KR101401496B1 - Thienopyrimidine derivatives, pharmaceutically acceptable salt thereof preparation method thereof and pharmaceutical composition for prevention or treatment of diabetes-related disease containing the same as an active ingredient - Google Patents

Abstract

The present invention relates to a novel thienopyrimidine derivative and a pharmaceutical composition containing the same as an active ingredient for the prophylaxis or treatment of diabetes and various diabetes related diseases.
The thienopyrimidine derivative of the present invention improves sugar and lipid metabolism by efficiently increasing the activity of GPR119 (G protein-coupled receptor 119), which increases sugar-dependent insulin secretion and inhibits feeding and weight gain, As well as diabetes, obesity, hyperlipidemia, diabetic vascular disease, and the like.

Description

TECHNICAL FIELD [0001] The present invention relates to a thienopyrimidine derivative, a pharmaceutically acceptable salt thereof, a process for preparing the same, and a pharmaceutical composition for preventing or treating diabetes-related diseases containing the same as an active ingredient. prevention or treatment of diabetes-related disease comprising the same as an active ingredient.

The present invention relates to a thienopyrimidine derivative, a pharmaceutically acceptable salt thereof, a process for producing the same, and a pharmaceutical composition for preventing or treating diabetes-related diseases containing the same as an active ingredient.

Diabetes mellitus is a chronic disease in which the pancreas does not secrete insulin or little or no insulin and does not effectively use insulin secreted by the body. It shows hyperglycemia with a high level of blood sugar, cardiovascular disorders, blindness, and renal failure. The number of diabetic patients estimated to be 180 million globally is expected to double to 2030, of which about 90-95% are type 2 diabetic patients. Type 2 diabetes is primarily caused by overgrowth in the liver, insulin resistance, and a process of diminishing insulin secretion due to insulin-deficient pancreatic beta cell failure (Current Opinion in Drug Discovery & Development 2009, 12, 519 -532).

Representative methods for treating type 2 diabetes include non-drug therapies such as diet and exercise therapy, and are largely classified into drug treatment methods other than the non-drug therapy. Drug therapy is usually initiated when drug control methods such as diet and exercise do not achieve the goal of glycemic control and widely prescribed oral drugs can be classified according to the mechanism of action and structural characteristics of the drug, (Current Medical Research and Opinion 2007, 23, 945-952).

Metformin is a biguanide-based drug that acts mainly through the inhibition of glucose production in the liver and the reduction of insulin resistance, and is generally not associated with side effects, but may be induced by lactic acid osis as a potential side effect. (International Journal of Obesity 2008, 32, 61-72). The thiazolidinedione-based drugs include rosiglitazone and pioglitazone as PPARgamma agonists, which act through the improvement of insulin sensitivity and have been reported to exhibit side effects such as edema, weight gain, hepatotoxicity and heart failure (Proceedings of the National Academy of Sciences, United States of America 2009, 106, 18745-18750). Sulfonylurea (sulphonylurea) drugs act in a sugar-independent manner to promote insulin secretion in the beta cells of the pancreas, thus causing hypoglycemia and possibly causing weight gain. The meglitinide-based drugs also have similar mechanism and side effects to sulfonylurea drugs. Alpha-glucosidase inhibitors are used for post-prandial suppression, with adverse effects in the intestine. Insulin and insulin analogs are commonly used in combination with oral medications, which have side effects such as hypoglycemia and weight gain induction and limitations as an injection (Current Opinion in Drug Discovery & Development 2009, 12, 519-532).

In recent years, efforts have been made to develop drugs that can increase insulin secretion in a sugar-dependent manner to address hypoglycemia and weight gain associated with drug therapy for advanced type 2 diabetes (Forecast Insight: Antidiabertics, Datamonitor DMHC2447, 08/2008).

GLP-1 receptor agonists such as exenatide are analogs (GLP-1 mimetics) mimicking GLP-1 rapidly degraded by dipeptidyl peptidase-IV (DPP-IV) It is a drug that promotes glucose-dependent insulin secretion without inhibiting rapid degradation, inhibits glucagon secretion, gastric emptying and appetite, and shows the effect of GLP-1, which has a beta-cell protective effect. Therefore, it does not induce hypoglycemia, shows weight reduction effect, and has HbA1c lowering effect, but it has side effects such as intestinal adverse effects and pancreatitis, and limitations as an injection. On the other hand, DPP-IV inhibitors such as sitagliptin and vildagliptin act by inhibiting the degradation of GLP-1 as an oral drug and exhibit a HbA1c-lowering effect similar to GLP-1 receptor agonist, (Current Opinion in Drug Discovery & Development 2009, 12, 519-532).

In this context, GPR119 is a promising target for the development of type 2 diabetes therapies and is being targeted for intensive research and development by major pharmaceutical companies. In adults, GPR119 is predominantly expressed mainly in the pancreas and intestines and increases glucose-dependent insulin secretion upon activation in pancreatic beta cells, similar to the GLP-1 receptor, and increases GLP-1 and / or GIP (glucose- dependent insulinotropic peptide is known to increase secretion of the corresponding secretion when activated in secretory cells. Unlike the GLP-1 receptor, which is a peptide ligand, GPR119 is a strong and selective ligand, (Endocrinology 2007, 148, 2598-2600; Expert Opinion on Drug Discovery 2008, 3, 403-413; Annual Reports in Medicinal Chemistry 2009, 44, 149-170; Expert Opinion on Therapeutic Patents 2009, 19, 1339-1359; Current Opinion in Drug Discovery & Development 2009, 12, 519-532). Thus, GPR119 is a potential point of implementation of the GLP-1 receptor agonist efficacy as an oral drug. In 2006, APD-668 compound (Ortho-McNeil, Arena) as GPR119 agonist first entered Clinical Phase I GPR119 agonists such as APD-597 compounds (Ortho-McNeil, Arena), PSN-821 compounds (OSI), MBX-2982 compounds (Sanofi-Aventis, Metabolex), and GSK-1292263A compounds (GSK) Currently, PSN-821 compound (OSI), MBX-2982 compound (Sanofi-Aventis, Metabolex) and GSK-1292263A compound (GSK) have entered clinical phase II (Thomson Reuters Integrity).

Accordingly, the present inventors have made efforts to develop a therapeutic agent for diabetes which is ensured of efficacy and safety, thereby preparing a novel thienopyrimidine derivative having a GPR119 agonizing activity and a pharmaceutically acceptable salt thereof, The present invention has been completed by providing a therapeutic agent for diabetes.

The present inventors have found compounds that have an antidiabetic activity against GPR119 (G protein-coupled receptor 119), which is known to increase sugar-dependent insulin secretion and inhibit feeding and weight gain. Thus, various metabolites induced by abnormal lipid and glucose metabolism The present inventors have made extensive efforts to develop a composition for effectively preventing or treating metabolic disorders. As a result, it has been found that the thienopyrimidine derivative of the above formula (1), which has not been known so far, significantly enhances the activity of GPR119, thereby completing the present invention.

It is therefore an object of the present invention to provide a thienopyrimidine derivative or a pharmaceutically acceptable salt thereof.

It is still another object of the present invention to provide a pharmaceutical composition for preventing or treating diabetes-related diseases containing the thienopyrimidine derivative or a pharmaceutically acceptable salt thereof as an active ingredient.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a thienopyrimidine derivative represented by the following formula (I): or a pharmaceutically acceptable salt thereof:

Formula 1

In the above formulas, Y is C ₁ -C ₆ alkyl, C ₁ -C ₆ alkylcarbonyl; C ₃ -C ₆ cycloalkylcarbonyl; C ₁ -C ₆ alkoxycarbonyl; C ₃ -C ₆ cycloalkoxycarbonyl; C ₁ -C ₆ alkylaminocarbonyl; Oxazole carbonyl; C ₃ -C ₆ Cycloalkylsulfonyl; Or a heteroaryl of a five-membered-six-membered ring substituted with halogen or C ₁ -C ₆ straight or branched chain alkyl; R is a heteroaromatic ring of 5-to 8-ring heteromonocycloalkyl or 5-angle-6-ring heteroaryl; X is -NA ₁ - or -O-, A ₁ is hydrogen or C ₁ -C ₆ Alkyl; Ar is halogen, unsubstituted or substituted by halogen C ₁ -C ₆ alkoxy, C ₁ -C ₆ Alkylsulfonyl and aminocarbonyl; < RTI ID = 0.0 > R < / RTI > n is an integer of 0-5.

The present inventors have found compounds that have an antidiabetic activity against GPR119 (G protein-coupled receptor 119), which is known to increase sugar-dependent insulin secretion and inhibit feeding and weight gain. Thus, various metabolites induced by abnormal lipid and glucose metabolism The present inventors have made extensive efforts to develop a composition for effectively preventing or treating metabolic disorders. As a result, it has been found that the thienopyrimidine derivative of the above formula (1), which has not been known until now, significantly enhances the activity of GPR119. Therefore, the composition of the present invention that efficiently enhances the activity of GPR119 can be an effective preventive and therapeutic agent for various diabetic complications such as diabetes, obesity, hyperlipidemia, diabetic vascular disease, and the like.

As used herein, the term " alkyl " means a straight or branched saturated hydrocarbon group, including, for example, methyl, ethyl, propyl, isobutyl, pentyl or hexyl. C ₁ -C ₆ Alkyl means an alkyl group having an alkyl unit having 1 to 6 carbon atoms, and when C ₁ -C ₆ alkyl is substituted, the number of carbon atoms of the substituent is not included.

The term "alkylcarbonyl" as used herein means a carbonyl group is bonded, for example, C ₁ -C ₆ Alkylcarbonyl means an alkyl group having a carbonyl group to which an alkyl unit having 1 to 6 carbon atoms is bonded.

The term "cycloalkyl-carbonyl" in the present specification means a group a cycloalkyl group attached, for example, C ₃ -C ₆ Cycloalkylcarbonyl means a carbonyl group to which a cycloalkyl unit having 3 to 6 carbon atoms (triangle-6 each ring) is bonded.

As used herein, the term " alkoxy " means a radical formed by removing hydrogen from an alcohol, and when the C ₁ -C ₆ alkoxy is substituted, the number of carbon atoms of the substituent is not included.

The term "alkoxycarbonyl" as used herein means a group bonded alkoxy groups, for example C ₁ -C ₆ The term " alkoxycarbonyl " means a carbonyl group (ester) bonded with an alkoxy group having 1 to 6 carbon atoms.

The term " alkylaminocarbonyl " as used herein refers to a carbonyl group to which an amine group substituted with an alkyl group is bonded, for example, C ₁ -C ₆ Alkylaminocarbonyl means a carbonyl group (amide) bonded with an amine group substituted with an alkyl group having 1 to 6 carbon atoms.

The term "between alkylsulfonyl" as used herein means a group of sulfonyl group substituted with between, for example, C ₃ -C ₆ Said alkylsulfonyl means a sulfonyl group substituted by a cycloalkyl of 3 to 6 carbon atoms (triangle-6 angular ring).

As used herein, the term " halogen " refers to a halogen group element and includes, for example, fluoro, chloro, bromo and iodo.

As used herein, the term " heteroaryl " means a heterocyclic aromatic group containing a hetero atom, oxygen, sulfur or nitrogen, in the ring. The heteroatom is preferably nitrogen or oxygen. The number of heteroatoms in the ring is 1-4, preferably 1-3. In heteroaryl, aryl is preferably monoaryl or biaryl.

As used herein, the term " heteromonocycloalkyl " means a monocyclic saturated hydrocarbon group containing hetero atoms in the ring, including oxygen, sulfur or nitrogen.

According to a preferred embodiment of the present invention, the heteroaryl of the 5-angled-six-ring of Y in formula (I) of the present invention is pyrimidine or oxadiazole; Hetero monocycloalkyl in the pentane-8 each ring of R is piperidine or azepane; Wherein the heteroaryl of the R 5 quadrature-hexa ring is tetrazole, X is -NA ₁ - or -O-, A ₁ is hydrogen or C ₁ -C ₃ Alkyl; And n is an integer of 0-4.

According to a more preferred embodiment of the present invention, Y in the general formula (1) of the present invention is isopropylcarbonyl, cyclopropylcarbonyl, isopropoxycarbonyl, 1-methylcyclopropoxycarbonyl, t-butoxycarbonyl, Isopropylaminocarbonyl, cyclopropylsulfonyl, ethylpyrimidyl, fluoropyrimidyl, isopropylisoxazole carbonyl, isopropyloxadiazolecarbonyl, trifluoro-2-methylpropylcarbonyl, methylisoxazole carbonyl Or cyclopropyl isoxazole carbonyl; Wherein X is _{-NH-, -NCH 3 -, -N-} CH 2 CH 3 - or -O-, and; Ar is phenyl substituted with one or more substituents selected from the group consisting of halogen, methoxy, trihalomethoxy, methylsulfonyl or aminocarbonyl; And n is an integer of 0-3.

According to a preferred embodiment of the present invention, the thienopyrimidine derivative represented by the formula (1) of the present invention is selected from the group consisting of the compounds represented by the following formulas (2) to (43).

       (2)

       (4)

       (6)

       (8)

     (10)

     (12)

     (14)

     (16)

     (18)

     (20)

     (22)

     (24)

     (26)

     (28)

     (30)

     (32)

     (34)

     (36)

      (38)

      (40)

      Formula 42

Most preferably, the thienopyrimidine derivative represented by formula 1 of the present invention is selected from the group consisting of the compounds represented by the above formulas 2, 3, 5, 7, 8, 10, 16, 17, 27 and 30 .

As shown in Table 2, the compounds according to the present invention exhibited GPR119 agonistic activity having an EC ₅₀ value of less than or equal to μM, , 30 thienopyrimidine derivative compounds have excellent GPR119 agonizing activity. That is, according to the present invention, the 10 compounds listed above have an EC ₅₀ value of less than 100 nM for GPR119. They can therefore be used as highly effective therapeutic compositions for diabetes and various diabetic complications.

According to another aspect of the present invention, there is provided a pharmaceutical composition for preventing or treating diabetic-related diseases comprising the thienopyrimidine derivative of the present invention, a pharmaceutically acceptable salt thereof or a solvate thereof as an active ingredient .

The term " diabetes " as used herein refers to a chronic disease characterized by a relative or absolute lack of insulin resulting in glucose-intolerance. Diabetes that is prevented or treated with the composition of the present invention includes all kinds of diabetes, including, for example, type 1 diabetes, type 2 diabetes and diabetes mellitus. Type 1 diabetes is an insulin-dependent diabetes mellitus, which is mainly caused by the breakdown of beta -cells, and type 2 diabetes is non-insulin dependent diabetes mellitus, caused by insufficient insulin secretion or insulin resistance after a meal.

As used herein, the term " diabetes related disease " means any disease in which diabetes affects the onset, progression, or therapeutic sensitivity of the disease, including, for example, obesity, coronary artery disease, ischemic stroke, peripheral vascular disease, intermittent claudication, Diabetic retinopathy, macular degeneration, cataract, diabetic nephropathy, glomerular sclerosis, chronic renal failure, diabetic retinopathy, diabetic retinopathy, diabetic retinopathy, diabetic retinopathy, diabetic retinopathy, diabetic nephropathy, Atherosclerosis, hypertriglyceridemia, hyperinsulinemia, hyperlipidemia, hypertriglyceridemia, insulin resistance, foot ulcer, ulcerative colitis, and heart disease, including but not limited to diabetic neuropathy, angina pectoris, thrombosis, atherosclerosis, myocardial infarction, transient ischemic attack, stroke, Including but not limited to diabetes mellitus, diabetes mellitus, dysmenorrhea, .

According to a preferred embodiment of the present invention, the thienopyrimidine derivative of the present invention has GPR119 agonistic activity.

The composition of the present invention may be provided as a pharmaceutical composition for the prevention or treatment of diabetes related diseases. When the composition of the present invention is manufactured from a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, muscle injection, intraperitoneal injection, transdermal administration or the like.

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . The daily dosage of the pharmaceutical composition of the present invention is, for example, 0.001-100 mg / kg.

The pharmaceutical composition of the present invention may be formulated into a conventional preparation using pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs May be prepared in unit dosage form or may be manufactured by intrusion into a multi-dose container. Typical formulations are, for example, oral (tablets, capsules, powders), intraoral, sublingual, rectal, vaginal, intranasal, topical or parenteral (intravenous, intracameral, intramuscular, subcutaneous And intravenous) administration formulations. For example, a compound according to the present invention may be in the form of tablets containing starch or lactose, in the form of capsules containing the active ingredient alone or as an excipient, or in the form of an elixir or suspension containing a chemical that flavors or colors For example, orally, buccally or sublingually. Liquid preparations may contain suspending agents (e. G., A mixture of a semisynthetic glyceride such as methylcellulose, witepsol or apricot kernel oil and a PEG-6 ester, or a mixture of PEG-8 and caprylic / Such as a glyceride mixture, such as a mixture of glycerides (e.g., a mixture of glycerides). It is also most preferred to use it as a sterile aqueous solution form when injected parenterally, for example, intravenously, intraperitoneally, intramuscularly, subcutaneously, and intrathecally, wherein the solution is administered in order to have isotonicity with the blood It may contain other substances (for example, salts or monosaccharides such as mannitol, glucose).

The thienopyrimidine derivative of the present invention may be used in the form of a pharmaceutically acceptable salt. As the salt, an acid addition salt formed by a pharmaceutically acceptable free acid may be used. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates, Derived from organic acids such as acetic acid, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, fumaric acid, and the like. Such pharmaceutically innocuous salts include, but are not limited to, sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate chloride, bromide, Butyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, succinate, maleic anhydride, maleic anhydride, , Sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzene sulfonate, toluene sulfonate, chlorobenzene sulfide Propyl sulphonate, naphthalene-1-yne, xylenesulfonate, phenylsulfate, phenylbutyrate, citrate, lactate,? -Hydroxybutyrate, glycolate, maleate, Sulfonate, naphthalene-2-sulfonate or mandelate.

The acid addition salt according to the present invention can be obtained by a conventional method, for example, by dissolving a derivative of Chemical Formula 1 in an organic solvent such as methanol, ethanol, acetone, methylene chloride, acetonitrile, , Or may be prepared by drying, or after the solvent and excess acid are distilled off under reduced pressure, followed by drying or crystallization in an organic solvent.

In addition, bases can be used to make pharmaceutically acceptable metal salts. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or an alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is preferable for the metal salt to produce sodium, potassium or calcium salt. In addition, the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable salt (such as silver nitrate). The present invention also encompasses thienopyrimidine derivatives represented by the above formula (1) and pharmaceutically acceptable salts thereof, as well as possible solvates, hydrates, stereoisomers and the like which can be prepared therefrom.

The present invention also relates to a process for preparing a compound of the formula (1) by reacting a compound of the formula (2) with a compound of the formula (3) in a base and an organic solvent, And

A process for producing a thienopyrimidine derivative according to claim 1, comprising the step of reacting the compound of 4 prepared in the above step 1 with 5 boronic acid in a catalyst, a base and an organic solvent to prepare a compound (1) (step 2) to provide.

[Reaction Scheme 1]

(In the above Reaction Scheme 1, Ar, X, R, and Y are as defined in Formula 1.)

Hereinafter, the manufacturing method according to the present invention will be described step by step.

Step 1

Step 1 according to the present invention is a step of reacting the starting compound 2 and the compound 3 in a base and an organic solvent to prepare a compound 4.

The reaction is widely known in the field of organic chemistry, and the reaction conditions such as reaction solvent, reaction temperature, reaction time and the like can be appropriately selected in consideration of the reactant and the produced material.

Preferably, the organic solvent in Step 1 is tetrahydrofuran, dimethylsulfoxide, acetonitrile, dimethylformamide, etc., and the base is selected from the group consisting of sodium hydride, triethylamine, diisopropylethylamine, pyridine, 4 -Dimethylaminopyridine, 2,6-lutidine, 1,8-diazabicyclo [5.4.0] -undec-7-ene and the like can be used.

The compound (3) may be used in an amount of 1 to 3 molar equivalents based on 1 molar equivalent of the compound (2), and the reaction time may be 1 to 24 hours, and the reaction temperature may be room temperature to the boiling point of the organic solvent.

Step 2

Step 2 according to the present invention is a step of reacting the compound of 4 prepared in Step 1 with 5 boronic acid in the presence of a catalyst, a base and an organic solvent to prepare a compound of Formula (I).

The reaction of step 2 above is a reaction commonly known as a Suzuki coupling reaction.

Preferably, the catalyst may be palladium, and the base may be sodium carbonate or sodium bicarbonate, and the organic solvent may be 1,4-dioxane or dimethoxyethane.

Further, the present invention relates to a process for preparing a compound of 6 by removing the Boc group of the compound of 1a in an acid and an organic solvent, as shown in the following Reaction Scheme 2 (step a); And

A process for the preparation of a compound of formula (I) according to claim 1, comprising the step of reacting a compound of formula (6) prepared in step (a) with an alkyl halide of formula (7) or an isocyanate compound of formula A method for producing a derivative is provided.

[Reaction Scheme 2]

(Wherein Ar, X, R and Y are as defined in the above formula (1)

A is halogen, Y is C ₁ -C ₆ linear or branched alkyl, preferably methyl, ethyl, isopropyl, and more preferably isopropyl.)

Hereinafter, the manufacturing method according to the present invention will be described step by step.

Step a

Step a according to the present invention is a step of preparing a compound of 6 by removing the Boc group of the compound of 1a.

The reaction is widely known in the field of organic chemistry, and the reaction conditions such as reaction solvent, reaction temperature, reaction time and the like can be appropriately selected in consideration of the reactant and the produced material.

For example, the compound of the above 1a may be dissolved in dichloromethane, which is a solvent, and trifluoroacetic acid may be added to the acid to remove the Boc group.

Step b

Step (b) according to the present invention is a step of reacting the compound of formula (6) prepared in step (a) with an alkyl halide or isocyanate compound of formula (7) in a base and an organic solvent to prepare a compound of formula (1).

At this time, the base of step b is preferably selected from the group consisting of triethylamine, diisopropylethylamine, pyridine, 4-dimethylaminopyridine, 2,6-lutidine, 1,8-diazabicyclo [5.4.0] - ene, and the like can be used. As the organic solvent, dichloromethane, dimethylformamide, tetrahydrofuran, dimethylsulfoxide, acetonitrile and the like can be used.

In addition, the reaction time in step b) may be 1 to 24 hours, and the reaction temperature may range from room temperature to the boiling point of the solvent.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides novel thienopyrimidine derivatives.

(b) The present invention provides a pharmaceutical composition for the prevention or treatment of diabetes and various diabetes-related diseases comprising a thienopyrimidine derivative as an active ingredient.

(c) The thienopyrimidine derivative of the present invention efficiently enhances the activity of GPR119 (G protein-coupled receptor 119), which increases sugar-dependent insulin secretion and inhibits feeding and weight gain, thereby enhancing glucose and lipid metabolism And can be usefully used as an effective preventive and therapeutic composition for various diabetic complications such as diabetes as well as obesity, hyperlipidemia, diabetic vascular disease and the like.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

The chemical structures, IUPAC names and NMR values of the specific compounds prepared in the present invention are shown in Table 1 below.

The rescue IUPAC Name NMR (or LC Mass) 2

t-Butyl 4 - ((7- (4- (methylsulfonyl) phenyl) thieno [3,2- d] pyrimidin-4-yl) oxy) piperidine-1-carboxylate ^{1 H NMR (500 MHz, CDCl} 3) δ 1.48 (s, 9H), 1.85 (m, 2H), 2.06 (m, 2H), 3.35 (m, 2H), 3.79 (m, 2H), 5.58 (m, 1H), 7.86 (s, 1 H), 8.84 (s, 1 H) 3

D ] pyrimidin-4-yl) oxy) piperidine-1-carboxylate < / RTI > ^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.2 Hz, 6H), 1.80-1.90 (m, 2H), 2.10-2.15 (m, 2H), 3.40-3.45 (m, 2H), 1H), 7.84 (s, 1H), 8.84 (s, 1H) 4

((7- (4-methoxyphenyl) thieno [3,2- d ] pyrimidin-4-yl) oxy) piperidine-1-carboxylate _{^{1 H NMR (500MHz, CDCl 3}} ) δ 1.26 (d, J = 6.2Hz, 6H), 1.85- 1.93 (m, 2H), 2.05-2.13 (m, 2H), 3.40-3.48 (m, 2H), 3.84 (s, 3H), 3.80-3.93 (m, 2H), 4.91-4.99 (m, IH), 5.60-5.65 (m, IH), 7.02 (d, J = 8.8 Hz, 2H) ), 7.86 (d, J = 8.9 Hz, 2H), 8.80 (s, 1H) 5

4 - ((l- (5-ethyl-pyrimidin-2-yl) piperidin-4-yl) oxy) -7- (4- (methylsulfonyl) phenyl) thieno [3,2- d] pyrimidin Midin ^{1 H NMR (500 MHz, CDCl} 3) δ 1.76-1.88 (m, 2H), 2.12-2.20 (m, 2H), 2.43 (s, 1H), 2.82-2.89 (m, 2H), 3.07 (s, 3H J = 8.5 Hz, 2H), 8.05 (s, 1H), 8.16 (d, J = 8.5 Hz, 2H) , 8.80 (s, 1 H) 6

D ] pyrimidin-4-yl) oxy) piperidin-1-yl) -methanone < EMI ID = ^{1 H NMR (500 MHz, CDCl} 3) δ 0.78-0.82 (m, 2H), 0.99-1.05 (m, 2H), 1.78-1.85 (m, 1H), 2.05-2.88 (m, 2H), 2.09-2.25 (m, 2H), 3.09 (s, 3H), 3.54-3.73 (m, 2H), 4.00-4.09 (m, 2H), 5.68-5.73 ), 8.08 (s, 1H), 8.17 (d, J = 8.6 Hz, 2H), 8.84 (s, 1H). 7

D ] pyrimidin-4-yl) oxy) piperidin-1-yl) propane -1-one ¹ H NMR (500 MHz, CDCl ₃₎ 1.16 δ (d, J = 6.7 Hz, 6H), -1.99 1.87 (m, 2H), 2.08-2.22 (m, 2H), 2.81-2.89 (m, 1H), (D, J = 8.5 Hz, 2H), 8.08 (s, 2H), 3.08 (s, 3H), 3.47-3.60 1H), 8.17 (d, J = 8.5 Hz, 2H), 8.83 (s, 1H) 8

D ) pyrimidin-4-yl) oxy) piperidine-1-carboxamide (Compound ^{1 H NMR (500 MHz, CDCl} 3) δ 1.17 (d, J = 6.5Hz, 6H), 1.88- 1.94 (m, 2H), 2.10-2.15 (m, 2H), 3.08 (s, 3H), 3.30- (M, 2H), 3.95-4.02 (m, 1H), 4.29 (d, J = 7.2 Hz, 1H), 5.59-5.64 J = 8.7 Hz, 2H), 8.07 (s, IH), 8.17 (d, J = 8.6 Hz, 2H), 8.82 9

4 - ((1- (cyclopropylsulfonyl) piperidin-4-yl) oxy) -7- (4- (methylsulfonyl) phenyl) thieno [3,2- d ] pyrimidine ^{1 H NMR (300 MHz, CDCl3} ): δ 8.02 (d, J = 7.2Hz, 1H), 7.88 -7.78 (m, 1H), 7.597.36 (m, 6H), 7.14 (d, J = 8.2Hz, (M, 2H), 3.89-3.78 (m, 2H), 3.68 (s, 3H), 2.74 (t, J = 5.5 Hz, 2H), 2.49-2.34 ), 1.931.79 (m, 5H), 1.56-1.37 (m, 2H), 1.22-1.04 (m, 2H). 10

t-Butyl 4 - ((7- (4- (methylsulfonyl) phenyl) thieno [3,2- d] pyrimidin-4-yl) amino) piperidine-1-carboxylate ^{1 H NMR (500 MHz, CDCl} 3) δ 1.48 (s, 9H), 1.42-1.55 (m, 2H), 2.16 (d, J = 10.1Hz, 2H), 2.89-3.03 (m, 2H), 3.08 ( J = 8.5 Hz, 1H), 7.91 (s, 1H), 8.05 (d, J = , 2H), 8.14 (d, J = 8.4 Hz, 2H), 8.72 (s, 1H) 11

D ] pyrimidin-4-yl) amino) piperidine-1-carboxylate < / RTI > ^{1 H NMR (500 MHz, CDCl} 3) δ 1.25 (d, J = 6.1 Hz, 6H), 1.46 -1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), 2H), 7.90 (s, 1H), 8.04 (d, J = 8.5 Hz, 1H), 3.07 (s, 3H), 4.15-4.33 (m, 2H), 8.13 (d, J = 8.5 Hz, 2H), 8.71 (s, 1H) 12

D ] pyrimidin-4-yl) amino) piperidine-1-carboxylate < / RTI > ^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.3 Hz, 6H), 1.46 -1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), (M, 2H), 4.40-4.46 (m, 1H), 4.80 (d, J = 7.7 Hz, 1H), 4.91-4.97 (S, 1H), 8.04 (t, J = 7.4 Hz, 1H), 8.06 (dd, J = 1.4 and 11.4 Hz, 1H), 8.71 13

Isopropyl 4 - ((7- (4-carbamoyl-phenyl) thieno [3,2- d] pyrimidin-4-yl) amino) piperidine-1-carboxylate ^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.3Hz, 6H), 1.46- 1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), (M, 2H), 4.40-4.46 (m, 1H), 4.72 (d, J = 7.7 Hz, 1H), 4.89-4.97 1H), 7.86 (s, 1H), 7.93 (d, J = 6.6 Hz, 2H), 8.05 (d, J = 6.8 Hz, 2H) 14

D ] pyrimidin-4-yl) amino) piperidine-1-carboxylate < / RTI > ^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.3Hz, 6H), 1.46- 1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), (D, J = 7.7 Hz, 1H), 5.95 (s, 1H), 6.74 (s, 1H), 4.15-4.33 (m, 2H), 4.40-4.46 (D, J = 1.5 and 13.5 Hz, 1H), 8.20 (t, J = 8.3 Hz, 1H), 7.77 (dd, J = 1.6 and 8.2 Hz, 8.71 (s, 1 H) 15

D ] pyrimidin-4-yl) amino) piperidine-1-carboxylate < / RTI > ^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.3Hz, 6H), 1.46- 1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), (D, J = 7.7 Hz, 1H), 4.90-5.00 (m, 1H), 7.33 (d, J = 0.7 and 8.7 Hz, 2H), 7.77 (s, 1H), 7.94 (d, J = 8.8 Hz, 2H) 16

t - butyl 4- ((7- (4- (methylsulfonyl) phenyl) thieno [3,2- d] pyrimidin-4-yl) amino) piperidine-1-carboxylate ^{1 H NMR (500 MHz, CDCl} 3) δ 1.49 (s, 9H), 1.73-1.85 (m, 4H), 2.85-2.98 (m, 2H), 3.07 (s, 3H), 3.36 (s, 3H), 8.9 (d, J = 8.6 Hz, 2H), 8.62 (m, 2H) (s, 1 H) 17

D ] pyrimidin-4-yl) amino) piperidine-1-carboxylate < / RTI > ^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.2Hz, 6H), 1.73- 1.87 (m, 4H), 2.89-2.99 (m, 2H), 3.06 (s, 3H), 3.35 ( 1H, s, 3H), 4.27-4.44 (m, 2H), 4.91-4.98 , 8.09 (d, J = 8.6 Hz, 2H), 8.61 (s, 1H) 18

Isopropyl 4 - ((7- (4-carbamoyl-3-chlorophenyl) thieno [3,2- d] pyrimidin-4-yl) (methyl) amino) piperidine-1-carboxylate ^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.2Hz, 6H), 1.72- 1.87 (m, 4H), 2.86-2.99 (m, 2H), 3.34 (s, 3H), 4.23- 1H), 7.84-7.94 (m, 3H), 8.04 (m, 2H) d, J = 1.5Hz, 1H), 8.61 (s, 1H). 19

N - (1- (5- fluoro-2-yl) piperidin-4-yl) - N - methyl-7- (4- (methylsulfonyl) phenyl) thieno [3,2- d] Pyrimidin-4-amine _{^{1 H NMR (500MHz, CDCl 3}} ) δ 1.80-1.94 (m, 4H), 3.07 (s, 3H), 3.03-3.10 (m, 2H), 3.34 (s, 3H), 4.86-4.95 (m, 2H) , 8.12 (d, J = 8.4 Hz, 2H), 8.22 (s, 2H), 8.64 (m, 2H) s, 1 H) 20

N - (1- (5- ethyl-pyrimidin-2-yl) piperidin-4-yl) - N - methyl-7- (4- (methylsulfonyl) phenyl) thieno [3,2- d] Pyrimidin-4-amine _{^{1 H NMR (500MHz, CDCl 3}} ): δ 1.19 (t, J = 7.6Hz, 3H), 1.80- 1.92 (m, 4H), 2.45-2.50 (m, 2H), 3.06 (s, 3H), 3.04- 1H), 7.91 (s, 1H), 8.01 (d, J = 8.5 Hz, 2H), 3.08 (m, 2H), 3.32 (s, 3H), 4.90-4.98 , 8.09 (d, J = 8.5 Hz, 2H), 8.18 (s, 2H), 8.62 (s, 1H). 21

Yl) amino) piperidin-1-yl) methanone (prepared according to the procedure described for the synthesis of 4- (4- (methylsulfonyl) phenyl) thieno [3,2- d ] pyrimidin- ^{1 H NMR (500 MHz, CDCl} 3) δ 0.90-0.94 (m, 2H), 1.13-1.18 (m, 2H), 1.76-1.90 (m, 5H), 2.71-2.83 (m, 1H), 3.09 (s 1H), 3.38 (s, 3H), 4.37-4.47 (m, 1H), 4.78-4.92 (m, 1H), 5.13-5.22 , 8.03 (d, J = 8.6 Hz, 2H), 8.63 (s, 1H) 22

D ] pyrimidin-4-yl) amino) piperidin-l-yl) -methanone [ Propan-1-one ^{1 H NMR (500 MHz, CDCl} 3) δ 1.17 (d, J = 10.2Hz, 6H), 1.79 -1.82 (m, 2H), 1.85-1.98 (m, 2H), 2.68-2.75 (m, 1H), (M, 1H), 2.82-2.90 (m, 1H), 3.07 (s, 3H), 3.21-3.30 8.05 (d, J = 8.5 Hz, 2H), 8.08 (d, J = 8.5 Hz, 2H), 8.62 (s, 1H). 23

thieno [3,4-d] pyrimidin-4-ylamino) methyl) piperidine-1-carboxylate ^{1 H NMR (500 MHz, CDCl} 3): δ 8.72 (s, 1H), 8.14 (d, J = 8.5 Hz, 2H), 8.05 (d, J = 8.5 Hz, 2H), 7.90 (s, 1H), 5.05 (t, J = 5.8Hz, 1H), 4.17-4.13 (m, 2H), 3.63-3.62 (m, 2H), 3.08 (s, 3H), 2.74-2.71 (m, 1H), 1.93-1.91 ( (m, 2H), 1.46 (s, 9H), 1.27-1.33 (m, 2H) 24

Thieno [3,4-d] pyrimidin-4-ylamino) methyl) piperidine-1-carboxylate ^{1 H NMR (500 MHz, CDCl} 3) δ 8.71 (s, 1H), 8.14 (d, J = 8.3 Hz, 2H), 8.05 (d, J = 8.3 Hz, 2H), 7.91 (s, 1H), 5.10 2H), 3.08 (s, 3H), 2.75-2.74 (m, 2H), 3.91-3.40 (m, , 1.95-1.93 (m, 1H), 1.83-1.79 (m, 2H), 1.30 -1.29 (m, 1H), 1.24 (d, J = 6.2 Hz, 6H) 25

thiopyrimidin-4-yl) amino) methyl) piperidine-1-carboxylate < / RTI > _{^{1 H NMR (300MHz, CDCl 3}} ) δ 8.62 (s, 1H), 8.10 (d, J = 8.4 Hz, 2H), 8.05 (d, J = 8.4Hz, 2H), 7.91 (s, 1H), 4.17- 2H), 3.73-3.74 (m, 2H), 3.53 (s, 3H), 3.08 (s, 3H), 2.70-2.63 1.69 (m, 2H), 1.45 (s, 9H), 1.28 - 1.24 (m, 2H) 26

thieno [3,2-d] pyrimidin-4-yloxy) methyl) piperidine-1-carboxylate ^{1 H NMR (300 MHz, CDCl} 3) δ 8.84 (s, 1H), 8.17 (d, J = 8.4 Hz, 2H), 8.07-8.05 (m, 3H), 4.49 (d, J = 6.5Hz, 2H) 2H), 1.47 (s, 9H), 2.29 (m, 2H) , 1.35-1.26 (m, 2H) 27

Thieno [3,2-d] pyrimidin-4-yl) (methyl) amino) piperidine-l- Di-1-carboxylate MH + 519 28

thieno [3,2-d] pyrimidin-4-yl) amino) azepane-1-carboxylate ^{1 H NMR (300 MHz, CDCl} 3) δ 8.71 (s, 1H), 8.13 (d, J = 8.3 Hz, 2H), 8.04 (d, J = 8.3 Hz, 2H), 7.89 (s, 1H), 4.92 2H), 3.83-3.16 (m, 2H), 3.08 (s, 3H), 2.28-2.22 (m, , 2.13-2.05 (m, 1H), 1.96-1.67 (m, 4H), 1.50 (s, 9H) 29

Methyl] piperidine-1-carboxylate < / RTI > was prepared by reacting isopropyl 4 - ((7- (4- (methylsulfonyl) phenyl) thieno [3,2- d] pyrimidin- ^{1 H NMR (300 MHz, CDCl} 3) δ 8.85-8.82 (m, 1H), 8.20-8.03 (m, 5H), 4.92-4.91 (m, 1H), 4.50-4.47 (m, 2H), 4.25-4.20 2H), 1.36-1. 34 (m, 2H), 1.26 (m, IH) -1.24 (d, J = 6.2 Hz, 6H). 30

yl) (methyl) amino) piperidine-l- (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2-d] pyrimidin- - carboxylate ^{1 H NMR (300 MHz, MeOH-} d 4) δ8.43 (s, 1H), 8.30 (s, 1H), 8.09-8.05 (m, 1H), 7.89-7.83 (m, 2H), 5.08-5.03 ( (s, 3H), 2.99-2.93 (m, 2H), 1.88-1.82 (m, 4H), 1.49 (s, 9H) 31

Yl) (methyl) amino) piperidine-l- (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2-d] pyrimidin- Carboxylate ^{1 H NMR (300 MHz, CDCl} 3) δ 8.44 (s, 1H), 8.30 (s, 1H), 8.10-8.05 (m, 1H), 7.90-7.84 (m, 2H), 5.11-5.05 (m, 1H ), 4.96-4.92 (m, 1H), 4.34-4.30 (m, 2H), 3.41 (s, 3H), 3.22 (s, 3H), 3.06-2.96 ), 1.29 (d, J = 6.2 Hz, 6 H) 32

thieno [3,4-d] pyrimidin-4-yl) amino) piperidine-1-carboxylate ^{1 H NMR (300 MHz, DMSO-} d 6) δ 8.50 (s, 1H), 8.47 (s, 1H), 8.27-8.25 (m, 1H), 7.92-7.87 (m, 2H), 4.37-4.33 (m (M, 2H), 1.98-1.90 (m, 2H), 1.52-1.36 (m, 12H) 33

Yl) (methyl) amino) piperidin-1-yl (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2-d] pyrimidin- ) (5-isopropylisoxazol-3-yl) methanone ^{1 H NMR (300 MHz, MeOH-} d 4) δ8.60 (s, 1H), 8.37 (s, 1H), 8.09-8.04 (m, 1H), 7.90-7.83 (m, 2H), 6.39 (s, 2H), 2.05-1.89 (m, 2H), 3.45 (s, 3H), 3.24 4H), 1.36-1.28 (d, J = 7.0 Hz, 6 H) 34

4- (2-fluoro-4- (methylsulfonyl) phenyl) -N- (1- (3- isopropyl-1,2,4-oxadiazol-5-yl) piperidin- ) -N-methylthieno [3,2-d] pyrimidin-4-amine _{^{1 H NMR (500MHz, CDCl 3}} ) δ 8.61 (s, 1H), 8.30 (t, J = 8.0Hz, 1H), 8.10 (s, 1H), 7.86 (d, J = 8.0Hz, 1H), 7.79 ( J = 8.0 Hz, 1H), 5.27-5.25 (m, 1H), 4.93 (d, J = 13.0 Hz, 2H), 4.31 (d, J = 13.0 Hz), 3.41-3.35 (M, 1H), 1.94-1.88 (m, 4H), 1.39 (d, J = 6.8 Hz, 6H) 35

2-yl) 4 - ((7- (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2- d] pyrimidine -4-yl) (methyl) amino) piperidine-1-carboxylate ^{1 H NMR (300 MHz, DMSO} -d 6): δ12.02 (s, 1H), 9.93 (s, 1H), 9.16-9.09 (m, 1H), 7.97 (d, J = 7.7 Hz, 2H), 2H), 2.45-2.32 (m, 1H), 2.54 (d, J = , 2.12 (d, J = 6.7 Hz, 2H), 1.85-1.63 (m, 5H), 1.50-1.33 (m, 2H), 1.17-1.00 (m, 2H). 36

Yl) (methyl) amino) piperidin-1-yl (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2-d] pyrimidin- ) (5-methylisoxazol-3-yl) methanone ^{1 H NMR (300 MHz, MeOH-} d 4) δ8.44 (s, 1H), 8.30 (s, 1H), 8.09-8.04 (m, 1H), 7.90-7.83 (m, 2H), 6.38 (s, 2H), 2.49 (s, 3H), 3.21 (s, 3H), 3.08-3.00 (m, , 1.98-1.92 (m, 4H) 37

3-yl) (4 - ((7- (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2- d] pyrimidin- (Methyl) amino) piperidin-1-yl) methanone ^{1 H NMR (300 MHz, MeOH-} d 4) δ8.44 (s, 1H), 8.30 (s, 1H), 8.09-8.04 (m, 1H), 7.89-7.83 (m, 2H), 6.31 (s, 3H), 3.21 (s, 3H), 3.07-3.00 (m, < RTI ID = 0.0 > 1H) (M, 2H), 1.01-0.98 (m, 2H), 2.31-2.17 (m, 38

thieno [3,2-d] pyrimidin-4-yloxy) piperidine-1-carboxylate ^{1 H NMR (300 MHz, CDCl} 3) δ 8.81 (s, 1H), 8.42 (t, J = 7.5 Hz, 1H), 8.25 (s, 1H), 7.90- 7.79 (m, 2H), 5.64-5.59 ( (m, 2H), 1.49 (m, 2H), 1.49 (m, 2H), 3.91-3. s, 9H) 39

3-yl) (4- (7- (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2- d] pyrimidin- Piperidin-1-yl) methanone < / RTI > ^{1 H NMR (300 MHz, CDCl} 3) δ 8.82 (s, 1H), 8.43 (t, J = 7.4 Hz, 1H), 8.27 (s, 1H), 7.90- 7.79 (m, 2H), 6.21 (s, 3H), 2.32-2.16 (m, 2H), 2.11-2.01 (m, 2H) m, 2H), 1.15-1.04 (m, 4H) 40

Yl) oxy] piperidin-1-yl) (5-iso (2-fluoroethoxy) Propyl isoxazol-3-yl) methanone ^{1 H NMR (300 MHz, CDCl} 3) δ 8.82 (s, 1H), 8.43 (t, J = 7.9 Hz, 1H), 8.28 (s, 1H), 7.91 -7.79 (m, 2H), 6.31 (s, 2H), 3.15-3.11 (m, 4H), 2.27-2.17 (m, 2H), 2.11- 2.04 (m, 2H), 1.35 (d, J = 10.9 Hz, 6H) 41

3,2-d] pyrimidin-4-yl) amino) piperidine-l-carbaldehyde was prepared from tert- butyl 4- (ethyl 7- (2- fluoro-4- (methylsulfonyl) phenyl) thieno [ Decylate ^{1 H NMR (300 MHz, CDCl} 3) δ 8.68 (s, 1H), 8.14-8.04 (m, 2H), 7.93-7.80 (m, 2H), 5.10 -5.04 (m, 1H), 4.38-4.27 (m , 2H), 3.93-3.82 (m, 2H), 3.13 (s, 3H), 2.98-2.86 (m, 2H), 1.95-1.84 (m, 4H), 1.51 (s, 9H), 1.26 (t, J = 7.2 Hz, 3 H) 42

5-yl) propyl) thieno [3,2-d] pyrimidin-2-yl) Amin-4-amine ^{1 H NMR (300 MHz, CDCl} 3) δ 8.68 (s, 1H), 8.43-8.38 (m, 1H), 8.07 (s, 1H), 7.88-7.77 (m, 2H), 5.04-5.00 (m, 1H ), 3.85-3.80 (m, 2H), 3.10-3.05 (m, 5H), 2.30-2.22 (m, 2H), 1.63 (d, J = 6.6 Hz,

Manufacturing example

< Example  1> t Butyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) Oxy ) Piperidin-l- Carboxylate  Produce

A. t -Butyl 4 - ((7- Bromothieno [3,2- d ] Pyrimidine Yl) Oxy ) Piperidin-l- Carboxylate  Produce

The 6-bromo-4-chloro-thieno [3,2- d] pyrimidine (100 mg, 0.40 mmol) and 1-Boc-4- hydroxypiperidine piperidine (121 mg, 0.60 mmol) in tetrahydrofuran ( THF) (4 ml), 60% sodium hydride (58 mg, 2.40 mmol) was added at room temperature, and the mixture was stirred for 13 hours. Water was added to the reaction mixture and extracted several times with ethyl acetate. The organic layer was collected, dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was subjected to silica gel column chromatography ( n -hexane: ethyl acetate = 5: 1) to obtain the desired compound (158 mg, 95%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.48 (s, 9H), 1.85 (m, 2H), 2.06 (m, 2H), 3.35 (m, 2H), 3.79 (m, 2H), 5.58 (m, 1H), 7.86 (s, 1 H), 8.84 (s, 1 H); MS (ESI) m / z 414 ([M + H] &lt; ⁺ &gt;).

B. t Butyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) Oxy ) Piperidin-l- Carboxylate  Produce

(100 mg, 0.24 mmol) was added to a solution of t -butyl 4 - ((7-bromothieno [3,2- d ] pyrimidin-4- yl) oxy) piperidine- 3 ml), and then 4- (methylsulfonyl) phenylboronic acid (58 mg, 0.29 mmol), tetrakis (triphenylphosphine) palladium (14 mg, 0.012 mmol) and sodium bicarbonate saturated aqueous solution ) Was added at room temperature and refluxed at 90 &lt; 0 &gt; C for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography ( n -hexane: ethyl acetate = 1), the target compound (70 mg, 59%) was obtained.

^{1 H NMR (500 MHz, CDCl} 3) δ 1.47 (s, 9H), 1.81-1.93 (m, 2H), 2.00-2.15 (m, 2H), 3.08 (s, 3H), 3.32-3.42 (m, 2H J = 8.3 Hz, 2H), 8.07 (s, 1H), 8.16 (d, J = 8.3 Hz, 2H) , 8.81 (s, 1 H); MS (ESI) m / z 490 ([M + H] &lt; ⁺ &gt;).

< Example  2> isopropyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) Oxy ) Piperidin-l- Carboxylate  Produce

Step 1: Isopropyl 4 - ((7- Bromothieno [3,2- d ] Pyrimidine Yl) Oxy ) Piperidin-l- Carboxylate  Produce

4-chlorothieno [3,2- d ] pyrimidine (471 mg, 1.89 mmol) and isopropyl 4-hydroxypiperidine-1-carboxylate (530 mg, 2.83 mmol) After dissolving in THF (15 ml), 60% sodium hydride (272 mg, 11.3 mmol) was added at room temperature, followed by stirring at the same temperature for 19 hours. Water was added to the reaction mixture and extracted several times with ethyl acetate. The organic layer was collected and dried with magnesium sulfate, and the solvent was removed under reduced pressure. The residue was subjected to silica gel column chromatography ( n -hexane: ethyl acetate = 4: 1) to obtain the desired compound (664 mg, 88%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.2 Hz, 6H), 1.80-1.90 (m, 2H), 2.10-2.15 (m, 2H), 3.40-3.45 (m, 2H), 3.75-3.90 (m, 2H), 4.85-4.95 (m, 1H), 5.60-5.65 (m, 1H), 7.86 (s, 1H), 8.84 (s, 1H); MS (ESI) m / z 400 ([M + H] &lt; ⁺ &gt;).

B. Isopropyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) Oxy ) Piperidin-l- Carboxylate  Produce

Isopropyl 4- (no-7-bomo [3,2- d] pyrimidin-4-ilrok City) piperidine-1-carboxylate (50 mg, 0.13 mmol), 1,4- dioxane ( 1.5 mg), and then 4- (methylsulfonyl) phenylboronic acid (30 mg, 0.15 mmol), tetrakis (triphenylphosphine) palladium (7 mg, 0.006 mmol) and sodium carbonate saturated aqueous solution ml) was added and refluxed at 110 ° C for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography ( n -hexane: ethyl acetate = 1), the above compound (57 mg, 97%) was obtained.

^{1 H NMR (500 MHz, CDCl} 3) δ 1.25 (d, J = 6.2 Hz, 6H), 1.85-1.93 (m, 2H), 2.05-2.13 (m, 2H), 3.07 (s, 3H), 3.39- (M, 1H), 8.04 (d, J = 8.6 Hz, 2H), 3.44 (m, 2H), 3.80-3.90 1H), 8.16 (d, J = 8.6 Hz, 2H), 8.81 (s, 1H); MS (ESI) m / z 476 ([M + H] &lt; ⁺ &gt;).

< Example  3> isopropyl ((7- (4- Methoxyphenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) Oxy ) Piperidin-l- Carboxylate  Produce

(7-bromothieno [3,2- d ] pyrimidin-4-yloxy) piperidine obtained in Step 1 of Example 2, which was performed in the same manner as in Step 2 of Example 2, (50 mg, 0.13 mmol) was dissolved in 1,4-dioxane (1.5 ml), and then 4-methoxyphenylboronic acid (23 mg, 0.15 mmol) and tetrakis Palladium (7 mg, 0.006 mmol) and sodium carbonate saturated aqueous solution (1.5 ml) were added, and the mixture was refluxed at 110 ° C for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography ( n -hexane: ethyl acetate = 1), the objective compound (45 mg, 85%) was obtained.

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.2 Hz, 6H), 1.85-1.93 (m, 2H), 2.05-2.13 (m, 2H), 3.40-3.48 (m, 2H), (D, J = 8.8 Hz, 2H), 7.81 (s, 2H), 3.84 (s, 3H), 3.80-3.93 1H), 7.86 (d, J = 8.9 Hz, 2H), 8.80 (s, 1H); MS (ESI) m / z 428 ([M + H] &lt; ⁺ &gt;).

< Example  4 > 4 - ((1- (5- Ethylpyrimidine Yl) piperidin-4-yl) Oxy ) -7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidine

A. 7- (4- ( Methylsulfonyl ) Phenyl ) -4- (Piperidin-4- Daily Times ) Tieno [3,2- d ] Pyrimidine &lt; / RTI &

D ) pyrimidin-4-yl) oxy) piperidine obtained in the step 2 of Example 1 above, t -butyl 4 - ((7- (4- (methylsulfonyl) phenyl) thieno [ -1-carboxylate (588 mg, 1.20 mmol) was dissolved in dichloromethane (DCM) (12 ml), trifluoroacetic acid (3 ml) was added at 0 ° C, and the mixture was stirred at room temperature for 2 hours. After completion of the reaction, the reaction mixture was concentrated under reduced pressure. The residue was dissolved in chloroform, and 2 M aqueous sodium hydroxide solution was added thereto to adjust the pH to about 8 to 9. The organic layer was washed with a saturated aqueous sodium chloride solution, dried over magnesium sulfate, and then the solvent was removed under reduced pressure to obtain the desired compound (239 mg, 51%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.76-1.88 (m, 2H), 2.12-2.20 (m, 2H), 2.43 (s, 1H), 2.82-2.89 (m, 2H), 3.07 (s, 3H ), 8.16 (d, J = 8.5 Hz, 2H), 3.16-3.23 (m, 2H), 5.49-5.56 , 8.80 (s, 1 H); MS (ESI) m / z 390 ([M + H] &lt; ⁺ &gt;).

B. 4 - ((1- (5- Ethylpyrimidine Yl) piperidin-4-yl) Oxy ) -7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidine &lt; / RTI &

D ] pyrimidine (30 mg, 0.08 mmol) and 2-chloro-5- (4-fluorobenzyl) Ethyl pyrimidine (34 mg, 0.23 mmol) was dissolved in DMF (2 ml), TEA (0.15 ml) was added at room temperature, and the mixture was stirred at 130 ° C for 3 hours. After concentration under reduced pressure, the residue was subjected to silica gel column chromatography ( n -hexane: ethyl acetate = 1: 2) to obtain the above compound (18 mg, 47%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.19 (t, J = 7.6 Hz, 3H), 1.91-1.96 (m, 2H), 2.12-2.19 (m, 2H), 2.47 (qd, J = 7.6, 15.2 2H), 3.08 (s, 3H), 3.62-3.70 (m, 2H), 4.27-4.32 (m, 2H), 5.68-5.72 J = 8.6 Hz, 2H), 8.16 (d, J = 8.6 Hz, 2H), 8.19 (s, 2H), 8.84 (s, 1H); MS (ESI) m / z 496 ([M + H] &lt; ⁺ &gt;).

< Example  5> Cyclopropyl  (4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) Oxy ) &Lt; / RTI &gt; piperidin-1-yl) methanone

(30 mg, 0.25 mmol) was added to a solution of 7- (4- (methylsulfonyl) phenyl) -4- (piperidin-4-yloxy) thieno [3,2- d ] pyrimidine 0.089 mmol) and cyclopropanecarbonyl chloride (20 mg, 0.19 mmol) were dissolved in dichloromethane (2 ml) and DMF (1 drop), followed by addition of TEA (0.1 ml) at room temperature and stirring at the same temperature for 21 hours Respectively. After concentrating under reduced pressure, the residue was subjected to silica gel column chromatography (ethyl acetate) to obtain the desired compound (33 mg, 94%).

^{1 H NMR (500 MHz, CDCl} 3) δ 0.78-0.82 (m, 2H), 0.99-1.05 (m, 2H), 1.78-1.85 (m, 1H), 2.05-2.88 (m, 2H), 2.09-2.25 (m, 2H), 3.09 (s, 3H), 3.54-3.73 (m, 2H), 4.00-4.09 (m, 2H), 5.68-5.73 ), 8.08 (s, 1 H), 8.17 (d, J = 8.6 Hz, 2 H), 8.84 (s, 1 H); MS (ESI) m / z 458 ([M + H] &lt; ⁺ &gt;).

< Example  6> 2- methyl -1- (4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) Oxy ) Piperidin-1-yl) propan-1-one

(30 mg, 0.25 mmol) was added to a solution of 7- (4- (methylsulfonyl) phenyl) -4- (piperidin-4-yloxy) thieno [3,2- d ] pyrimidine 0.089 mmol) and isobutyryl chloride (21 mg, 0.19 mmol) were dissolved in dichloromethane (2 ml) and DMF (1 drop), TEA (0.1 ml) was added at room temperature, and the mixture was stirred at the same temperature for 21 hours . After concentrating under reduced pressure, the residue was subjected to silica gel column chromatography (ethyl acetate) to obtain the desired compound (32 mg, 91%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.16 (d, J = 6.7 Hz, 6H), 1.87-1.99 (m, 2H), 2.08-2.22 (m, 2H), 2.81-2.89 (m, 1H), (D, J = 8.5 Hz, 2H), 8.08 (s, 2H), 3.08 (s, 3H), 3.47-3.60 1H), 8.17 (d, J = 8.5 Hz, 2H), 8.83 (s, 1H); MS (ESI) m / z 460 ([M + H] &lt; ⁺ &gt;).

< Example  7> N-isopropyl-4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) Oxy ) Piperidin-l- Carboxamide  Produce

(30 mg, 0.25 mmol) was added to a solution of 7- (4- (methylsulfonyl) phenyl) -4- (piperidin-4-yloxy) thieno [3,2- d ] pyrimidine 0.089 mmol) and isopropyl isocyanate (17 mg, 0.19 mmol) were dissolved in dichloromethane (2 ml) and DMF (1 drop), TEA (0.1 ml) was added at room temperature and the mixture was stirred at the same temperature for 21 hours. After concentration under reduced pressure, the residue was purified by silica gel column chromatography (ethyl acetate) to give the above compound (20 mg, 55%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.17 (d, J = 6.5 Hz, 6H), 1.88-1.94 (m, 2H), 2.10-2.15 (m, 2H), 3.08 (s, 3H), 3.30- (M, 2H), 3.95-4.02 (m, 1H), 4.29 (d, J = 7.2 Hz, 1H), 5.59-5.64 J = 8.7 Hz, 2H), 8.07 (s, 1H), 8.17 (d, J = 8.6 Hz, 2H), 8.82 (s, 1H); MS (ESI) m / z 475 ([M + H] &lt; ⁺ &gt;).

< Example  8 > 4 - ((1- ( Cyclopropylsulfonyl ) &Lt; / RTI &gt; piperidin-4-yl) Oxy ) -7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidine

(30 mg, 0.25 mmol) was added to a solution of 7- (4- (methylsulfonyl) phenyl) -4- (piperidin-4-yloxy) thieno [3,2- d ] pyrimidine 0.089 mmol) and cyclopropanesulfonyl chloride (27 mg, 0.19 mmol) were dissolved in dichloromethane (2 ml) and DMF (1 drop), TEA (0.1 ml) was added at room temperature and stirred at the same temperature for 21 hours Respectively. After concentrating under reduced pressure, the desired compound (13 mg, 34%) was obtained through silica gel column chromatography ( n -hexane: ethyl acetate = 1: 2).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.01-1.05 (m, 2H), 1.20-1.23 (m, 2H), 2.06-2.15 (m, 2H), 2.19-2.28 (m, 2H), 2.31-2.38 (m, 1H), 3.09 (s, 3H), 3.36-3.45 (m, 2H), 3.62-3.70 (m, 2H), 5.60-5.63 ), 8.09 (s, 1 H), 8.17 (d, J = 8.5 Hz, 2 H), 8.83 (s, 1 H); MS (ESI) m / z 494 ([M + H] &lt; ⁺ &gt;).

< Example  9> t Butyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

A. t -Butyl 4 - ((7- Bromothieno [3,2- d ] Pyrimidine Yl) amino) piperidin-l- Carboxylate  Produce

4-chlorothieno [3,2- d ] pyrimidine (100 mg, 0.40 mmol) was dissolved in DMSO (3 ml) and then 4-amino-1-Boc-piperidine mg, 0.88 mmol), and the mixture was stirred at the same temperature for 14 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate, dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: ethyl acetate = 4: 1) 90%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.42-1.52 (m, 2H), 1.48 (s, 9H), 2.13 (d, J = 6.6 Hz, 2H), 2.85-3.05 (m, 2H), 4.05- 4.15 (m, 2H), 4.35-4.41 (m, IH), 4.80 (s, IH), 7.71 (s, IH), 8.73 (s, IH); MS (ESI) m / z 413 ([M + H] &lt; ⁺ &gt;).

B. t Butyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

(100 mg, 0.24 mmol) was added to a solution of t -butyl 4 - ((7-bromothieno [3,2- d ] pyrimidin- 4- yl) amino) piperidine- 3 ml), and then 4- (methylsulfonyl) phenylboronic acid (58 mg, 0.29 mmol), tetrakis (triphenylphosphine) palladium (14 mg, 0.012 mmol) and sodium bicarbonate saturated aqueous solution ) Was added at room temperature and refluxed at 90 DEG C for 7 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography ( n -hexane: ethyl acetate = 1: ). The resulting product was recrystallized from diethyl ether to give the desired compound (23 mg, 20%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.48 (s, 9H), 1.42-1.55 (m, 2H), 2.16 (d, J = 10.1 Hz, 2H), 2.89-3.03 (m, 2H), 3.08 ( J = 8.5 Hz, 1H), 7.91 (s, 1H), 8.05 (d, J = , 2H), 8.14 (d, J = 8.4 Hz, 2H), 8.72 (s, 1H); MS (ESI) m / z 489 ([M + H] &lt; ⁺ &gt;).

< Example  10> isopropyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

A. Isopropyl 4 - ((7- Bromothieno [3,2- d ] Pyrimidine Yl) amino) piperidin-l- Carboxylate  Produce

D ] pyrimidine (396 mg, 1.59 mmol) was dissolved in DMSO (12 ml), and then isopropyl 4-aminopiperidine-1-carboxylate (650 mg, 3.49 mmol) were added and the mixture was stirred at the same temperature for 20 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate, dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: ethyl acetate = 4: 1) 99%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.25 (d, J = 6.1 Hz, 6H), 1.90-2.10 (m, 2H), 2.15-2.20 (m, 2H), 2.90-3.10 (m, 2H), 1H), 7.73 (s, 1H), 8.73 (s, 2H), 4.40-4.45 1H); MS (ESI) m / z 399 ([M + H] &lt; ⁺ &gt;).

B. Isopropyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

Isopropyl 4 - ((7-to-no-bomo [3,2- d] pyrimidin-4-yl) amino) piperidine-1-carboxylate (50 mg, 0.13 mmol) for 1,4- (7 mg, 0.006 mmol) and sodium carbonate saturated aqueous solution (1.5 mg, 0.15 mmol) were added to a solution of 4- (methylsulfonyl) phenylboronic acid ml) was added at room temperature and heated at 110 &lt; 0 &gt; C for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated sodium chloride aqueous solution and dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (n-hexane: ethyl acetate = 1: ), The target compound (24 mg, 41%) was obtained.

^{1 H NMR (500 MHz, CDCl} 3) δ 1.25 (d, J = 6.1 Hz, 6H), 1.46-1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), J = 8.5 Hz, &lt; RTI ID = 0.0 &gt; 1H, &lt; / RTI & 2H), 8.13 (d, J = 8.5 Hz, 2H), 8.71 (s, 1H); MS (ESI) m / z 475 ([M + H] &lt; ⁺ &gt;).

< Example  11> isopropyl 4 - ((7- (3-fluoro-4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

To a solution of isopropyl 4 - ((7-bromothieno [3,2- d ] pyrimidin-4-yl) amino) piperidine- 1 -carboxylate , 0.13 mmol) was dissolved in 1,4-dioxane (1.5 ml), and then 3-fluoro-4- (methylsulfonyl) benzenboronic acid (33 mg, 0.15 mmol), tetrakis (triphenylphosphine) palladium (7 mg, 0.006 mmol) and a saturated sodium carbonate aqueous solution (1.5 ml) were added at room temperature and heated at 110 占 폚 for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography ( n -hexane: ethyl acetate = 1: ), The target compound (20 mg, 32%) was obtained.

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.3 Hz, 6H), 1.46-1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), (M, 2H), 4.40-4.46 (m, 1H), 4.80 (d, J = 7.7 Hz, 1H), 4.91-4.97 J = 1.5 and 8.2 Hz, 1H), 7.95 (s, 1H), 8.04 (t, J = 7.4 Hz, 1H), 8.06 (dd, J = 1.4 and 11.4 Hz, 1H), 8.71 MS (ESI) m / z 493 ([M + H] &lt; ⁺ &gt;).

< Example  12> isopropyl 4 - ((7- (4- Carbamoylphenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

To a solution of isopropyl 4 - ((7-bromothieno [3,2- d ] pyrimidin-4-yl) amino) piperidine- 1 -carboxylate , 0.13 mmol) was dissolved in 1,4-dioxane (1.5 ml), and then 4-aminocarbonylphenylboronic acid (25 mg, 0.15 mmol) and tetrakis (triphenylphosphine) palladium ) And a saturated aqueous sodium carbonate solution (1.5 ml) were added at room temperature and heated at 110 [deg.] C for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate) , 6%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.3 Hz, 6H), 1.46-1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), (M, 2H), 4.40-4.46 (m, 1H), 4.72 (d, J = 7.7Hz, 1H), 4.89-4.97 1H), 7.86 (s, 1H), 7.93 (d, J = 6.6 Hz, 2H), 8.05 (d, J = 6.8 Hz, 2H), 8.73 MS (ESI) m / z 440 ([M + H] &lt; ⁺ &gt;).

< Example  13> isopropyl 4 - ((7- (4- Carbamoyl -3- Fluorophenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-1-car Leucylate Manufacturing

To a solution of isopropyl 4 - ((7-bromothieno [3,2- d ] pyrimidin-4-yl) amino) piperidine- 1 -carboxylate , 0.13 mmol) was dissolved in 1,4-dioxane (1.5 ml), and then 4-carbamoyl-3-fluorophenylboronic acid (27 mg, 0.15 mmol) and tetrakis (triphenylphosphine) palladium , 0.006 mmol) and sodium carbonate saturated aqueous solution (1.5 ml) were added at room temperature and heated at 110 ° C for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate) , 42%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.3 Hz, 6H), 1.46-1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), (D, J = 7.7 Hz, 1H), 5.95 (s, 1H), 6.74 (s, 1H), 4.15-4.33 (m, 2H), 4.40-4.46 (D, J = 1.5 and 13.5 Hz, 1H), 8.20 (t, J = 8.3 Hz, 1H), 7.77 (dd, J = 1.6 and 8.2 Hz, 8.71 (s, 1 H); MS (ESI) m / z 493 ([M + H] &lt; ⁺ &gt;).

< Example  14> isopropyl 4 - ((7- (4- ( Trifluoromethoxy ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-1-car Leucylate Manufacturing

To a solution of isopropyl 4 - ((7-bromothieno [3,2- d ] pyrimidin-4-yl) amino) piperidine- 1 -carboxylate , 0.13 mmol) was dissolved in 1,4-dioxane (1.5 ml), and then 4- (trifluoromethoxy) phenylboronic acid (31 mg, 0.15 mmol) and tetrakis (triphenylphosphine) palladium , 0.006 mmol) and sodium carbonate saturated aqueous solution (1.5 ml) were added at room temperature and heated at 110 ° C for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography ( n -hexane: ethyl acetate = 1), the desired compound (46 mg, 77%) was obtained.

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.3 Hz, 6H), 1.46-1.58 (m, 2H), 2.12-2.20 (m, 2H), 2.95-3.06 (m, 2H), J = 7.7 Hz, 1H), 4.90-5.00 (m, 1H), 7.33 (d, J = 0.7 and 8.7 Hz, 1H) 2H), 7.77 (s, 1H), 7.94 (d, J = 8.8 Hz, 2H), 8.72 (s, 1H); MS (ESI) m / z 481 ([M + H] &lt; ⁺ &gt;).

< Example  15> t -Butyl 4- (methyl (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

A. t -Butyl 4 - ((7- Bromothieno [3,2- d ] Pyrimidine Yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

4-chlorothieno [3,2- d ] pyrimidine (200 mg, 0.80 mmol) was dissolved in DMSO (5 ml), and then 4-methylamino-1-Boc-piperidine , 0.821 mmol) at room temperature, and the mixture was stirred at 60 ° C for 5 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate, dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: ethyl acetate = 4: 1) , 91%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.48 (s, 9H), 1.68-1.83 (m, 4H), 2.80-2.98 (m, 2H), 3.31 (s, 3H), 4.15-4.38 (m, 2H ), 4.92-5.05 (m, 1 H), 7.75 (s, 1 H), 8.64 (s, 1 H); MS (ESI) m / z 427 ([M + H] &lt; ⁺ &gt;).

B. t -Butyl 4- (methyl (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

(100 mg, 0.23 mmol) was reacted with t -butyl 4 - ((7-bromothieno [3,2- d ] pyrimidin- (Methylsulfonyl) phenylboronic acid (56 mg, 0.28 mmol), tetrakis (triphenylphosphine) palladium (14 mg, 0.012 mmol) and a sodium bicarbonate saturated aqueous solution (2 ml) at room temperature, followed by stirring at 90 占 폚 for 24 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography ( n -hexane: ethyl acetate = 1: ). The obtained product was recrystallized from diethyl ether to obtain the above-mentioned compound (80 mg, 66%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.49 (s, 9H), 1.73-1.85 (m, 4H), 2.85-2.98 (m, 2H), 3.07 (s, 3H), 3.36 (s, 3H), J = 8.6 Hz, 2H), 8.62 (d, J = 8.6 Hz, 2H) (s, 1 H); MS (ESI) m / z 503 ([M + H] &lt; ⁺ &gt;).

< Example  16> isopropyl 4- (methyl (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidine-1-carboxylate

A. Isopropyl 4 - ((7- Bromothieno [3,2- d ] Pyrimidine Yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

4-chlorothieno [3,2- d ] pyrimidine (70 mg, 0.28 mmol) was dissolved in DMSO (3 ml) and isopropyl 4- (methylamino) piperidin- (130 mg, 0.65 mmol) was added at room temperature and stirred at the same temperature for 22 hours. Water was added to the reaction mixture, extracted with ethyl acetate, dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: ethyl acetate = 4: 1) mg, 94%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.2 Hz, 6H), 1.58-1.88 (m, 4H), 2.85-3.00 (m, 2H), 3.31 (s, 3H), 4.20- 4.49 (m, 2 H), 4.90 - 5.03 (m, 2 H), 7.76 (s, 1 H), 8.64 (s, 1 H); MS (ESI) m / z 413 ([M + H] &lt; ⁺ &gt;).

B. Isopropyl 4- (methyl (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

Isopropyl 4 - ((7-to-no-bomo [3,2- d] pyrimidin-4-yl) (methyl) amino) piperidine-1-carboxylate (50 mg, 0.12 mmol) 1 , Was dissolved in 4-dioxane (1.5 ml), and then 4- (methylsulfonyl) phenylboronic acid (29 mg, 0.15 mmol), tetrakis (triphenylphosphine) palladium (7 mg, 0.006 mmol) and sodium carbonate saturation Aqueous solution (1.5 ml) was added at room temperature and heated at 110 占 폚 for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography ( n -hexane: ethyl acetate = 1: ), The desired compound (22 mg, 37%) was obtained.

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.2 Hz, 6H), 1.73-1.87 (m, 4H), 2.89-2.99 (m, 2H), 3.06 (s, 3H), 3.35 ( 2H), 4.91-4.98 (m, 1H), 5.00-5.10 (m, 1H), 7.91 (s, 1H), 8.03 (d, J = 8.4 Hz, 2H) , 8.09 (d, J = 8.6 Hz, 2H), 8.61 (s, 1H); MS (ESI) m / z 489 ([M + H] &lt; ⁺ &gt;).

< Example  17> isopropyl 4 - ((7- (4- Carbamoyl -3- Chlorophenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

(7-bromothieno [3,2- d ] pyrimidin-4-yl) (methyl) amino) piperidine-1-carboxylate obtained in step 1 of Example 16 (50 mg, 0.12 mmol) was dissolved in 1,4-dioxane (1.5 ml), and then 4-carbamoyl-3- chlorophenylboronic acid (29 mg, 0.15 mmol), tetrakis (triphenylphosphine) palladium (7 mg, 0.006 mmol) and a saturated aqueous sodium carbonate solution (1.5 ml) at room temperature and heated at 110 &lt; 0 &gt; C for 24 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated sodium chloride aqueous solution and dried over magnesium sulfate. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate) , 54%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.26 (d, J = 6.2 Hz, 6H), 1.72-1.87 (m, 4H), 2.86-2.99 (m, 2H), 3.34 (s, 3H), 4.23- 1H), 7.84-7.94 (m, 3H), 8.04 (m, 2H) d, J = 1.5 Hz, 1 H), 8.61 (s, 1 H); MS (ESI) m / z 488 ([M + H] &lt; ⁺ &gt;).

< Example  18> N - (1- (5- Fluoropyrimidine Yl) piperidin-4-yl) - N - methyl -7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4- Amine  Produce

A.  N - methyl -7- (4- ( Methylsulfonyl ) Phenyl ) - N - (piperidin-4-yl) Tieno [3,2- d ] Pyrimidin-4-amine

D ] pyrimidin-4-yl) amino) piperidine obtained in the step 2 of Example 15 above was used instead of t -butyl 4- (methyl (7- (4- (methylsulfonyl) phenyl) thieno [ Carboxylate (576 mg, 1.15 mmol) was dissolved in dichloromethane (12 ml), trifluoroacetic acid (3 ml) was added at 0 ° C, and the mixture was stirred at room temperature for 2 hours. After completion of the reaction, the reaction mixture was concentrated under reduced pressure. The residue was dissolved in chloroform, and a 2M aqueous solution of sodium hydroxide was added to adjust the pH to 8-9. The organic layer was washed with a saturated aqueous sodium chloride solution, dried over magnesium sulfate, and then the solvent was removed under reduced pressure to obtain the desired compound (282 mg, 61%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.77-1.94 (m, 4H), 1.86 (s, 1H), 2.80-2.89 (m, 2H), 3.07 (s, 3H), 3.22-3.29 (m, 2H (D, J = 8.3 Hz, 2H), 3.36 (s, 3H), 4.86-4.96 (s, 1 H); MS (ESI) m / z 403 ([M + H] &lt; ⁺ &gt;).

B. N - (1- (5- Fluoropyrimidine Yl) piperidin-4-yl) - N - methyl -7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-amine

N - methyl-7- (4- (methylsulfonyl) phenyl) - N - (piperidin-4-yl) thieno [3,2- d] pyrimidin-4-amine (30 mg, 0.08 mmol) (25 mg, 0.19 mmol) were dissolved in dichloromethane (2 ml) and DMF (1 drop), DIPEA (0.1 ml) was added at room temperature, and the mixture was stirred at 40 ° C for 18 hours Respectively. After concentrating under reduced pressure, the residue was subjected to silica gel column chromatography ( n -hexane: ethyl acetate = 1: 1) to obtain the desired compound (8 mg, 22%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.80-1.94 (m, 4H), 3.07 (s, 3H), 3.03-3.10 (m, 2H), 3.34 (s, 3H), 4.86-4.95 (m, 2H ), 8.12 (d, J = 8.4 Hz, 2H), 8.22 (s, 2H), 8.64 (s, 1 H); MS (ESI) m / z 499 ([M + H] &lt; ⁺ &gt;).

< Example  19> N - (1- (5- Ethylpyrimidine Yl) piperidin-4-yl) - N - methyl -7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4- Amine  Produce

N obtained by the step 1 in Example 18-methyl-7- (4- (methylsulfonyl) phenyl) - N - (piperidin-4-yl) thieno [3,2- d] pyrimidine - 4-amine (30 mg, 0.08 mmol) and 2-chloro-5-ethylpyrimidine (33 mg, 0.23 mmol) were dissolved in DMF (2 ml), TEA (0.15 ml) was added at room temperature, Lt; / RTI &gt; After concentrating under reduced pressure, the residue was subjected to silica gel column chromatography ( n -hexane: ethyl acetate = 1: 2) to obtain the desired compound (24 mg, 63%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.19 (t, J = 7.6 Hz, 3H), 1.80-1.92 (m, 4H), 2.45-2.50 (m, 2H), 3.06 (s, 3H), 3.04- 2H), 3.91 (d, J = 8.5 Hz, 2H) , 8.09 (d, J = 8.5 Hz, 2H), 8.18 (s, 2H), 8.62 (s, 1H); MS (ESI) m / z 509 ([M + H] &lt; ⁺ &gt;).

< Example  20> Cyclopropyl  (4- (Methyl (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-1-yl) Methanone  Produce

Methyl-7- (4- (methylsulfonyl) phenyl) - Example 18 (a) N obtained through the N - (piperidin-4-yl) thieno [3,2- d] pyrimidin -4 -Amine (30 mg, 0.08 mmol) and cyclopropanecarbonyl chloride (20 mg, 0.19 mmol) were dissolved in dichloromethane (2 ml) and DMF (1 drop), TEA (0.1 ml) was added at room temperature, Lt; / RTI &gt; for 18 hours. After concentrating under reduced pressure, the residue was subjected to silica gel column chromatography (ethyl acetate) to obtain the desired compound (17 mg, 48%).

^{1 H NMR (500 MHz, CDCl} 3) δ 0.90-0.94 (m, 2H), 1.13-1.18 (m, 2H), 1.76-1.90 (m, 5H), 2.71-2.83 (m, 1H), 3.09 (s 1H), 3.38 (s, 3H), 4.37-4.47 (m, 1H), 4.78-4.92 (m, 1H), 5.13-5.22 , 8.03 (d, J = 8.6 Hz, 2H), 8.63 (s, 1H); MS (ESI) m / z 471 ([M + H] &lt; ⁺ &gt;).

< Example  21> 2- methyl -1- (4- (Methyl (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2- d ] Pyrimidin-4-yl) amino) piperidin-1-yl) propan-

Methyl-7- (4- (methylsulfonyl) phenyl) - Example 18 N obtained through the step of the N - (piperidin-4-yl) thieno [3,2-d] pyrimidine - After dissolving 4-amine (30 mg, 0.08 mmol) and isobutyryl chloride (20 mg, 0.19 mmol) in dichloromethane (2 ml) and DMF (1 drop), TEA (0.1 ml) was added at room temperature Stir for 18 hours. After concentrating under reduced pressure, the residue was subjected to silica gel column chromatography (ethyl acetate) to obtain the desired compound (14 mg, 40%).

^{1 H NMR (500 MHz, CDCl} 3) δ 1.17 (d, J = 10.2 Hz, 6H), 1.79-1.82 (m, 2H), 1.85-1.98 (m, 2H), 2.68-2.75 (m, 1H), (M, 1H), 2.82-2.90 (m, 1H), 3.07 (s, 3H), 3.21-3.30 8.50 (s, 1H), 8.04 (d, J = 8.5 Hz, 2H), 8.08 (d, J = 8.5 Hz, 2H), 8.62 MS (ESI) m / z 473 ([M + H] &lt; ⁺ &gt;).

< Example  22> tert Butyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- yl Amino) methyl ) Piperidin-l- Carboxylate  Produce

A. tert -Butyl 4 - ((7- Bromothieno [3,2-d] pyrimidine -4- Amino ) methyl ) Piperidin-l- Carboxylate  Produce

To a solution of 7-bromo-4-chlorothieno [3,2-d] pyrimidine (200 mg, 0.802 mmol) and tert- butyl 4- (aminomethyl) piperidine- mmol) were added to DMSO, followed by stirring at room temperature for 14 hours. Extracted with EtAcO after the reaction was completed, MgSO been dried over ₄ by solidifying in EtAcO / hexanes to give the desired compound (300 mg, 88%).

^{1 H NMR (300 MHz, CDCl} 3) δ 8.73 (s, 1H), 7.71 (s, 1H), 5.09-5.05 (m, 1H), 4.14-4.11 (m, 2H), 3.60-3.57 (m, 2H ), 2.73-2.66 (m, 2H), 1.89-1.86 (m, 1H), 1.79-1.75 (m, 2H)

 B. tert Butyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- yl Amino) methyl ) Piperidin-l- Carboxylate  Produce

carboxylate (250 mg, 0.585 mmol) and 4- ((4-fluoropyridin- Methylsulfonyl) phenylboronic acid (140 mg, 0.702 mmol) and tetrakistriphenylphosphine (34 mg, 0.029 mmol) were added to 1,4-dioxane (7 mL). NaHCO ₃ (147 mg, 1.76 mmol) was dissolved in water (10 mL), and the solution was refluxed for 8 hours. After completion of the reaction, the reaction mixture was extracted with EtAcO, dried over MgSO ₄ and then separated into a column to obtain the desired compound (193 mg, 66%).

^{1 H NMR (500 MHz, CDCl} 3) δ 8.72 (s, 1H), 8.14 (d, J = 8.5 Hz, 2H), 8.05 (d, J = 8.5 Hz, 2H), 7.90 (s, 1H), 5.05 (t, J = 5.8 Hz, 1H), 4.17-4.13 (m, 2H), 3.63-3.62 (m, 2H), 3.08 (s, 3H), 2.74-2.71 (m, 1H), 1.93-1.91 (m , 1.81-1.78 (m, 2H), 1.46 (s, 9H), 1.27-1. 23 (m, 2H)

< Example  23> isopropyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Amino ) methyl ) Piperidine-1-carboxylate &lt; / RTI &gt;

thiopyrimidin-4-ylamino) methyl) piperidine-1-carboxylate (prepared from 80 mg &lt; RTI ID = 0.0 & , 0.165 mmol) was added 4M HCl in dioxane (5 mL), and the mixture was stirred at room temperature for 1 hour. After completion of the reaction, the mixture was filtered and concentrated under reduced pressure. 1.0 M of isopropyl chloroformate dissolved in toluene (0.13 mL, 0.133 mmol) and TEA (0.05 mL, 0.379 mmol) were dissolved in dichloromethane, followed by stirring overnight at room temperature. After completion of the reaction, the reaction mixture was extracted with dichloromethane, dried over MgSO ₄ , concentrated under reduced pressure, and then separated into a column to obtain the desired compound (48 mg, 60%).

^{1 H NMR (500 MHz, CDCl} 3) δ 8.71 (s, 1H), 8.14 (d, J = 8.3 Hz, 2H), 8.05 (d, J = 8.3 Hz, 2H), 7.91 (s, 1H), 5.10 2H), 3.96-3.61 (m, 2H), 3.08 (s, 3H), 2.75-2.74 (m, 2H) , 1.95-1.93 (m, 1H), 1.83-1.79 (m, 2H), 1.30-1.29 (m, 1H), 1.24 (d, J = 6.2 Hz, 6H)

< Example  24> tert -Butyl 4 - ((methyl (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) amino) methyl ) Piperidin-l- Carboxylate  Produce

thiopyrimidin-4-ylamino) methyl) piperidine-1-carboxylate (prepared from tert-butyl 4 - ((7- (4- (methylsulfonyl) phenyl) thieno [3,2- , 0.099 mmol) and sodium hydride (4 mg, 0.149 mmol) were added to DMF (2 mL) and the temperature was lowered to 0 ° C. Methyl iodide (0.01 mL, 0.149 mmol) was slowly added thereto, and the temperature was gradually raised to room temperature, followed by stirring for 1 hour. After completion of the reaction, the reaction mixture was extracted with EA, dried over MgSO ₄ , concentrated under reduced pressure, and then subjected to column chromatography to obtain the desired compound (10 mg, 20%).

^{1 H NMR (300 MHz, CDCl} 3) δ 8.62 (s, 1H), 8.10 (d, J = 8.4 Hz, 2H), 8.05 (d, J = 8.4 Hz, 2H), 7.91 (s, 1H), 4.17 2H), 3.73-3.74 (m, 2H), 3.53 (s, 3H), 3.08 (s, 3H), 2.70-2.63 -1.69 (m, 2H), 1.45 (s, 9H), 1.28 - 1.24 (m, 2H)

< Example  25> tert Butyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Sake ) methyl ) Piperidin-l- Carboxylate  Produce

A. tert -Butyl 4 - ((7- Bromothieno [3,2-d] pyrimidine -4- Sake ) methyl ) Piperidin-l- Carboxylate  Produce

(300 mg, 1.20 mmol) and tert-butyl 4- (hydroxymethyl) piperidine-1-carboxylate (388 mg, 1.80 mmol) were added to a solution of 7-bromo-4-chlorothieno [ mmol) was added to THF (10 mL), NaH (173 mg, 7.21 mmol) was added, and the mixture was stirred at room temperature overnight. After completion of the reaction, the reaction mixture was extracted with EtAcO. The extract was dried over MgSO ₄ , concentrated under reduced pressure and purified by column chromatography to obtain the desired compound (496 mg, 96%).

^{1 H NMR (500 MHz, CDCl} 3) δ 8.85 (s, 1H), 7.86 (s, 1H), 4.47 (d, J = 6.6 Hz, 2H), 4.18-4.16 (m, 2H), 2.78-2.74 ( 2H), 1.46 (s, 9H), 1.33-1.28 (m, 2H), 2.09-2.05 (m,

B. tert Butyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Sake ) methyl ) Piperidin-l- Carboxylate  Produce

Was prepared in the same manner as in the step B of Example 22.

^{1 H NMR (300 MHz, CDCl} 3) δ 8.84 (s, 1H), 8.17 (d, J = 8.4Hz, 2H), 8.07-8.05 (m, 3H), 4.49 (d, J = 6.5 Hz), 2H 2H), 1.47 (s, 9H), &lt; RTI ID = 0.0 &gt; ), 1.35-1.26 (m, 2H)

< Example  26> 1- Methylcyclopropyl -4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

A. 1- Methylcyclopropyl -4-( Methyl amino ) Piperidin-l- Carboxylate  Produce

1,2-Dichloroethane (30 mL) was added to 1-methylcyclopropyl-4-piperidone (1.0 g, 5.02 mmol) and sodium triacetoxyborohydride (2.1 g, 10.0 mmol) (0.02 mL, 6.52 mmol) was added slowly and the mixture was stirred at room temperature for 12 hours. After completion of the reaction, the reaction mixture was filtered and concentrated under reduced pressure to obtain the target compound.

 B. 1- Methylcyclopropyl -4 - ((7- Bromothieno [3,2-d] pyrimidine Yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

The title compound was synthesized in the same manner as in the step A of Example 22.

C. 1- Methylcyclopropyl -4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

The title compound was synthesized in the same manner as in the step B of Example 22.

MH + 519

< Example  27> tert -Butyl 4- (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Amino ) Ajay Pan -One- Carboxylate

A. tert -Butyl 4- (7- Bromothieno [3,2-d] pyrimidine -4- yl Amino) Ajay Pan -One- Carboxyl Manufacture of rate

The title compound was synthesized in the same manner as in Example 22.

^{1 H NMR (500 MHz, CDCl} 3) δ8.72 (s, 1H), 7.70 (s, 1H), 4.96-4.89 (m, 1H), 4.45-4.37 (m, 1H), 3.85-3.64 (m, 1H), 2.08-2.05 (m, 1H), 1.93-1.30 (m, 1H), 3.58-3.57 1.71 (m, 3H), 1.48 (s, 9H), 1.25-1.24 (m, 1H)

B. tert -Butyl 4- (7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- yl Amino) Ajay Pan -One- Carboxylate  Produce

The title compound was synthesized in the same manner as in the step B of Example 22.

^{1 H NMR (300 MHz, CDCl} 3) δ 8.71 (s, 1H), 8.13 (d, J = 8.3 Hz, 2H), 8.04 (d, J = 8.3 Hz, 2H), 7.89 (s, 1H), 4.92 2H), 3.83-3.16 (m, 2H), 3.08 (s, 3H), 2.28-2.22 (m, , 2.13-2.05 (m, 1H), 1.96-1.67 (m, 4H), 1.50 (s, 9H)

< Example  28> isopropyl 4 - ((7- (4- ( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Sake ) methyl ) Piperidin-l- Carboxylate  Produce

thiopyridin-4-yloxy) methyl) piperidine-1-carboxylate (102 mg, , 0.203 mmol) were added to 4.0 M HCl in 1,4-dioxane (10 mL) and stirred overnight. After the solvent was removed under reduced pressure, 1.0 M of isopropyl chloroformate dissolved in toluene (0.18 mL, 0.177 mmol) and TEA (0.03 mL, 0.205 mmol) were dissolved in dichloromethane (1 mL) and the mixture was stirred at room temperature overnight . After the reaction was completed, the reaction mixture was extracted with dichloromethane, dried over MgSO ₄ , concentrated under reduced pressure, and then separated into a column to obtain the desired compound (10 mg, 10%)

< Example  29> 4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-1-car Leucylate Manufacturing

A. tert -Butyl 4- ( Methyl amino ) Piperidin-l- Carboxylate  Produce

1,2-Dichloroethane (30 mL) was added to 1-Boc-4-piperidone (1.0 g, 5.02 mmol) and sodium triacetoxyborohydride (2.1 g, 10.0 mmol) mL, 6.52 mmol) was added slowly and the mixture was stirred at room temperature for 12 hours. After completion of the reaction, the reaction mixture was filtered and concentrated under reduced pressure to obtain the title compound (582 mg, 54%)

^{1 H NMR (300 MHz, CDCl} 3) δ4.05-4.02 (m, 2H), 2.84-2.76 (m, 2H), 2.52-2.47 (m, 1H), 2.45 (s, 3H), 1.87-1.83 ( m, 2H), 1.46 (s, 9H0, 1.28 - 1.20 (m, 2H)

B. tert -Butyl 4 - ((7- Bromothieno [3,2-d] pyrimidine Yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

The title compound was synthesized in the same manner as in the step A of Example 22.

¹ H NMR (300 MHz, DMSO- d ₆ )? 8.5 (s, IH), 8.42 (s, IH), 4.89-4.85 (m, ), 2.88-2.81 (m, 2H), 1.70-1.69 (m, 4H), 1.41 (s, 9H)

C. tert -Butyl 4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

The title compound was synthesized in the same manner as in the step B of Example 22.

^{1 H NMR (300 MHz, MeOH-} d 4) δ 8.43 (s, 1H), 8.30 (s, 1H), 8.09-8.05 (m, 1H), 7.89-7.83 (m, 2H), 5.08-5.03 (m 3H), 2.99-2.93 (m, 2H), 1.88-1.82 (m, 4H), 1.49 (s, 9H) )

< Example  30> isopropyl 4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

The title compound was synthesized in the same manner as in the step A of Example 22.

_{^{1 H NMR (300MHz, CDCl 3}} ) δ8.44 (s, 1H), 8.30 (s, 1H), 8.10-8.05 (m, 1H), 7.90 -7.84 (m, 2H), 5.11-5.05 (m, 1H ), 4.96-4.92 (m, 1H), 4.34-4.30 (m, 2H), 3.41 (s, 3H), 3.22 (s, 3H), 3.06-2.96 ), 1.29 (d, J = 6.2 Hz, 6 H)

< Example  31> tert -Butyl 4- (7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Amino ) Piperidin-1-car Leucylate Manufacturing

A. tert -Butyl 4- (7- Bromothieno [3,2-d] pyrimidine -4- yl Amino) piperidin-l- Carboxylate  Produce

The title compound was synthesized in the same manner as in the step B of Example 29,

^{1 H NMR (300 MHz, DMSO-} d 6) δ 8.51 (s, 1H), 8.30 (s, 1H), 7.93 (d, J = 7.4 Hz, 1H), 4.35-4.28 (m, 1H), 4.00- 2H), 1.91-1.87 (m, 2H), 1.48-1.41 (m, 11H)

B. tert -Butyl 4- (7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Amino ) Piperidin-l- Carboxylate  Produce

The title compound was synthesized in the same manner as in the step B of Example 22.

^{1 H NMR (300 MHz, DMSO-} d 6) δ8.50 (s, 1H), 8.47 (s, 1H), 8.27-8.25 (m, 1H), 7.92-7.87 (m, 2H), 4.37-4.33 ( 2H), 1.98-1.90 (m, 2H), 1.52-1.36 (m, 12H)

< Example  32> (4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-1-yl) (5- Isopropyl isoxazole -3 days) Meta-discussion  Produce

thiopyrimidin-4-yl) (methyl) amino) piperidine-l- (2-fluoro-4- -Carboxylate (77 mg, 0.153 mmol) were added to 4.0 M HCl in 1,4-dioxane (2 mL) and stirred for 4 hours. The solvent was then removed under reduced pressure, then CH ₂ Cl ₂ (29 mg, 0.183 mmol), N, N-diisopropylethylamine (0.08 mL, 0.458 mmol), 1-hydroxybenzotriazole (27 mg ^{, 0.198 mmol), N 1 -} (( ethyl-butylimino) methylene) -N ^3, N ³ - dimethyl-propane-1,3-diamine hydrochloride (38 mg, and then put gave an additional 0.198 mmol), for 8 hours Lt; / RTI &gt; Water was added to the reaction mixture, and the mixture was extracted with CH ₂ Cl _{2. The} organic layer was dried over magnesium sulfate, and the solvent was removed under reduced pressure. The residue was chromatographed on silica gel column to obtain the desired compound (58 mg, 72%).

^{1 H NMR (300 MHz, MeOH-} d 4) δ8.60 (s, 1H), 8.37 (s, 1H), 8.09-8.04 (m, 1H), 7.90-7.83 (m, 2H), 6.39 (s, (M, 2H), 2.05-1.89 (m, 2H), 3.45 (s, 3H), 3.24 4H), 1.36-1.28 (d, J = 7.0 Hz, 6 H)

< Example  33> 7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) -N- (1- (3-isopropyl-l, 2,4- Oxadiazole Yl) piperidin-4-yl) -N- Methylthieno [3,2-d] pyrimidine -4- Amine  Produce

thiopyrimidin-4-yl) (methyl) amino) piperidine-l- (2-fluoro-4- -Carboxylate (86 mg, 0.166 mmol) was added to 4.0 M HCl in 1,4-dioxane (2 mL) and stirred for 4 hours. Then, the solvent was removed under reduced pressure, and then Na ₂ CO ₃ (53 mg, 0.499 mmol) dissolved in a minimum amount of water was added to the solvent of CH ₂ Cl ₂ (2 mL) and stirred overnight. This CH ₂ Cl ₂ and extracted with dry, remove the solvent after the organic layer with Na ₂ SO ₄ under reduced pressure, MeOH (2 mL) into a solvent 3-isopropyl-5- (trichloromethyl) -1,2,4 -Oxadiazole (46 mg, 0.200 mmol) were added and the mixture was stirred at 70 캜 for two days. Thereafter, the mixture was cooled to room temperature, and the reaction mixture was coated with silica gel and then separated by column chromatography to obtain the target compound.

^{1 H NMR (500 MHz, CDCl} 3) δ8.61 (s, 1H), 8.30 (t, J = 8.0 Hz, 1H), 8.10 (s, 1H), 7.86 (d, J = 8.0 Hz, 1H), 7.79 (d, J = 8.0Hz, 1H), 5.27-5.25 (m, 1H), 4.93 (d, J = 13.0 Hz, 2H), 4.31 (d, J = 13.0 Hz), 3.41-3.35 (m, 4H ), 3.22-3.16 (m, 1H) , 3.09 (s, 1H), 3.04-2.99 (m, 1H), 2.04-2.00 (m, 1H), 1.94-1.88 (m, 4H), 1.39 (d, J = 6.8 Hz, 6H)

< Example  34> 1,1,1- Trifluoro -2- Methyl propane -2-yl 4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

A. 1,1,1- Trifluoro -2- Methyl propane Yl-1H- Imidazole -One- Carboxylate  Produce

N, N'-carbonyldiimidazole (1.33 g, 8.20 mmol) was dissolved in chloroform (10 mL) and 2-fluoromethyl-2-propanol (0.84 mL, 7.81 mmol) Lt; / RTI &gt; After completion of the reaction, the reaction mixture was extracted with CH ₂ Cl ₂ , dried with MgSO ₄ , filtered, concentrated under reduced pressure, and then separated by column chromatography to obtain the target compound.

^{1 H NMR (500 MHz, CDCl} 3) δ8.09 (s, 1H), 7.37 (s, 1H), 7.08 (s, 1H), 1.84 (s, 6H)

B. 1,1,1- Trifluoro -2- Methyl propane -2-yl 4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-l- Carboxylate  Produce

yl) (methyl) amino) piperidine-l- (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2-d] pyrimidin- -Carboxylate (114 mg, 0.219 mmol) was taken in 4.0 M HCl in 1,4-dioxane (3 mL) and stirred overnight. The solvent was then removed under reduced pressure, and the residue was added to methanol (2 mL), followed by TEA (0.03 mL, 0.230 mmol). To the solution was added 3-methyl-1 - ((1,1,1-trifluoro-2-methylpropan-2- yloxy) carbonyl) -1H-imidazol-3-trifluoromethanesulfonate 93 mg, 0.241 mmol), which was stirred overnight at room temperature. After completion of the reaction, the reaction mixture was extracted with EtAcO, dried over MgSO ₄ , filtered, concentrated under reduced pressure, and then separated by column chromatography to obtain the desired compound (49 mg, 39%).

^{1 H NMR (300 MHz, MeOH-} d 4) δ8.43 (s, 1H), 8.30 (s, 1H), 8.09-8.04 (m, 1H), 7.89-7.83 (m, 2H), 5.11-5.06 ( (s, 3H), 3.08-2.96 (m, 2H), 1.90-1.84 (m, 4H), 1.71 (s, 3H) 6H)

< Example  (4 - ((7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) ( methyl ) Amino) piperidin-1-yl) (5- Methyl isoxazole -3 days) Meta-discussion  Produce

The title compound was synthesized in the same manner as in the step A of Example 32,

^{1 H NMR (300 MHz, MeOH-} d 4) δ8.44 (s, 1H), 8.30 (s, 1H), 8.09-8.04 (m, 1H), 7.90-7.83 (m, 2H), 6.38 (s, (M, 2H), 2.49 (s, 3H), 3.21 (s, 3H), 3.08-3.00 , 1.98-1.92 (m, 4H)

<Example 36> (5-cyclopropyl yisook-3-yl) (4 - ((7- (2-fluoro-4- (methylsulfonyl) phenyl) thieno [3,2-d] pyrimidine Yl) (methyl) amino) piperidin-1-yl) methanone

The title compound was synthesized in the same manner as in the step A of Example 32,

^{1 H NMR (300 MHz, MeOH-} d 4) δ 8.44 (s, 1H), 8.30 (s, 1H), 8.09-8.04 (m, 1H), 7.89-7.83 (m, 2H), 6.31 (s, 1H ), 5.26-5.18 (m, IH), 4.86-4.81 (m, IH), 4.35-4.31 (m, IH), 3.43 (s, ), 2.21-2.17 (m, 1H), 2.00-1.91 (m, 4H), 1.17-1.13 (m, 2H), 1.01-0.98

< Example  37> tert -Butyl 4- (7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Sake ) Piperidin-l- Carboxylate  Produce

A. tert -Butyl 4- (7- Bromothieno [3,2-d] pyrimidine -4- Sake ) Piperidin-l- Carboxylate  Produce

The title compound was synthesized by the same procedure as in the step A of Example 25.

^{1 H NMR (500 MHz, CDCl} 3) δ 8.84 (s, 1H), 7.87 (s, 1H), 5.60-5.55 (m, 1H), 3.83-3.79 (m, 2H), 3.39-3.31 (m, 2H ), 2.12-2.06 (m, 2H), 1.88-1.84 (m, 2H), 1.48 (s, 9H)

B. tert -Butyl 4- (7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- Sake ) Piperidin-l- Carboxylate  Produce

The title compound was synthesized by the same procedure as in the step B of Example 22.

^{1 H NMR (300 MHz, CDCl} 3) δ 8.81 (s, 1H), 8.42 (t, J = 7.5 Hz, 1H), 8.25 (s, 1H), 7.90-7.79 (m, 2H), 5.64-5.59 ( 2H), 1.49 (m, 2H), 1.49 (m, 2H), 3.91-3. s, 9H)

< Example  38> (5- Cyclopropyl isoxazole Yl) (4- (7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- yl oxy ) &Lt; RTI ID = 0.0 &gt; piperidin-1-yl) Meta-discussion  Produce

The title compound was synthesized by the same procedure as in the step A of Example 33.

_{^{1 H NMR (300MHz, CDCl 3}} ) δ8.82 (s, 1H), 8.43 (t, J = 7.4Hz, 1H), 8.27 (s, 1H), 7.90-7.79 (m, 2H), 6.21 (s, 3H), 2.32-2.16 (m, 2H), 2.11-2.01 (m, 2H) m, 2H), 1.15-1.04 (m, 4H)

<Example 39> (4- (7- (4- (methylsulfonyl 2-fluoro) phenyl) thieno [3,2-d] pyrimidin-4-yloxy) piperidin-1-yl ) (5-isopropylisoxazol-3-yl) methanone

The title compound was synthesized in the same manner as in the step A of Example 32,

^{1 H NMR (300 MHz, CDCl} 3) δ 8.82 (s, 1H), 8.43 (t, J = 7.9 Hz, 1H), 8.28 (s, 1H), 7.91-7.79 (m, 2H), 6.31 (s, 2H), 3.15-3.11 (m, 4H), 2.27-2.17 (m, 2H), 2.11- 2.04 (m, 2H), 1.35 (d, J = 10.9 Hz, 6H)

< Example  40> tert -Butyl 4- (ethyl (7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4-yl) amino) piperidin-l- Carboxylate  Produce

A. tert -Butyl 4 - ((7- Bromothieno [3,2-d] pyrimidine -4- yl ) (Ethyl) amino) piperidin-l- Carboxylate  Produce

The title compound was synthesized by the same procedure as in the step A of Example 22.

^{1 H NMR (300 MHz, CDCl} 3) δ 8.66 (s, 1H), 7.75 (s, 1H), 4.94 (m, 1H), 4.35-4.26 (m, 2H), 3.74 (q, J = 6.9 Hz, 2H), 2.92-2.84 (m, 2H), 1.83-1.74 (m, 4H) 1.49 (s, 9H), 1.33 (t, J = 6.9 Hz,

B. tert -Butyl 4- (ethyl (7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) Tieno [3,2-d] pyrimidin-4- yl ) Amino) piperidine-1-carboxylate

The title compound was synthesized by the same procedure as in the step B of Example 22.

^{1 H NMR (300 MHz, CDCl} 3) δ 8.68 (s, 1H), 8.14-8.04 (m, 2H), 7.93-7.80 (m, 2H), 5.10-5.04 (m, 1H), 4.38-4.27 (m , 2H), 3.93-3.82 (m, 2H), 3.13 (s, 3H), 2.98-2.86 (m, 2H), 1.95-1.84 (m, 4H), 1.51 (s, 9H), 1.26 (t, J = 7.2 Hz, 3 H)

< Example  41> 7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) -N- (3- (2-isopropyl-2H- Tetrazole Yl) propyl) Tieno [ 3,2-d] pyrimidine -4- Amine  Produce

A. 7- Bromo -N- (3- (2-isopropyl-2H- Tetrazole Yl) propyl) Tieno [3,2-d] pyrimidin-4- Amine  Produce

(180 mg, 0.721 mmol) and 3- (2-isopropyl-2H-tetrazol-5-yl) propan- 1- amine hydrochloride Chloride (445 mg, 2.16 mmol) was added to DMSO (4 mL) and the mixture was stirred at room temperature for 14 hours. After completion of the reaction, the reaction mixture was extracted with EtAcO, dried over MgSO ₄ and solidified with EtAcO / hexane to obtain the target compound (233 mg, 85%).

^{1 H NMR (300 MHz, CDCl} 3) δ 8.72 (s, 1H), 7.71 (s, 1H), 5.06-4.97 (m, 1H), 3.83-3.79 (m, 2H), 3.07-3.03 (m, 2H ), 2.28-2.21 (m, 2H), 1.63 (d, J = 6.9 Hz)

B. 7- (2- Fluoro -4-( Methylsulfonyl ) Phenyl ) -N- (3- (2-isopropyl-2H- Tetrazole -5- yl )profile) Tieno [3,2-d] pyrimidin-4- Amine  Produce

^{1 H NMR (300 MHz, CDCl} 3) δ 8.68 (s, 1H), 8.43-8.38 (m, 1H), 8.07 (s, 1H), 7.88-7.77 (m, 2H), 5.04-5.00 (m, 1H ), 3.85-3.80 (m, 2H), 3.10-3.05 (m, 5H), 2.30-2.22 (m, 2H), 1.63 (d, J = 6.6 Hz,

Experimental Example

< Experimental Example  1> Pharmacological activity confirmation experiment ( GPR119  Hyperactivity activity)

The GPR119 expression vector was prepared by first extracting total RNA from Caco-2 cells with RNA extraction solution (Invitrogen, USA), synthesizing cDNA using cDNA synthesis kit (Bioneer, Korea), and then performing primer (forward direction: GTAAGTGAAGTCCTGCCACTTCG, TGAAATTCTCTGCCCTTACCG) and cloned into pTARGET (Promega, USA) vector. To see the effect of GPR119, CRE reporter vector (Promega, USA) and pTARGET GPR119 vector were introduced into CHO-K1 using lipofectamine (lipofectamine, Invitogen, USA). After introducing the two vectors, C2-C5 clone cells (50 μg / ml, G418, USA, USA) and 200 μg / ml Hygromycin B (Invitrogen, USA) . The GPR119 agonist was selected using CHO-K1-GPR119-C2-C5 cells (hereinafter referred to as clonal cells) and the EC ₅₀ of the agonist was determined. Clonal cells were maintained in RPMI (Gibco, USA), 10% FBS (Gibco, USA) and penicillin / streptomycin (Gibco, USA).

First, 30,000 clones per well were placed in a 96-well plate and cultured for 24 hours. After incubation for 24 hours, the compounds of the present invention were treated with the compounds of the present invention. After 6 hours, the medium was discarded and treated with reproter lysis buffer (Promega, USA) and stored at -70 ° C for 30 minutes. After storage and thawing at room temperature, the activity of the GPR 119 agonist was measured using a Luciferase assay kit (Thermo Scientific, USA). The EC ₅₀ value was determined using Prism 4 (GraphPad Inc. USA) program by adding the active concentration of the compound and the results are shown in Table 1 below.

compound GPR119 agonistic activity (EC ₅₀ , nM) Example 1 (Formula 2) <100 Example 2 (Formula 3) <100 Example 4 (Formula 5) <100 Example 6 (Formula 7) <100 Example 9 (Formula 10) <100 Example 15 (Formula 16) <100 Example 16 (Formula 17) <100 Example 26 (Formula 27) <100 Example 29 (Formula 30) <100

As shown in Table 2, the compounds according to the present invention exhibited GPR119 agonistic activity having an EC ₅₀ value of less than or equal to μM, And thienopyrimidine derivatives of 30 have an EC ₅₀ value of less than or equal to 100 nM for GPR119.

Therefore, the compounds shown in the examples of the present invention exhibit excellent GPR119 agonizing activity, and thus can be useful as a therapeutic agent for diabetes with abnormal blood glucose levels.

Meanwhile, the thienopyrimidine derivative represented by the formula (1) according to the present invention can be formulated into various forms depending on the purpose. Hereinafter, some formulation methods in which the compound represented by Formula 1 according to the present invention is contained as an active ingredient are exemplified, and the present invention is not limited thereto.

< Formulation example  1> Sanje  Produce

2 g of the thienopyrimidine derivative of the formula (1)

Lactose 1 g

The objective components were mixed and filled in airtight bags to prepare powders.

< Formulation example  2> Preparation of tablets

100 mg of the thienopyrimidine derivative of the formula (1)

Corn starch 100 mg

Lactose 100 mg

2 mg of magnesium stearate

After the desired components were mixed, tablets were prepared by tableting according to a conventional method for producing tablets.

< Formulation example  3> Preparation of capsules

100 mg of the thienopyrimidine derivative of the formula (1)

Corn starch 100 mg

Lactose 100 mg

2 mg of magnesium stearate

After the objective components were mixed, they were filled in gelatin capsules according to the conventional preparation method of capsules to prepare capsules.

< Formulation example  4> Preparation of injection

100 mg of the thienopyrimidine derivative of the formula (1)

180 mg mannitol

Na ₂ HPO ₄ .2H ₂ O 26 mg

2974 mg of distilled water

According to the conventional method for preparing an injectable preparation, an injectable preparation was prepared by incorporating the aforementioned components in the amounts indicated.

Claims (8)

A thienopyrimidine derivative represented by the following formula (1): &lt; EMI ID =
Formula 1

In the above formula, Y is C ₁ -C ₆ alkyl; C ₁ -C ₆ alkylcarbonyl; C ₃ -C ₆ cycloalkylcarbonyl; C ₁ -C ₆ alkoxycarbonyl; C ₃ -C ₆ cycloalkoxycarbonyl; C ₁ -C ₆ alkylaminocarbonyl; Oxazole carbonyl; C ₃ -C ₆ cycloalkylsulfonyl; Or pyrimidine or oxadiazole substituted with C ₁ -C ₆ linear or branched alkyl; R is a heteroatom cycloalkyl or tetrazole of 5-to 8-membered rings containing one nitrogen atom as a heteroatom in the ring; X is -NA ₁ - or -O-, A ₁ is hydrogen or C ₁ -C ₆ alkyl; Ar is halogen, unsubstituted or halogen-substituted C ₁ -C ₆ alkoxy, C ₁ -C ₆ alkyl sulfonyl, and aminocarbonyl-phenyl substituted by one or more substituents selected from the group consisting of a; n is an integer of 0-5.
The heterocyclic cyclohexyl ring according to claim 1, wherein the heteroaromatic ring of R is a piperidine or azepane ring having 5-to 8-ring rings containing one nitrogen atom as a hetero atom in the ring; X is -NA ₁ - or -O-, A ₁ is hydrogen or C ₁ -C ₃ alkyl; And n is an integer of 0-4. The thienopyrimidine derivative or a pharmaceutically acceptable salt thereof.
The compound according to claim 1, wherein Y is isopropylcarbonyl, cyclopropylcarbonyl, isopropoxycarbonyl, 1-methylcyclopropoxycarbonyl, t-butoxycarbonyl, isopropylaminocarbonyl, Trifluoromethylcarbonyl, methylisoxazolecarbonyl or cyclopropylisoxazolecarbonyl; or a pharmaceutically acceptable salt thereof, wherein R &lt; 1 &gt;, R &lt; 2 &gt; Wherein X is _{-NH-, -NCH 3 -, -N-} CH 2 CH 3 - or -O-, and; Ar is phenyl substituted with one or more substituents selected from the group consisting of halogen, methoxy, trihalomethoxy, methylsulfonyl or aminocarbonyl; And n is an integer of 0-3. The thienopyrimidine derivative or a pharmaceutically acceptable salt thereof.
2. The thienopyrimidine derivative according to claim 1, wherein the thienopyrimidine derivative represented by the formula (1) is selected from the group consisting of compounds represented by the following formulas (2) to (42) salt.
(2)

(4)

(6)

(8)

(10)

(12)

(14)

(16)

(18)

(20)

(22)

(24)

(26)

(28)

(30)

(32)

(34)

(36)

(38)

(40)

Formula 42

The thieno pyrimidine derivative according to claim 4, wherein the thienopyrimidine derivative is selected from the group consisting of the compounds represented by formulas 2, 3, 5, 7, 8, 10, 16, 17, Pyrimidine derivative or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition for preventing or treating diabetes or diabetic complications comprising the thienopyrimidine derivative of any one of claims 1 to 5, a pharmaceutically acceptable salt thereof or a solvate thereof as an active ingredient.
7. The composition of claim 6, wherein said thienopyrimidine derivative has GPR119 agonistic activity.
The method of claim 6, wherein the diabetic complication is selected from the group consisting of obesity, coronary artery disease, ischemic stroke, peripheral vascular disease, intermittent claudication, myocardial infarction, postprandial lipidemia, symptoms of impaired glucose tolerance, symptoms of fasting glucose insufficiency, metabolic acidosis, Diabetic neuropathy, angina pectoris, thrombosis, atherosclerosis, myocardial infarction, transient ischemic attack, cerebral ischemic attack, cerebral ischemic stroke, cerebral ischemic stroke, Wherein the composition is selected from the group consisting of vascular restenosis, hyperglycemia, hyperinsulinemia, hyperlipidemia, hypertriglyceridemia, insulin resistance, foot ulcers, ulcerative colitis, and endocardial dysfunction.