtggtta actctggtga taccgtactg aactccgtga aagctgcacg tgagcgtttc 1080 ggtcgtatcg ttcagatgca cgctaacaaa cgtgaagaga tcaaagaagt tcgcgcgggc 1140 gacatcgctg ctgctatcgg tctgaaagac gtaaccactg gtgacaccct gtgtgacccg 1200 gatgcgccga tcattctgga acgtatggaa ttccctgagc cggtaatctc catcgcagtt 1260 gaaccgaaaa ccaaagctga ccaggaaaaa atgggtctgg ctctgggccg tctggctaaa 1320 gaagacccgt ctttccgtgt atggactgac gaagaatcta accagaccat catcgcgggt 1380 atgggcgaac tgcacctcga catcatcgtt gaccgtatga agcgtgaatt caacgttgaa 1440 gcgaacgtag gtaaaccgca ggttgcttac cgtgaaacta tccgccagaa agttaccgat 1500 gttgaaggta aacacgcgaa acagtctggt ggtcgtggtc agtatggtca tgttgttatc 1560 gacatgtacc cgctggagcc gggttcaaac ccgaaaggct acgagttcat caacgacatt 1620 aaaggtggtg taatccctgg cgaatacatc ccggccgttg ataaaggtat ccaggaacag 1680 ctgaaagcag gtccgctggc aggctacccg gtagtagaca tgggtattcg tctgcacttc 1740 ggttcttacc atgacgttga ctcctctgaa ctggcgttta aactggctgc ttctatcgcc 1800 tttaaagaag gctttaagaa agcgaaacca gttctgcttg agccgatcat gaaggttgaa 1860 gtagaaactc cggaagagaa caccggtgac gttatcggtg acttgagccg tcgtcgtggt 1920 atgctcaaag gtcaggaatc tgaagttact ggcgttaaga tccacgctga agtaccgctg 1980 tctgaaatgt tcggatacgc aactcagctg cgttctctga ccaaaggtcg tgcatcatac 2040 actatggaat tcctgaagta tgatgaagcg ccgagtaacg ttgctcaggc cgtaattgaa 2100 gcccgtggta aataa 2115 <210> 19 <211> 48 <212> DNA <213> Bacteriophage Lambda promoter <400> 19 taacaccgtg cgtgttgact attttacctc tggcggtgat aatggttg 48 <210> 20 <211> 1083 <212> DNA <213> Escherichia coli lacI gene <400> 20 gtgaaaccag taacgttata cgatgtcgca gagtatgccg gtgtctctta tcagaccgtt 60 tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa cgcgggaaaa agtggaagcg 120 gcgatggcgg agctgaatta cattcccaac cgcgtggcac aacaactggc gggcaaacag 180 tcgttgctga ttggcgttgc cacctccagt ctggccctgc acgcgccgtc gcaaattgtc 240 gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg tggtggtgtc gatggtagaa 300 cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc ttctcgcgca acgcgtcagt 360 gggctgatca ttaactatcc gctggatgac caggatgcca ttgctgtgga agctgcctgc 420 actaatgttc cggcgttatt tcttgatgtc tctgaccaga cacccatcaa cagtattatt 480 ttctcccatg aagacggtac gcgactgggc gtggagcatc tggtcgcatt gggtcaccag 540 caaatcgcgc tgttagcggg cccattaagt tctgtctcgg cgcgtctgcg tctggctggc 600 tggcataaat atctcactcg caatcaaatt cagccgatag cggaacggga aggcgactgg 660 agtgccatgt ccggttttca acaaaccatg caaatgctga atgagggcat cgttcccact 720 gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa tgcgcgccat taccgagtcc 780 gggctgcgcg ttggtgcgga catctcggta gtgggatacg acgataccga agacagctca 840 tgttatatcc cgccgttaac caccatcaaa caggattttc gcctgctggg gcaaaccagc 900 gtggaccgct tgctgcaact ctctcagggc caggcggtga agggcaatca gctgttgccc 960 gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata cgcaaaccgc ctctccccgc 1020 gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag 1080 tga 1083 <210> 21 <211> 33 <212> DNA <213> Escherichia coli ssRA gene <400> 21 gcagcaaacg acgaaaacta cgctttagca gct 33

Claims (12)

a) inserting a cI repressor gene into the E. coli chromosome;
b) removing the fusA gene in the inserted E. coli chromosome to prepare a mutant strain;
c) transforming said mutant strain with a first vector comprising a lambda promoter, a fusA gene tagged with an SsrA protein, and a lacI gene to produce a transforming strain;
d) transforming the transformed strain with a second vector comprising a fusA gene having at least one mutation of a Lac promoter and a base sequence; And
e) transforming the first vector and the second vector with a third vector comprising a promoter comprising a 5 'UTR (UnTranslated Region) sequence and a gene encoding a functional protein,
Wherein the functional protein is a plasma protein, a muscle protein, an enzyme, an antibody or a hormone. A method for producing a strain library for producing a functional protein. The method according to claim 1,
Wherein the step of inserting the cI repressor gene converts the Lac operon in the E. coli chromosome into a cI transcription repressor gene. The method according to claim 1,
Wherein the cI repressor gene comprises the nucleotide sequence of SEQ ID NO: 17. The method according to claim 1,
Wherein the fusA gene comprises the nucleotide sequence of SEQ ID NO: 18. The method according to claim 1,
Wherein the lacI gene comprises the nucleotide sequence of SEQ ID NO: 20. The method according to claim 1,
Wherein the 5 'UTR sequence comprises the nucleotide sequence of SEQ ID NO: 14. The method according to claim 1,
Wherein the 5 'UTR sequence is characterized in that the nucleotide sequence of SEQ ID NO: 14 is one or more mutated. The method according to claim 1,
Wherein the SsrA protein is a proteolytic marker. The method according to claim 1,
The functional protein may be selected from the group consisting of etanercept, epoetin alpha, infliximab, interferon alpha, insulin lispro, filgrastim, paclitaxel, imiglucerase, glatiramer acetate, rituximab, pegfilgrastim, insulin gratim, adalimumab, trastuzumab, It has been shown to be effective in the treatment of diabetic retinopathy, such as bevacizumab, ranibizumab, insulin, growth hormone, tumor necrosis factor-alpha, interleukin-7, insulin-like growth factor 2, interferon gamma, interferon alpha, interleukin-2, osteogenic protein, recombinant plasminogen activator ), Bone morphogenetic protein 2 (Bone morphogene tic protein 2, antifungal peptide, tissue plasminogen activator, immunoglobulin G, erythropoietin, granulocyte-macrophage stimulating factor ), Granulocyte-colony stimulating factor, muromomab, abciximab, daclizumab, basiliximab, palivizumab, (Ibuprofen), ibuprofen, ibritumomab, omalizumab, efalizumab, tositumomab, cetuximab, natalizumab, alkaline phosphatase, PhoA), levan fructotransferase (LFT), cellulose binding domain, cholera toxin B, organophosphohydrolase, calcitonin, blood coagulation Argument (b lood coagulation factors, hirudin, and monoclonal antibody 5T4. As a strain library for producing a functional protein,
Wherein said strain comprises a first vector comprising a lambda promoter, a fusA gene, and a lacI gene, a second promoter comprising a lac promoter and a fusA gene having at least one base sequence mutated, and a 5 'UTR Wherein the fusA gene in the chromosome is transformed with a third vector comprising a promoter containing the UnTranslated Region sequence and a gene encoding a functional protein and the cI transcription inhibitor gene is inserted,
Wherein the functional protein is a plasma protein, a muscle protein, an enzyme, an antibody, or a hormone. As a strain library for producing a functional protein,
Wherein said strain comprises a first vector comprising a lambda promoter, a fusA gene, and a lacI gene, a second promoter comprising a lac promoter and a fusA gene having at least one base sequence mutated, A fusA gene in a chromosome transformed with a third vector comprising a promoter containing a 5 'UTR (UnTranslated Region) sequence and a gene encoding a functional protein is deleted, and a cI transcription repressor gene inserted E. coli,
Wherein the functional protein is a plasma protein, a muscle protein, an enzyme, an antibody, or a hormone. 11. A method for producing a functional protein using the strain library for producing a functional protein according to claim 10 or claim 11.

Images