KR101359305B1 - Tuber tissue-specific laccase promoter from Solanum tuberosum and uses thereof - Google Patents

Abstract

The present invention potato ( Solanum tuberosum ) -derived tuber tissue specific laccase promoter, a recombinant plant expression vector comprising the promoter, a plant and its seed transformed with the recombinant plant expression vector, and a foreign gene to be recombined into the recombinant plant expression vector. step; And a method of expressing tuber tissue specificly in a transgenic plant, comprising the step of transforming the recombinant plant expression vector into a plant; a trait in which the foreign gene prepared by the method is specifically expressed in tuber tissue. To provide converting plants and their seeds.

Description

Tuber tissue-specific laccase promoter from potato and its use {Tuber tissue-specific laccase promoter from Solanum tuberosum and uses approximately}

The present invention relates to tuber tissue-specific laccase promoter and its use derived from potatoes, more specifically potato ( Solanum) tuberosum ) -derived tuber tissue specific laccase promoter, a recombinant plant expression vector comprising the promoter, a plant and its seed transformed with the recombinant plant expression vector, and a foreign gene to be recombined into the recombinant plant expression vector. step; And a method of expressing tuber tissue specificly in a transgenic plant, comprising the step of transforming the recombinant plant expression vector into a plant; a trait in which the foreign gene prepared by the method is specifically expressed in tuber tissue. To converting plants and their seeds.

Crop molecular breeding is a key technology that will lead the next generation of agriculture in that it can use all kinds of genes as materials and can fine-tune the effects of infinite breeding by pulling down the breeding techniques that were previously available only in the genome. . In order to maximize the effectiveness of the technology, such crop molecular breeding should be preceded by 1) accumulation of a large amount of genetic data that can represent genes of various plants, 2) transformation system of various crops, and 3) external Development of various promoters that can regulate the expression of the inserted gene should be preceded. Known promoters used to achieve transformation purposes by confining the expression of foreign genes to specific tissues of plants can be classified as follows according to their function.

First, it is a root specific expression promoter. Although no commercialized case yet, Arabidopsis peroxidase (peroxidase, prxEa) was isolated to confirm root-specific expression. Recently, the sweet potato-derived Maz gene (ibMADS) and the sugar-induced ADP-glucose pyrophosphatase , AGPase) gene has been isolated has been patented (Patent Publication 2004-0067290, Patent Publication 2004-0070820) to confirm that the promoter induces specific expression in the roots and induces root-specific transient expression in carrots, radishes. These promoters can be expected to be mainly used for the purpose of improving agricultural traits, accumulating useful proteins, and producing useful substances in major root crops used for food, food, or food.

Second, seed-specific promoters can be mentioned. As a representative example, the rice gluten promoter used to develop golden rice as a promoter of the major storage protein gene of rice has been widely used to induce seed-specific expression of monocotyledonous plants. Promoters mainly used to induce seed specific expression include the soybean-derived lectin promoter, the cabbage-derived napin promoter, and the gamma tocopherol methyl transferase (γ-TMT) in seedlings of Arabidopsis. Carrot-derived DC-3 promoters used in studies that enhanced the production of vitamin E by inducing gene expression, and there is a case confirmed the seed specific expression induction of perilla-derived oleosin promoter. The seed-specific promoters are mainly used for the purpose of accumulating useful proteins and producing beneficial substances in major crops in which seed itself is used as a food, a food, or a raw material for food.

Third, a systemic expression induction promoter may be mentioned. The promoter of 35S RNA gene of CaMV (caaflower mosaic virus) is used as a representative dicotyledonous promoter as a plant whole-body induction promoter, and rice actin (actin) as a whole-body induction promoter for a monocotyledonous plant such as rice. And corn ubiquithin gene promoters have been mainly used, and recently, a promoter of rice cytochrome C gene (OsOc1) has been developed and used by domestic researchers (Korean Patent Registration 2001-0429335). They are already inherent in inducing the expression of antibiotics, herbicide resistance genes and reporter genes used as selection markers in the plant transformation basic carrier. In the research aspect, Promoters considered.

Fourth, other tissue specific promoters, such as a leaf, can be mentioned. Rice and corn-derived albics (rbcS) promoters that induce potent gene expression only in photosynthetic tissues such as leaves, RolD promoters that induce plant root expression from Agrobacterium, and tubers from potato Specific expression-induced patatin promoter, tomato-derived fruit maturation Specific expression-induced phytoene synthase (PDS) promoter, and cabbage-derived oleosin promoter whose function has been confirmed to be pollen-specific in Chinese cabbage flower And a rugged tissue-specific BcA9 promoter (see Patent Registration No. 10-0435143) of the male endothelium drug of flowers to induce the expression of Bt protein genes toxic to cells. There is a case of developing and registering a patent.

In addition, a large number of promoters have been reported for various tissues of various plant-derived tissues for various purposes, and are still under development, but most of the types of promoters that have been commercialized or widely used among plant researchers are mentioned above. There is a need to continue to develop new promoters that can control the site of gene expression more precisely according to the intention of the developer.

Meanwhile, Korean Laid-Open Patent Publication No. 2010-0028839 discloses a methionine-containing transformant using a seed storage protein of perilla and a method for preparing the same, and Korean Laid-Open Patent Publication No. 2009-0021655 discloses dehydroascorse derived from hairy root of sesame seeds. Potato transformed with a bait reductase gene is disclosed, and Korean Patent Publication No. 1998-702105 discloses the expression of sucrose phosphorylase in plants, and Korean Patent No. 10-0210352 discloses an amylopectin type. Genetic modification of potato to produce starch has been disclosed, but nothing has been found for potato-derived tuber tissue specific laccase promoter as in the present invention.

The present invention has been made in accordance with the above requirements, in the present invention, it was confirmed that the promoter of the Lacaze gene induced by the wound of potato tuber is specifically expressed only in potato tuber, and reveals the nucleotide sequence of the Rakease promoter. This completes the present invention.

In order to solve the above problems, the present invention potato ( Solanum tubersum- derived tuber tissue specific laccase promoter.

The present invention also provides a recombinant plant expression vector comprising the promoter.

The present invention also provides a plant transformed with the recombinant plant expression vector and seeds thereof.

In addition, the present invention comprises the steps of recombining a foreign gene into the recombinant plant expression vector; And it provides a method for expressing the tuber tissue specific in the transgenic plant, the foreign gene comprising the step of transforming the recombinant plant expression vector to the plant.

The present invention also provides a transgenic plant and seed thereof, wherein the foreign gene produced by the above method is specifically expressed in tuber tissue.

The present invention provides a tuber tissue-specific laccase promoter derived from potato and its use, thereby producing a useful material for the tuber tissue of the plant or transforming the plant to functionally modify the material in the existing tuber tissue. It can be used as a very useful way to develop.

Figure 1 shows the nucleotide sequence of the promoter of potato derived LaCase gene of the present invention.
Figure 2 is a schematic diagram showing the plant expression vector pCAM3-LacP in which the promoter of the lacase gene is inserted into the β-glucuronidase (abbreviated as 'GUS') reporter gene.
3 shows GUS staining (A) of potato plants transformed by pCAM3-LacP (Lac-P), pCAMBIA3301 (35S-P) and activity of GUS enzymes in tubers of transgenic potato plants (B).
Figure 4 shows the activity of tissue-specific GUS enzymes in transgenic potato plants.

In order to achieve the object of the present invention, the present invention is a potato ( Solanum tubersum- derived tuber tissue specific laccase promoter.

In contrast to the CaMV35S promoter derived from Cauliflower mosaic virus, which is widely used in the past, the potato tuber tissue specific expression promoter of the present invention can be used in potato tuber tissue. Can be expressed specifically.

Also, variants of the promoter sequence are included within the scope of the present invention. The mutant is a base sequence having a functional characteristic similar to that of the nucleotide sequence of SEQ ID NO: 1, although the nucleotide sequence thereof is changed. Specifically, the promoter sequence has a nucleotide sequence that has at least 70% homology, more preferably at least 80% homology, more preferably at least 90% homology, and most preferably at least 95% homology with the nucleotide sequence of SEQ ID NO: 1 .

"% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The present invention also provides a recombinant plant expression vector comprising the promoter. Preferably, the recombinant plant expression vector may be prepared by operably linking a gene of interest encoding a protein of interest downstream of the LaCase promoter. In the present invention, "operably linked" refers to a component of an expression cassette that functions as a unit for expressing a heterologous protein. For example, a promoter operably linked to heterologous DNA encoding a protein promotes the production of functional mRNA corresponding to the heterologous DNA.

The potato tuber tissue specific expression vector of the present invention can be used as a transient expression vector capable of temporarily expressing in a plant into which a foreign gene has been introduced and a plant expression vector capable of permanently expressing a foreign gene in a introduced plant. Can be.

Binary vectors that can be used in the present invention may be any binary vector containing the right border (RB) and left border (LB) of T-DNA capable of transforming plants in the presence of Ti plasmid of A. tumefaciens . However, it is preferable to use pBI101 (Cat #: 6018-1, Clontech, USA), pBIN19 (Genbank Accession No. U09365), pBI121, pCAMBIA vector, and the like, which are frequently used in the art.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used when referring to DNA fragment (s), nucleic acid molecules that are delivered into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

A preferred example of a plant expression vector is a Ti-plasmid vector that is capable of transferring a so-called T-region into a plant cell when it is present in a suitable host such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the genes according to the invention into a plant host are viral vectors, such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector preferably comprises one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol It doesn't happen.

In the recombinant vector of the present invention, conventional terminators can be used, for example nopalin synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens) Terminator of the octopine gene, but is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The present invention also provides a plant transformed with the recombinant plant expression vector and seeds thereof.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have to have regeneration and / or tissue culture periods. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. Method is calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185 ), (DNA or RNA-coated) particle bombardment of various plant elements (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumulopasis by plant infiltration or transformation of mature pollen or vesicles And infection with (incomplete) virus (EP 0 301 316) in en mediated gene transfer. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.

"Plant cell" used for transformation of a plant may be any plant cell. The plant cell may be any of a cultured cell, a cultured tissue, a culture or whole plant, preferably a cultured cell, a cultured tissue or culture medium, and more preferably a cultured cell.

"Plant tissue" refers to tissues of differentiated or undifferentiated plants, such as, but not limited to, fruits, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie single cells, protoplasts. (protoplast), shoots and callus tissue. Plant tissue may be in planta or in organ culture, tissue culture or cell culture.

In addition, the present invention comprises the steps of recombining a foreign gene into the recombinant plant expression vector; And it provides a method for expressing the tuber tissue specific in the transgenic plant, the foreign gene comprising the step of transforming the recombinant plant expression vector to the plant. Preferably, the foreign gene may encode a protein selected from the group consisting of interleukin, interferon, platelet induced growth factor, hemoglobin, elastin, collagen, insulin, fibroblast growth factor, human growth factor, human serum albumin and erythropoietin. However, it is not limited thereto.

The foreign gene may be any gene desired for expression in tuber tissue of potato plants, and may be located after the promoter in the potato tuber tissue specific expression vector of the present invention and may be expressed by fusion with a reporter gene as necessary. The recombinant potato tuber tissue specific expression vector may be transformed into a plant as described above.

The present invention also provides a transgenic plant and seed thereof, wherein the foreign gene produced by the above method is specifically expressed in potato tuber tissue. Preferably, the plant may be a dicotyledonous plant, more preferably a potato, but is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

Example  One. Rakes  Promoter of gene and nucleotide sequence analysis

Potatoes ( Solanum tuberosum cv.Desiree) Potato LaCase cDNA gene homologous to the nucleotide sequence of the LaCase gene was identified from the EST sequence library expressed after the wound, based on the NCBI genebank sequence blast search ( http://www.ncbi.org). ). Based on the potato LaCase cDNA gene, LaCase specific Lac-1: GGTTTAGTCTTGGCACAATTGGAAGAAC (SEQ ID NO: 2) and Lac-2: CCATGGCTTTTCCTTTTTACTAAAACTCGATTC (SEQ ID NO: 3) primers were prepared to secure the promoter and 5'-UTR of the gene. . Genomic DNA was extracted from tubers of potato, and then genomic DNA was treated with the restriction enzymes of Dra I, EcoRV, Pvu II, Stu I based on the experimental method provided by Universal Genome Walker Kit (Clontech), and then the adapter provided in the kit. Was ligated to produce four types of libraries. Based on this, the first PCR product was performed using AP1 adapter primer (ACTATAGGGCACGCGTGGT) (SEQ ID NO: 4) and Lac-1 primer (GGTTTAGTCTTGGCACAATTGGAAGAAC) (SEQ ID NO: 5), and then the PCR product was diluted 50-fold. A second PCR was performed using AP2 adapter primers (ACT ATA GGG CAC GCG TGG T (SEQ ID NO: 6) and Lac-2 specific primers.) About 1100 bp DNA fragments amplified by PCR were converted into pCR-TOPO TA vectors ( The sequence was analyzed after cloning in Invitrogen, USA (Fig. 1) The protein synthesis start codon 'ATG' is shown in bold italic font.

Example  2. Rakes  Plant expression vector production using gene promoter

Promoters and UTR portions of the LaCase genes secured in Example 1 and inserted into the pCR-TOPO TA vector were recovered by treatment with XbaI and NcoI restriction enzymes. This was cloned into pCAMBIA 3301 into which the GUS gene was inserted to prepare a pCAM3-LacP vector (FIG. 2) and used for plant transformation using Agrobacterium.

Example  3. The plant expression vector pCAM3 - LacP Transformation of Potato Plants Using

The plant expression vectors pCAM3-LacP and pCAMBIA 3301 prepared as described above were prepared using Agrobacterium ( Agrobacterium). tumefaciens GV) were transformed with the Freeze-thaw method (An, G. 1987, Methods in Enzymology, 153: 292-293). Each transformed Agrobacterium was shaken at 28 ° C. for 2 days, and then transformed by leaf section coculture with young leaves taken from potato shoots (cv. Desiree) a week old.

Example  4. Histochemical staining and enzymatic analysis of transformed potato plants

After co-culture with Agrobacterium, leaf sections were selected for individuals that were re-differentiated with resistance in basta selection medium. GUS activity from selected transgenic plants was examined by histochemical staining and enzymatic methods. To stain the entire tissue of each transgenic plant, each tissue of the plant was subjected to 1 mM X-glu (5-bromo-4-chloro-3-indolyl-β-glucuronide), 100 mM sodium phosphate (pH 7.0), 10 mM In a solution containing EDTA, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, and 0.1% Triton X-100 for 12 hours at 37 ° C, 100% ethanol Chlorophyll was removed. In panel A of FIG. 3, NC is a normal potato plant not transformed, Lac-P is a potato plant transformed with pCAM3-LacP, and 35S-P is a pCAMBIA 3301 transformed potato having CaMV35S in the GUS gene. As a result, pCAMBIA 3301 with CaMV35S showed GUS activity in all tissues, whereas in pCAM3-LacP transgenic potatoes, GUS activity was specifically confirmed in tuber tissues.

In addition, in order to quantitatively investigate the activity of GUS, each tissue of the transgenic plant was prepared by 50 mM sodium phosphate (pH 7.0), 10 mM EDTA according to the method of Jefferson et al. (EMBO J. 6: 3901-3907, 1987). The supernatant was taken by grinding in a solution containing, 0.1% Triton X-100, 0.1% sodium lauroylsarcosine, and 10 mM β-mercaptoethanol, followed by centrifugation at 16,000 × g. The obtained supernatant was mixed with 1 mM MUG (4-methylumbelliferyl glucuronide) and reacted at 37 ° C. Then, 0.2 M Na ₂ CO ₃ was added to terminate the reaction. After completion of the reaction, the reaction solution was measured at 360 nm excitation and 460 nm emission wavelengths using a fluorescence meter, and then the measured value was compared with a standard curve made using MUG standard solution. Activity was calculated and shown in panel B of FIG. 3. As a result, it was found that the promoter of the pCAM3-LacP gene is expressed to a higher degree than the CaMV35S promoter.

In addition, tissue-specific GUS enzyme activity in transgenic potato plants was investigated. As a result, it was found that GUS was hardly expressed in leaves, stems, and roots, whereas GUS was strongly expressed in tubers (FIG. 4). From the above results, it can be seen that the promoter of pCAM3-LacP gene is expressed specifically in tuber tissue of potato.

Attach an electronic file to a sequence list

Claims (11)

Potato ( Solanum , consisting of the nucleotide sequence of SEQ ID NO: 1) tuberosum) specific la helicase (laccase) promoter derived from tuber tissue. A recombinant plant expression vector comprising the promoter of claim 1. The recombinant plant expression vector of claim 2, wherein the recombinant plant expression vector is prepared by operably linking a gene of interest encoding a protein of interest downstream of the promoter. A plant transformed with the recombinant plant expression vector of claim 2. A seed of a plant according to claim 4. Recombining the foreign gene into the recombinant plant expression vector of claim 2; And
A method for expressing tuber tissue specific in a transgenic plant comprising the step of transforming the recombinant plant expression vector to a plant. The method of claim 6, wherein the foreign gene encodes a protein selected from the group consisting of interleukin, interferon, platelet-induced growth factor, hemoglobin, elastin, collagen, insulin, fibroblast growth factor, human growth factor, human serum albumin and erythropoietin. Characterized in that. A transgenic plant, wherein the foreign gene produced by the method of claim 6 is specifically expressed in tuber tissue. The transgenic plant of claim 8, wherein the plant is a dicotyledonous plant. 10. The transgenic plant of claim 9, wherein the plant is a potato plant. Seeds of plants according to claim 8.

Images