KR101370805B1 - Electrochemical pH sensor using ferrocene-tagged aptamer and fabrication method thereof - Google Patents
Electrochemical pH sensor using ferrocene-tagged aptamer and fabrication method thereof Download PDFInfo
- Publication number
- KR101370805B1 KR101370805B1 KR1020120018925A KR20120018925A KR101370805B1 KR 101370805 B1 KR101370805 B1 KR 101370805B1 KR 1020120018925 A KR1020120018925 A KR 1020120018925A KR 20120018925 A KR20120018925 A KR 20120018925A KR 101370805 B1 KR101370805 B1 KR 101370805B1
- Authority
- KR
- South Korea
- Prior art keywords
- dna
- ferrocene
- electrochemical
- sensor
- labeled
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/302—Electrodes, e.g. test electrodes; Half-cells pH sensitive, e.g. quinhydron, antimony or hydrogen electrodes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2291/00—Indexing codes associated with group G01N29/00
- G01N2291/02—Indexing codes associated with the analysed material
- G01N2291/025—Change of phase or condition
- G01N2291/0255—(Bio)chemical reactions, e.g. on biosensors
Abstract
본 발명은 금(Au) 나노입자들이 증착된 다이아몬드 박막 전극을 기반으로 하여 페로센-표지된 압타머를 이용하여 pH를 측정하는 전기화학적 센서에 관한 것으로서, 종래 평면형 금(Au) 전극 보다 더 넓은 범위에서 더 높은 감도로 pH를 측정할 수 있다. The present invention relates to an electrochemical sensor for measuring pH using a ferrocene-labeled aptamer based on a diamond thin film electrode on which gold (Au) nanoparticles are deposited, and has a wider range than a conventional planar gold (Au) electrode. PH can be measured with higher sensitivity at.
Description
본 발명은 전기화학적 pH 센서 및 그 제조 방법에 관한 것으로서, 보다 구체적으로는 페로센(ferrocene)-표지된 압타머(aptamer)를 이용하여 전기화학적 방법으로 양성자를 검출함으로써 pH를 측정하는 센서 및 그 제조 방법에 관한 것이다.
The present invention relates to an electrochemical pH sensor and a method for manufacturing the same, and more particularly, a sensor for measuring pH by detecting a proton by an electrochemical method using a ferrocene-labeled aptamer, and a manufacturing method thereof. It is about a method.
다이아몬드는 생체 적합성뿐만 아니라, 화학 안정성, 열전도성, 견고성, 광학적 특성이 우수하다. 그러나 다이아몬드 자체는 전기적 전류 전도성이 없는 절연체이며, 보론으로 도핑을 하면 반도체의 특성을 나타낸다. 다이아몬드 전극 기판은 높은 시그널-노이즈 비와 장기 안정성, 높은 감도, 우수한 재현성 등으로 인해, 기존의 금이나 백금 등의 전극을 사용하였을 때보다 더 낮은 농도까지 검출이 가능하다. 그러나, 다이아몬드 박막에 바이오 물질을 고정하기 위해서는 아미노기(-NH2)나 카르복실기(-COOH)를 형성하는 과정이 필요한데, 이와 같이 표면에 작용기를 형성하는 공정은 매우 복잡하고 제한적이다. In addition to biocompatibility, diamond is excellent in chemical stability, thermal conductivity, robustness, and optical properties. However, diamond itself is an insulator with no electrical current conductivity, and when doped with boron, it exhibits the characteristics of a semiconductor. Due to the high signal-to-noise ratio, long-term stability, high sensitivity, and excellent reproducibility, the diamond electrode substrate can detect a lower concentration than using an electrode such as gold or platinum. However, in order to fix the biomaterial on the diamond film, a process of forming an amino group (-NH 2 ) or a carboxyl group (-COOH) is required. Thus, a process for forming a functional group on the surface is very complicated and limited.
페로센(Fc)는 산화환원 반응성 분자로서, 중심 고리 원자를 중심으로 반대쪽에 두 개의 싸이클로펜타디에닐 고리가 결합된 샌드위치 화합물이다. (도 1(c)) 이 화합물은 화학적으로 안정하고, 쉽게 작용기화될 수 있으며, 전기화학적으로 가역적이다. Fc-dT는 산화환원 반응성 페로센(Fc)기로 변형된 염기성 뉴클레오티드로서, 도 1(d)에 보여지는 바와 같이 올리고뉴클레오티드 내부로 혼입되어 핵산 분석을 위한 전기화학적 프로브로 사용되고 있다. Ferrocene (Fc) is a redox-reactive molecule, a sandwich compound in which two cyclopentadienyl rings are bonded to opposite sides of a central ring atom. (C) This compound is chemically stable, easily functionalized and electrochemically reversible. Fc-dT is a basic nucleotide modified with a redox-reactive ferrocene (Fc) group, and is incorporated into an oligonucleotide as shown in FIG. 1 (d) and used as an electrochemical probe for nucleic acid analysis.
또한 압타머는 표적 분자에 특이적으로 결합하는 올리고핵산 또는 펩티드 분자로서, 통상 RNA, 한 가닥 DNA(ss-DNA), 또는 합성 뉴클레오티드와 이들의 결합체 등을 들 수 있다. [James W (2000) aptamers. In: Meyers RA (ed) Encyclopedia of Analytical Chemistry, John Wiley & Sons Ltd, Chichester, pp 4848] 이 중에서 DNA 압타머는 한 가닥 사슬로 된 올리고뉴클레오티드를 포함한다. DNA에서 발견되는 4개의 염기는 아데닌 (A), 사이토신 (C), 구아닌 (G) 및 티민 (T)이다. 도 1(a)에 보여지는 것처럼, 사이토신은 산성 조건에서 프로토네이티드된 사이토신(C+)과 3중 수소결합을 통하여 C-C+ 염기쌍(base pair)을 형성하고, 이에 따라 ss-DNA는 2개의 평행한 듀플렉스를 형성하면서 i- motif라는 4중 구조를 갖게 된다. In addition, aptamers are oligonucleic acid or peptide molecules that specifically bind to a target molecule, and typically include RNA, single-stranded DNA (ss-DNA), or synthetic nucleotides and a combination thereof. James W (2000) aptamers. In: Meyers RA (ed) Encyclopedia of Analytical Chemistry, John Wiley & Sons Ltd, Chichester, pp 4848] Among these, DNA aptamers comprise oligonucleotides in single stranded chains. The four bases found in the DNA are adenine (A), cytosine (C), guanine (G) and thymine (T). As shown in FIG. 1 (a), cytosine forms a CC + base pair through triple hydrogen bonds with cytosine (C + ) protonated under acidic conditions, whereby ss-DNA is 2 It forms four parallel duplexes and has a quadratic structure called an i- motif .
많은 연구자들이 Fc-표지된 올리고뉴클레오티드를 이용하여 전기화학적 DNA 센서를 개발해왔다. 타겟 물질은 이들 센서에 있는 표면 제한적이고 산화환원종으로 표지된 압타머와 특이적으로 결합하여 압타머 프로브의 배향에 변화를 일으킨다. 이러한 배향의 변화는 표지된 산화환원종과 전극 사이의 거리를 변화시키고, 이에 따라 효과적인 전자 전달을 용이하게 하고, 전기화학적 시그널을 증대시킨다. [Lu Y, Li X, Zhang L, Yu P, Su L, Mao L (2008) aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe. Anal Chem 80:1883]
Many researchers have developed electrochemical DNA sensors using Fc-labeled oligonucleotides. The target material specifically binds to the surface-limiting and redox species labeled aptamers in these sensors, resulting in a change in orientation of the aptamer probes. This change in orientation changes the distance between the labeled redox species and the electrode, thus facilitating effective electron transfer and enhancing the electrochemical signal. Lu Y, Li X, Zhang L, Yu P, Su L, Mao L (2008) aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe. Anal Chem 80: 1883]
본 발명의 목적은 다이아몬드 박막 전극을 기반으로 페로센-표지된 압타머를 이용하여 pH를 측정하는 전기화학적 센서 및 그 제조 방법을 제공하는 것이다.
It is an object of the present invention to provide an electrochemical sensor for measuring pH using a ferrocene-labeled aptamer based on a diamond thin film electrode and a method of manufacturing the same.
상기 기술적 과제를 해결하기 위하여, 본 발명은 금(Au) 나노입자들이 증착된 다이아몬드 박막 전극을 기반으로 하는 전기화학적 pH 센서로서, 상기 금(Au) 나노입자는 페로센으로 표지된 압타머(aptamer)와 공유결합된 것을 특징으로 하는 전기화학적 pH 센서를 제공한다. In order to solve the technical problem, the present invention is an electrochemical pH sensor based on a diamond thin film electrode on which gold (Au) nanoparticles are deposited, and the gold (Au) nanoparticles are aptamer labeled with ferrocene. It provides an electrochemical pH sensor characterized in that it is covalently bonded with.
본 발명의 일실시예에 따르면, 상기 압타머는 페로센으로 표지된 ss-DNA(single-stranded DNA)인 것이 바람직하다. 이때, 페로센으로 표지된 ss-DNA는 말단기가 싸이올로 치환되어 금(Au) 나노입자와 공유결합된 것이 특징이다. According to one embodiment of the present invention, the aptamer is preferably single-stranded DNA (ss-DNA) labeled with ferrocene. In this case, the ss-DNA labeled with ferrocene is characterized in that the end group is substituted with a thiol and covalently bonded with gold (Au) nanoparticles.
본 발명의 일실시예에 따른 전기화학적 pH 센서의 pH 감지 범위는 pH 4.8 내지 8.3이며, 감도는 약 0.196 ㎂/pH 이다. The pH detection range of the electrochemical pH sensor according to an embodiment of the present invention is pH 4.8 to 8.3, the sensitivity is about 0.196 ㎂ / pH.
또한 본 발명은 1) 보론 도핑된 다이아몬드 전극 상에 금 나노입자들을 증착하는 단계; 및 2) 상기 금 나노입자와 페로센으로 표지된 ss-DNA를 결합시키는 단계:를 포함하는 전기화학적 pH 센서의 제조 방법을 제공한다. The present invention also provides a method for preparing gold nanoparticles, comprising: 1) depositing gold nanoparticles on a boron doped diamond electrode; And 2) combining the gold nanoparticles with ss-DNA labeled with ferrocene.
본 발명의 일실시예에 의하면, 금 나노입자와 페로센으로 표지된 ss-DNA의 결합은 상기 ss-DNA의 말단기를 싸이올기로 치환하여 Au-S 공유결합을 형성함으로써 이루어질 수 있다.
According to one embodiment of the present invention, the binding of gold nanoparticles and ss-DNA labeled with ferrocene may be achieved by substituting the end group of the ss-DNA with a thiol group to form an Au-S covalent bond.
본 발명에서 사용된 금 나노입자는 다이아몬드 박막 표면 처리의 어려움을 해소하고, 전극면적을 개선하는 효과뿐만 아니라, 화학반응에 의해 생성된 전자 전달의 매개체 역할을 통해 전기화학 센서의 성능을 개선시켰다. 본 발명에 따른 센서는 pH 4.8 ~ 8.3의 선형 범위와 약 0.196 mA/pH의 감도를 나타내었으며, 이러한 결과는 종래 평면 금(Au) 박막 전극을 이용하여 개발한 pH 센서(약 0.07 mA /pH의 감도, pH 5.6 ~ 7.1의 선형 범위)에 비하여 약 2.8배 감도가 향상된 것이고, 선형 범위도 더 넓어진 것으로서 본 발명에 따른 pH 센서가 매우 우수한 성능을 나타냄을 확인할 수 있다.The gold nanoparticles used in the present invention solve the difficulty of diamond film surface treatment, improve the electrode area, and improve the performance of the electrochemical sensor through the role of mediator of electron transfer generated by the chemical reaction. The sensor according to the present invention exhibited a linear range of pH 4.8 to 8.3 and a sensitivity of about 0.196 mA / pH. These results indicate that the pH sensor (about 0.07 mA / pH) developed using a conventional flat gold (Au) thin film electrode was used. Sensitivity, a linear range of pH 5.6 ~ 7.1) is about 2.8 times the sensitivity is improved, the linear range is also wider, it can be seen that the pH sensor according to the present invention shows a very good performance.
도 1은 (a) 사이토신과 헤미프로토네이티드(hemiprotonated) C-C+ 염기쌍의 구조, (b) i- motif 구조, (c) 페로센 및 (d) Fc-dT의 모식도이다.
도 2는 본 발명의 실시예에 따른 Fc-표지된 압타머를 가진 전기화학적 센서의 개요도와 다른 pH에서 측정된 SWV(strategy and square-wave voltammograms) 그래프이다.
도 3은 BDD 전극상에서 다음과 같은 여러 가지 전압하에 측정된 금(Au)-나노입자전극 SEM 이미지이다: (a) -0.1 V, (b) -0.2 V, (c) -0.3 V, (d) -0.4 V, (e) -0.5 V and (f) -0.6 V. (스캐일 바: 2 ㎛)
도 4는 Au-NP/BDD 전극과 평면 Au 전극에서의 양성자 검출을 위한 SWV 피크 전류의 교정 곡선이다. Figure 1 is a schematic diagram of (a) the structure of cytosine and hemiprotonated C-C + base pairs, (b) i- motif structure , (c) ferrocene and (d) Fc-dT.
FIG. 2 is a schematic diagram of an electrochemical sensor with an Fc-labeled aptamer in accordance with an embodiment of the present invention and a graph of strategy and square-wave voltammograms measured at different pHs.
FIG. 3 is an SEM image of gold (Au) -nanoparticle electrode measured under various voltages on a BDD electrode: (a) -0.1 V, (b) -0.2 V, (c) -0.3 V, (d ) -0.4 V, (e) -0.5 V and (f) -0.6 V. (scale bar: 2 μm)
4 is a calibration curve of SWV peak current for proton detection in Au-NP / BDD electrode and planar Au electrode.
이하 본 발명을 보다 구체적으로 설명한다. Hereinafter, the present invention will be described more specifically.
본 발명은 다이아몬드 박막 전극을 기반으로 페로센-표지된 압타머를 이용하여 pH를 측정하는 전기화학적 센서에 관한 것이다. 본 발명에서는 압타머로 사이토신(cytosine)이 풍부한 한 가닥 사슬 DNA(single-stranded DNA; ss-DNA)를 사용하여 샘플의 pH값에 따라 시그널 변화를 측정하였다. 일반적으로 사이토신(C)은 산성 조건에서 프로토네이티드 사이토신(C+)과 3중 수소결합을 통하여 C-C+ 염기쌍(base pair)을 형성하면서 ss-DNA는 i- motif라는 4중 구조를 갖게 된다.(도 1) 페로센은 좋은 산화화학종으로서, 이런 구조에서 압타머에 표지된 페로센과 전극 간의 거리가 가까워지면 효과적인 전자전달이 이루어지게 된다. The present invention relates to an electrochemical sensor for measuring pH using a ferrocene-labeled aptamer based on a diamond thin film electrode. In the present invention, a single-stranded DNA (ss-DNA) rich in cytosine as an aptamer was used to measure signal change according to the pH value of the sample. In general, cytosine (C) forms CC + base pairs through triple hydrogen bonds with protonated cytosine (C + ) in acidic conditions, and ss-DNA has a quadruple structure called i- motif . (FIG. 1) Ferrocene is a good oxidizing species. In this structure, when the distance between the ferrocene labeled with the aptamer and the electrode is closer, effective electron transfer is achieved.
도 2는 전기화학적 pH 센서의 원리를 보여준다. Fc-표지된 ss-DNA의 구조는 pH 값에 따라 변한다. 일반적으로 사이토신은 3중 수소 결합을 통해 양성자화된 사이토신과 결합한다. 염기성 pH에서, DNA는 DNA의 사이토신 잔기가 양성자화되지 않기 때문에 스트레치된(stretched) 랜덤 구조를 갖는다. 이 구조에서는 Fc 부분과 전극 표면 사이의 거리가 멀기 때문에 효과적인 전자 이동이 어렵다. 2 shows the principle of an electrochemical pH sensor. The structure of the Fc-labeled ss-DNA changes with pH value. In general, cytosine binds to protonated cytosine through triple hydrogen bonds. At basic pH, DNA has a stretched random structure because cytosine residues of DNA are not protonated. In this structure, the effective electron transfer is difficult because the distance between the Fc portion and the electrode surface is far.
그러나 낮은 pH에서는 Fc 부분과 전극 표면쪽으로 더 가까이 오기 때문에, 사이토신이기는 부분적으로 양성자화되고, DNA는 촘촘하게 접힌 형태가 된다. 따라서 낮은 pH에서 전자 이동이 효과적으로 이루어지고, 피크 곡선의 증가한다. 이러한 원리에 기초하여, SWV에서 피크 전류를 측정함으로써 pH값을 결정할 수 있다. At low pH, however, closer to the Fc region and the electrode surface, the cytosine is partially protonated and the DNA is tightly folded. Therefore, electron transfer is effectively made at low pH, and the peak curve is increased. Based on this principle, the pH value can be determined by measuring the peak current in the SWV.
본 발명에 따른 금(Au) 나노입자들이 증착된 다이아몬드 박막 전극을 기반으로 하는 전기화학적 pH 센서에서 금(Au) 나노입자는 페로센으로 표지된 압타머(aptamer)와 공유결합된 것이 특징이다. 예를 들어, 압타머는 페로센으로 표지된 ss-DNA(single-stranded DNA)인 것일 수 있으며, 이때, 페로센으로 표지된 ss-DNA는 말단기가 싸이올로 치환되어 금(Au) 나노입자와 공유결합을 이루도록 구성한다. In the electrochemical pH sensor based on the diamond thin film electrode on which the gold (Au) nanoparticles are deposited, the gold (Au) nanoparticles are covalently bonded to an aptamer labeled with ferrocene. For example, the aptamer may be single-stranded DNA (ss-DNA) labeled with ferrocene, wherein the ss-DNA labeled with ferrocene is covalently bonded to the gold (Au) nanoparticles by the end group being substituted with a thiol. Configure to achieve.
본 발명의 일실시예에 따른 전기화학적 pH 센서의 pH 감지 범위는 pH 4.8 내지 8.3이며, 감도는 약 0.196 ㎂/pH 로서 매우 우수하다. The pH detection range of the electrochemical pH sensor according to an embodiment of the present invention is pH 4.8 to 8.3, and the sensitivity is very good as about 0.196 dl / pH.
또한 본 발명은 1) 보론 도핑된 다이아몬드 전극 상에 금 나노입자들을 증착하는 단계; 및 2) 상기 금 나노입자와 페로센으로 표지된 ss-DNA를 결합시키는 단계:를 포함하는 전기화학적 pH 센서의 제조 방법을 제공한다. The present invention also provides a method for preparing gold nanoparticles, comprising: 1) depositing gold nanoparticles on a boron doped diamond electrode; And 2) combining the gold nanoparticles with ss-DNA labeled with ferrocene.
본 발명의 일실시예에 의하면, 금 나노입자와 페로센으로 표지된 ss-DNA의 결합은 상기 ss-DNA의 말단기를 싸이올기로 치환하여 Au-S 공유결합을 형성함으로써 이루어질 수 있다.
According to one embodiment of the present invention, the binding of gold nanoparticles and ss-DNA labeled with ferrocene may be achieved by substituting the end group of the ss-DNA with a thiol group to form an Au-S covalent bond.
이하 실시예를 통해 본 발명을 보다 구체적으로 상세히 설명한다. 그러나 이는 본 발명의 이해를 돕기 위한 예시적인 목적으로 기술된 것으로서, 본 발명의 범위가 이에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to Examples. However, these are described for the purpose of helping to understand the present invention, and the scope of the present invention is not limited thereto.
실시예Example : 전기화학적 : Electrochemical pHpH 센서의 제조 Manufacture of sensors
BDD 박막 전극을 제조하기 위하여, 핫필라멘트 화학기상증착(HFCVD) 시스템을 사용했다. 열적으로 산화된 실리콘(Si) 와이퍼는 정전기적 자기정렬법에 의해 다이아몬드 나노결정 씨드로 밀도 있게 코팅하였다. 그 다음 이 다이아몬드 씨드로 코팅된 기판 상에 도핑된 다이아몬드 필름을 성장시켰다. To manufacture BDD thin film electrodes, a hot filament chemical vapor deposition (HFCVD) system was used. Thermally oxidized silicon (Si) wipers were densely coated with diamond nanocrystalline seeds by electrostatic self-alignment. The doped diamond film was then grown on this diamond seed coated substrate.
Au-NPs/BDD 을 제조하기 위해, 2.0 mM HAuCl4 와 0.5 M H2SO4를 포함하는 혼합액 중에서 600초 동안 -0.5 V의 일정한 전압하에 금 나노입자를 BDD 전극상에 전기화학적으로 증착시켰다. Fc-ss-DNA는 Au-NPs/BDD 전극 상에 Au-S 상호작용에 의해 고정되었다. 이 전극을 실온에서 12시간 동안 10 μg/mL ss-DNA 를 포함하는 0.01M PBS (pH 7.4) 중에 담갔다가, PBS로 헹구었다. 본 발명에 사용된 페로센-표지된 ss-DNA는 Bioneer Co.에서 합성하였으며, 이 DNA의 서열은 다음과 같았다: To prepare Au-NPs / BDD, gold nanoparticles were electrochemically deposited on a BDD electrode under a constant voltage of −0.5 V for 600 seconds in a mixed solution comprising 2.0 mM HAuCl 4 and 0.5 MH 2 SO 4 . Fc-ss-DNA was immobilized by Au-S interaction on the Au-NPs / BDD electrode. This electrode was immersed in 0.01 M PBS (pH 7.4) containing 10 μg / mL ss-DNA for 12 hours at room temperature and rinsed with PBS. The ferrocene-labeled ss-DNA used in the present invention was synthesized from Bioneer Co. The sequence of this DNA was as follows:
(5´) (Fc-dT)TTAATCCCAATCCCAATCCCAATCCC(Thiol) (3´).
(5 ′) (Fc-dT) TTAATCCCAATCCCAATCCCAATCCC (Thiol) (3 ′).
한편 본 발명에 따른 페로센-표지된 압타머를 이용한 전기화학적 pH 센서와 성능을 비교하기 위해, RF 스퍼터링에 의해 금 전극을 제조했다. 이때, 금 박막층과 실리콘 기판 사이의 접착력을 향상시키기 위해, 금(Au) 박막(박막 두께: 2000 A)을 증착하기 전에, 200 A 티타늄(Ti)층을 실리콘 기판 상에 하부층으로 증착했다.
Meanwhile, in order to compare the performance with the electrochemical pH sensor using the ferrocene-labeled aptamer according to the present invention, a gold electrode was prepared by RF sputtering. At this time, in order to improve the adhesion between the gold thin film layer and the silicon substrate, a 200 A titanium (Ti) layer was deposited on the silicon substrate as a lower layer before depositing the gold (Au) thin film (thin film thickness: 2000 A).
실험예Experimental Example : : pHpH 측정 결과 Measurement result
도 3는 여러 가지 다른 전압에서 BDD 전극상에 위치한 금(Au)-나노입자전극의 SEM 이미지를 보여준다. 금(Au) 나노클러스터는 600초 동안 2 mM HAuCl4과 0.5 M H2SO4용액을 이용하여 전기화학적으로 증착되었다. -0.5 V까지 네거티브 전압이 가해졌을 때, 금(Au)-나노입자는 더 밀도가 높아졌다. (도 3(a-e)) 그러나 -0.6 V 보다 더 큰 전압이 가해졌을 때는 금(Au)-나노입자의 밀도가 감소했다. (도 3(f)). 이러한 결과로부터, -0.5 V 가 적절한 전압으로 선택되었다. (도 3(e)) 이 전압에서 금 나노클러스트는 전극 표면상에 평균 직경 80 nm로 균일하게 분포되었다. 3 shows SEM images of gold (Au) -nanoparticle electrodes placed on BDD electrodes at various different voltages. Gold (Au) nanoclusters were electrochemically deposited using a 2 mM HAuCl 4 and 0.5 MH 2 SO 4 solution for 600 seconds. When negative voltages were applied to -0.5 V, gold (Au) -nanoparticles became denser. However, when a voltage greater than -0.6 V was applied, the density of Au-nanoparticles decreased. (FIG. 3 (f)). From these results, -0.5 V was chosen as the appropriate voltage. (FIG. 3 (e)) At this voltage, the gold nanoclusters were uniformly distributed with an average diameter of 80 nm on the electrode surface.
도 4는 Au-NPs/BDD 전극과 평면형 Au 전극에 대한 피크 전류(i p ) 대 pH의 교정 곡선을 나타낸다. Au-NPs/BDD 전극은 pH 4.8 ~ 8.3 범위에서 선형적 관계를 나타내며, 관계식은 
최대 전류는 pH 4.8에서 관찰되었다. 피크 전류의 접힌 DNA의 형성은 pH가 이 값 이하로 감소되어도 거의 변화가 없었다. 평면형 Au 전극에 대해, i p 와 pH의 관계는 pH 5.3 ~ 7.0 범위에서 선형적이다. (
Maximum current was observed at pH 4.8. The formation of folded DNA at peak current was almost unchanged even when the pH was reduced below this value. For planar Au electrodes, the relationship between i p and pH is linear in the range of pH 5.3 to 7.0. (
상기 검출 결과로부터, 낮은 전자 전달 저항, 넓은 전위 윈도우, 넓은 표면적 및 효과적인 전자 전달 등의 BDD 전극과 Au-NPs의 시너지 효과로 인해 본 발명에 따른 전기화학센서가 평면형 Au 보다 더 넓은 범위에서 더 높은 감도를 나타낸다는 것을 확인할 수 있다. From the detection results, the electrochemical sensor according to the present invention has a higher range in a wider range than planar Au due to the synergistic effect of Au-NPs with BDD electrodes such as low electron transfer resistance, wide potential window, wide surface area and effective electron transfer. It can be confirmed that the sensitivity is shown.
서열목록 전자파일 첨부Attach an electronic file to a sequence list
Claims (5)
상기 금 나노입자들이 분산된 보론 도핑된 다이아몬드 전극; 및
상기 전극 상에 공유결합에 의하여 고정화된 SS-DNA(single-stranded DNA)를 포함하고,
상기 SS-DNA는 페로센으로 표지된 것을 특징으로 하고,
상기 페로센으로 표지된 SS-DNA는 염기성 pH에서 스트레칭되고, 산성 pH에서 접힌 형태가 되는 것을 특징으로 하는 전기화학적 pH 센서.An electrochemical pH sensor based on diamond thin film electrodes on which gold (Au) nanoparticles are deposited,
Boron doped diamond electrodes in which the gold nanoparticles are dispersed; And
A single-stranded DNA (SS-DNA) immobilized by covalent bond on the electrode,
The SS-DNA is characterized in that labeled with ferrocene,
The ferrocene-labeled SS-DNA is stretched at basic pH, electrochemical pH sensor, characterized in that the folded form at acidic pH.
상기 페로센으로 표지된 ss-DNA는 말단기가 싸이올로 치환되어 금(Au) 나노입자와 공유결합된 것을 특징으로 하는 전기화학적 pH 센서.The method of claim 1,
The ferrocene-labeled ss-DNA is an electrochemical pH sensor, characterized in that the end group is substituted with a thiol and covalently bonded with gold (Au) nanoparticles.
2) 상기 금 나노입자와 페로센으로 표지된 ss-DNA를 결합시키는 단계:를 포함하는 전기화학적 pH 센서의 제조 방법.1) depositing gold nanoparticles on the boron doped diamond electrode; And
2) combining the gold nanoparticles with ss-DNA labeled with ferrocene: a method of manufacturing an electrochemical pH sensor comprising a.
상기 금 나노입자와 페로센으로 표지된 ss-DNA의 결합은 상기 ss-DNA의 말단기를 싸이올기로 치환하여 Au-S 공유결합을 통해 이루어지는 것을 특징으로 하는 전기화학적 pH 센서의 제조 방법.5. The method of claim 4,
Bonding of the gold nanoparticles and ss-DNA labeled with ferrocene is a method for producing an electrochemical pH sensor, characterized in that the end group of the ss-DNA is substituted by a thiol group through Au-S covalent bond.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020120018925A KR101370805B1 (en) | 2012-02-24 | 2012-02-24 | Electrochemical pH sensor using ferrocene-tagged aptamer and fabrication method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020120018925A KR101370805B1 (en) | 2012-02-24 | 2012-02-24 | Electrochemical pH sensor using ferrocene-tagged aptamer and fabrication method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20130097339A KR20130097339A (en) | 2013-09-03 |
| KR101370805B1 true KR101370805B1 (en) | 2014-03-12 |
Family
ID=49449739
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020120018925A KR101370805B1 (en) | 2012-02-24 | 2012-02-24 | Electrochemical pH sensor using ferrocene-tagged aptamer and fabrication method thereof |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101370805B1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110632156A (en) * | 2019-11-04 | 2019-12-31 | 吉林大学 | Be used for detecting aflatoxin B1Aptamer sensor and preparation method thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4217494A1 (en) * | 2020-09-24 | 2023-08-02 | University of Cincinnati | Highly chemically stable aptamer sensors |
| CN115266850B (en) * | 2022-07-26 | 2024-04-12 | 长春工业大学 | Preparation method of aptamer sensor for detecting cefquinome |
-
2012
- 2012-02-24 KR KR1020120018925A patent/KR101370805B1/en active IP Right Grant
Non-Patent Citations (1)
| Title |
|---|
| Anal. Chim. Acta, Vol. 658, No. 2, pp. 128~132 (2010) * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110632156A (en) * | 2019-11-04 | 2019-12-31 | 吉林大学 | Be used for detecting aflatoxin B1Aptamer sensor and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20130097339A (en) | 2013-09-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Du et al. | Fabrication of DNA/graphene/polyaniline nanocomplex for label-free voltammetric detection of DNA hybridization | |
| Gupta et al. | Polymelamine modified edge plane pyrolytic graphite sensor for the electrochemical assay of serotonin | |
| Terse-Thakoor et al. | Graphene based biosensors for healthcare | |
| KR101188172B1 (en) | Electrochemical biosensor and method of fabricating the same | |
| Rahmanian et al. | Development of sensitive impedimetric urea biosensor using DC sputtered Nano-ZnO on TiO2 thin film as a novel hierarchical nanostructure transducer | |
| Kan et al. | Imprinted electrochemical sensor for dopamine recognition and determination based on a carbon nanotube/polypyrrole film | |
| Arya et al. | Polyaniline protected gold nanoparticles based mediator and label free electrochemical cortisol biosensor | |
| Ghanbari et al. | Electrochemically fabricated polypyrrole nanofiber-modified electrode as a new electrochemical DNA biosensor | |
| Fayazfar et al. | DNA impedance biosensor for detection of cancer, TP53 gene mutation, based on gold nanoparticles/aligned carbon nanotubes modified electrode | |
| Ran et al. | A sensitive amperometric immunosensor for alpha-fetoprotein based on carbon nanotube/DNA/Thi/nano-Au modified glassy carbon electrode | |
| Gao et al. | Graphene oxide directed in-situ deposition of electroactive silver nanoparticles and its electrochemical sensing application for DNA analysis | |
| Erdem et al. | Electrochemical monitoring of indicator-free DNA hybridization by carbon nanotubes–chitosan modified disposable graphite sensors | |
| Song et al. | Pt-polyaniline nanocomposite on boron-doped diamond electrode for amperometic biosensor with low detection limit | |
| WO2009122159A2 (en) | Biosensor for analyte detection | |
| Li et al. | Electrochemical growth of gold nanoparticles on horizontally aligned carbon nanotubes: A new platform for ultrasensitive DNA sensing | |
| Song et al. | Dopamine sensor based on a boron-doped diamond electrode modified with a polyaniline/Au nanocomposites in the presence of ascorbic acid | |
| Song et al. | Electrochemical sensor based on Au nanoparticles decorated boron-doped diamond electrode using ferrocene-tagged aptamer for proton detection | |
| Shi et al. | A label-free hemin/G-quadruplex DNAzyme biosensor developed on electrochemically modified electrodes for detection of a HBV DNA segment | |
| Karadeniz et al. | Electrochemical monitoring of DNA hybridization by multiwalled carbon nanotube based screen printed electrodes | |
| Weng et al. | Label-free DNA sensor by boron-doped diamond electrode using an ac impedimetric approach | |
| McMullan et al. | Aptamer conjugated Mo6S9− xIx nanowires for direct and highly sensitive electrochemical sensing of thrombin | |
| CN113406154B (en) | Three-dimensional hydrogel-graphene-based biosensor and preparation method thereof | |
| Li et al. | A novel aptameric biosensor based on the self-assembled DNA–WS2 nanosheet architecture | |
| Li et al. | Amplified electrochemical detection of nucleic acid hybridization via selective preconcentration of unmodified gold nanoparticles | |
| Eksin et al. | based electrode assemble for impedimetric detection of miRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20170109 Year of fee payment: 4 |
|
| FPAY | Annual fee payment |
Payment date: 20180108 Year of fee payment: 5 |
|
| FPAY | Annual fee payment |
Payment date: 20190211 Year of fee payment: 6 |