KR101323652B1 - Methods for Screening Therapeutics for X-linked Adrenoleukodystrophy and Autologous Differentiated Oligodendrocytes Therefor - Google Patents

Abstract

The present invention relates to a method for preparing inverted pluripotent stem cells and a method for screening X-linked adrenal protein dystrophy disease using cells differentiated from inverted pluripotent stem cells. The present invention can prepare induction of differentiated pluripotent stem cells in human fibroblasts derived from X-linked adrenoleukodystrophy (X-ALD) patients. In addition, the efficacy of the drug can be confirmed by screening a candidate drug for X-linked adrenal protein dystrophy by using oligodendrocytes differentiated into pluripotent stem cells. In particular, the production of autologous oligodendrocytes through a method for producing pluripotent stem cells has the advantage of allowing patient-specific treatment.

Description

Methods for Screening Therapeutics for X-linked Adrenoleukodystrophy and Autologous Differentiated Oligodendrocytes Therefor}

The present invention relates to a method for preparing inverted pluripotent stem cells and a method for screening X-linked adrenal protein dystrophy disease using cells differentiated from inverted pluripotent stem cells.

X-linked adrenoleukodystrophy (X-ALD) is an adrenoleukodystrophy protein, which has the ability to break down long chain fatty acids (VLCFAs) of C26: 0 and C24: 0. A disease caused by genetic mutation of ABCD1 (an ATP-binding-cassette transporter superfamily D member 1) encoding ALDP or ABCD1) (1) (2). Abnormally high levels of VLCFA result in primary symptoms in neural cells of the nervous system, adrenal cortex and testes (3, 4). X-ALD symptoms, with a prevalence of 1 per 20,000, show a variety of phenotypes, typically 1) Childhood Cerebral form ALD (CCALD, 3-10) with the most lethal fast progressive inflammation demyelination. Onset) dies within a few years after the onset of symptoms, and 2) a mild adult form called adrenomyeloneuropathy (AMN, about 28-9 years old) with early symptoms limited to the spinal cord and peripheral nerves. Slow progression (5). Interestingly, there seems to be no direct link between the ABCD1 gene variant and the clinical phenotype (6), and even identical pairs with the same variant of the ABCD1 gene develop into other phenotypes (7).

Currently, no successful treatment for X-ALD has been developed. In conservative therapy, Lorenzo's oil normalizes VLCFA levels in the serum of X-ALD patients, but this cannot prevent the progression of patients with neurological symptoms (5). Hematopoietic stem cell transplantation (HSCT) (8) and genetically modified autologous HSCT have been shown to have therapeutic effects only in the early CCALD. With several possibilities, including pharmacological introduction of ABCD2, the closest homologs of ABCD1 carriers (10, 11) and inflammation reduction (12) using immunomodulatory drugs have also been attempted. One of the reasons why it is difficult to treat X-ALD patients is that treatment options prescribed to patients are extremely limited, depending on the clinical phenotype and disease progression stage. Although typically diagnosed of X-ALD with the ratio of VLCFA to C22: 0 (usually C26: 0) in serum (or fibroblasts), this ratio shows good correlation with the progression of subtypes or disease (13, 14). On the other hand, a recent study with post-mortem brains reported that accumulation of VLCFA in white matter was associated with disease phenotype and severity (15, 16). Unfortunately, however, VLCFA levels of oligodendrocytes (OL) cannot be readily measured from surviving X-ALd patients. In this respect, oligodendrocytes differentiated from patient-specific induced pluripotent stem cells (iPSCs) have a special opportunity to control the levels of VLCFA in patients' oligodendrocytes, ie phenotype and disease intensity rate. Will provide.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

In this study, the inventors established two major types of iPSCs in X-ALD, CCALD and AMN, and differentiated them inside oligodendrocytes and neurons. These iPSC-based cell models of X-ALD provided valuable information about X-ALD, for example, that VLCFA accumulation occurs to varying degrees depending on cell type and disease subtype. In addition, abnormal accumulation of VLCFA in X-ALD-oligodendrocytes can be reduced by lovastatin (17), or in vitro of X-ALD fibroblasts with 4-PBA (4-phenylbutyrate). Levels were shown to be normalized (10). Since the X-ALD mouse model does not faithfully reflect human pathological abnormalities, the cell model system using the X-ALD-iPSC of the present invention investigates the causative pathophysiology of X-ALD and develops disease phenotype-specific therapies. It will provide you with a great opportunity.

Accordingly, it is an object of the present invention to provide a method for producing a differentiated induced pluripotent stem cell.

Another object of the present invention is to provide a method for differentiating induced pluripotent stem cells prepared by reverse differentiation into oligodendrocytes.

Still another object of the present invention is to provide a method for screening an X-ALD therapeutic agent candidate.

Another object of the present invention to provide a differentiation-induced pluripotent stem cells of the X-ALD patient prepared by the method for producing a differentiation-induced pluripotent stem cells.

Another object of the present invention is to provide autologous oligodendrocytes of X-ALD patients differentiated from pluripotent stem cells prepared by pluripotent stem cells.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method for producing induced differentiated pluripotent stem cells, comprising the following steps.

(a) introducing a combination of genes of OCT4, SOX2, KLF4 and c-MYC as a transgene into a vector;

(b) transforming the transgene-inserted vector into human somatic cells derived from an X-linked adrenoleukodystrophy (X-ALD) patient; And

(c) culturing the human fibroblasts after transformation to produce a reverse differentiated pluripotent stem cell form.

According to another aspect of the present invention, the present invention provides an induced pluripotent stem cell of an X-linked adrenoleukodystrophy (X-ALD) patient prepared by the above method. .

As used herein, the term 'induced pluripotent stem cell' refers to a cell induced to have pluripotent differentiation ability through artificial dedifferentiation from differentiated cells, also referred to as induced pluripotent stem cell. Induction of pluripotent stem cells has almost the same characteristics as embryonic stem cells, specifically similar cell morphology, similar gene and protein expression patterns, in vitro and in It has pluripotency in vivo , forms teratoma, inserts into blastocyst of mouse, forms chimera mice, and allows germline transmission of genes. The reverse differentiated induced pluripotent stem cells of the present invention include all derived derived differentiated pluripotent stem cells such as humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, rabbits, and the like. Induction of differentiation of pluripotent stem cells, most preferably induction of pluripotent stem cells derived from X-ALD patients.

As used herein, the term “transgene” refers to a gene or genetic material that is transferred by natural migration or by genetic engineering technology from one organism to another. Specifically, it is a DNA segment containing a gene sequence which is separated from one organism and introduced into another organism. The gene sequence used as a trans gene in the present invention uses OCT4, SOX2, KLF4 and c-MYC as transgenes in a vector, which is necessary for reverse differentiation from dedifferentiated to pluripotent stem cells. Reverse differentiation is an epigenetic retrograde process that returns existing differentiated cells to an undifferentiated state to enable formation of new differentiated tissues, also called reprogramming, and is based on the reversibility of epigenetic changes in the cell genome. will be. According to the object of the present invention, the 'de-differentiation' is a process for returning the differentiated cells having a differentiation capacity of 0% or more and less than 100% to the undifferentiated state is all included therein, for example, differentiation having a differentiation capacity of 0% It may also include the process of undifferentiated cells into differentiated cells having a differentiation capacity of 1%.

The method of proceeding to the steps (b) and (c) introduces a combination of genes of OCT4, SOX2, KLF4 and c-MYC, which are genes capable of reverse differentiation into retroviral vectors purchased from Addgene (Cambridge, MA). In order to inoculate human X-ALD-fibroblasts (GM04496 and GM17819, Coriell Inst.) In a 12-well plate at a level of 5 x 10 ⁴ cells / well, to 2-7 mg / ml concentration of protamine sulfate, more preferably Transforms fibroblasts for 24 hours with supernatant containing four viral vectors in the presence of protamine sulfate at a concentration of 5 mg / ml. Five days after transformation, fibroblasts were re-inoculated into a plate with a feeder layer of STO cells (ATCC) treated with mitomycin-C (Mitomycin-C, MMC), and 20 days after transformation, human embryonic stem cells ( Colony in human Embryonic Stem Cell (hESC) form can be obtained by mechanical degradation.

The medium used for culturing human somatic cells to obtain the dedifferentiation induced pluripotent stem cells after transformation includes any conventional medium. For example, Eagles' MEM (Eagle's minimum essential medium, Eagle, H. Science 130: 432 (1959)), α-MEM (Stanner, CP et al., Nat . New Biol . 230: 52 (1971)), Iscove's MEM (Iscove, N. et al, J. Exp Med 147:... 923 (1978).....), 199 medium (Morgan et al, Proc Soc Exp Bio Med ., 73: 1 (1950) ), CMRL 1066, RPMI 1640 (Moore et al, J. Amer Med Assoc 199:.... 519 (1967)....), F12 (Ham, Proc Natl Acad Sci USA 53: 288 (1965)), F10 (Ham, RG Exp . Cell Res . 29: 515 (1963)), DMEM (Dulbecco's modification of Eagle's medium, Dulbecco, R. et al., Virology 8: 396 (1959)), a mixture of DMEM and F12 (Barnes, D. et al., Anal . Biochem . 102:. 255 (1980) ), Waymouth's MB752 / 1 (Waymouth, C. J. Natl Cancer Inst . 22: 1003 (1959)), McCoy's 5A (McCoy, TA, et al, Proc Soc Exp Biol Med 100:...... 115 (1959).) And MCDB series (Ham, RG et al, In Vitro 14:11 (1978)) may be used, but is not necessarily limited thereto.

According to a preferred embodiment of the present invention, the vector used in the present invention is used for the introduction of non-viral mediated dedifferentiation factors using viral-mediated or non-viral vectors using retroviruses and lentiviruses, protein and cell extracts, and the like. Or reverse differentiation with stem cell extracts, compounds, and the like, more preferably retroviruses.

According to a preferred embodiment of the present invention, human fibroblasts are used to obtain pluripotent stem cells in differentiation in the present invention. More preferably human fibroblasts derived from X-linked adrenoleukodystrophy (X-ALD) patients, most preferably pediatric cerebral type X-ALD pediatric cerebral type X-ALD (Childhood Cerebral) human fibroblasts derived from patients with form ALD, CCALD) or adrenomyeloneuropathy (AMN).

According to another aspect of the invention, the step of differentiating induction of differentiated induced pluripotent stem cells prepared by the steps (a), (b), (c) of the present invention into oligodendrocyte (post-c) It includes a method comprising a.

According to a preferred embodiment of the present invention, the post-c step comprises a method comprising the following substeps:

(post-c-1) culturing the prepared differentiated induced pluripotent stem cells to obtain embryonic-like cell mass (Embryoid Body, EB) and to differentiate them into neural rosette structure (Neural Rosette structure);

(post-c-2) differentiating the neural rosette structure into spherical neural masses (SNMs);

(post-c-3) differentiating the neural precursors into oligodendrocyte precursor cells (OPCs); And

(post-c-4) differentiating the oligodendrocyte precursors into oligodendrocytes.

For differentiation of embryonic-like cell masses (EBs), hESC / hiPSC colonies were separated into colonase type IV, and EBs were isolated from basic fibroblast proliferation factor with the addition of the low molecular chemical dosomorphin (dorsomorphin, SB431542) or SD431542. Formed by culturing in basic Fibroblast Growth Factor-depleted (bFGF-depleted) ES cell culture medium. After 4 days, EB was inoculated onto a culture dish coated with Matrigel (BD) in DMEM / F12 medium containing N2 additive (R & D System) and 20 ng / ml bFGF to obtain a neural rosette structure. . Suspension-culture is performed by treatment with 10 ng / ml of bFGF to produce spherical neural mass (SNM). SNM was re-inoculated onto Matrigel-coated petri dishes and oligodendrocytes in N2 medium containing 10 ng / ml bFGF and 10 ng / ml epidermal growth factor receptor (EGF, PeproTech). precursor cells (OPC) for 4-8 days, followed by 8 cells in N2 medium supplemented with 10 ng / ml bFGF and 10 ng / ml platelet-derived growth factor (PDGF, PeproTech). Incubate further for days. Final differentiation of oligodendrocytes is induced by removing the growth factor and adding 30 ng / ml of 3,3′5-triido-L-tyronein (T3) (Sigma) for 3-4 weeks (Medium constitution: DMEM / F12 with N2 and T3 added) (19, 23, 24). Neuronal differentiation proceeds with minor modifications to existing methods (19, 25).

According to a more preferred embodiment, the oligodendrocytes of the present invention are characterized in that the content of intracellular long tail chain fatty acid (Very long-chain fatty acid, VLCFA) is increased compared to normal oligodendrocytes. Long tail fatty acids in oligodendrocytes obtained by dedifferentiation from and re-differentiation from cells of patients with X-ALD compared to oligodendrocytes of normal people are oligodendrocytes, which appear at about 2 to 30 times higher concentration, more preferably. It is about 5-20 times higher.

According to another aspect of the present invention, the present invention provides a method for screening an X-linked adrenoleukodystrophy (X-ALD) therapeutic agent candidate comprising the following steps:

(a) treating a therapeutic candidate to cells differentiated from dedifferentiation induced pluripotent stem cells prepared by dedifferentiation from cells of an X-ALD patient; And

(b) analyzing a decrease in the amount of Very long-chain Fatty Acid (VLCFA) in the differentiated cells, upregulation of the expression of ABCD2 gene or downregulation of the expression of ELOVL1 gene.

Cells differentiated from dedifferentiation-induced pluripotent stem cells prepared by dedifferentiating from the cells of the X-ALD patient are carried out in the manner of step (a) to step (c) and step post c-1 to post c-4 Is produced. When the concentration of long tail fatty acid is observed by treating the therapeutic candidate in the differentiated cells produced by the method, it can be confirmed that the therapeutic candidate is effective for treating X-ALD disease. At this time, the concentration of long tail fatty acid is reported that the therapeutic effect of the candidate substance is present when the decrease in the concentration of 20% or more than the treatment without the candidate drug, more preferably 40% or more, and most preferably 60 In case of decrease of more than%, it is determined that the therapeutic effect of the candidate substance exists.

In the present invention, the criterion for judging the effect of a candidate drug for treating X-linked adrenal protein dystrophy is not limited to observing whether the concentration of long tail fatty acid is decreased. X- association for adrenoleukodystrophy patient is ABCD1 gene is damaged, it is determined whether the up-regulation of gene expression is reduced, whereby a fatty acid tail is unable to smoothly decompose properly bar, the ABCD2 gene that replaces a gene of the damage to the ABCD1 Indirectly, the concentration of long tail fatty acids can be determined. When the therapeutic candidate is administered in the present invention, when the expression level of the ABCD2 gene is 1.5 times or more compared to the control group, the therapeutic efficacy of the candidate is present, and more preferably, the therapeutic effect is present when it is upregulated by 2 or more times. see.

In addition, ELOVL1 gene, a gene affecting the concentration of long-tail fatty acids, is a gene involved in the synthesis of long-tail fatty acids, and high concentration of long-ring fatty acids accumulates intracellularly during upregulation. When the candidate drug is administered in the present invention, ELOVL1 gene down-regulation can be determined to determine the therapeutic efficacy of the drug candidate.

When the expression level of the gene after administration of the therapeutic candidate is downregulated by about 30-0% compared to the control group, the therapeutic efficacy of the candidate is present, and more preferably 20-0%.

To determine whether upregulation or downregulation, the expression levels of ABCD2 and ELOVL1 genes, the amount of ABCD2 and ELOVL1 proteins or the activity of ABCD2 and ELOVL1 proteins are measured in the cells treated with the sample. As a result of the measurement, if the expression level of ABCD2 and ELOVL1 genes, the amount of ABCD2 and ELOVL1 proteins or the activity of ABCD2 and ELOVL1 proteins were up-regulated or down-regulated, the sample was X- It can be determined as a therapeutic substance for ALD disease.

Measurement of the change in the expression level of the ABCD2 and ELOVL1 gene can be carried out through various methods known in the art. For example, RT-PCR (Sambrook et al., Molecular Cloning . A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001)), Northern blotting (Peter B. Kaufma et al., Molecular and Cellular Methods in Biology and Medicine , 102-108, CRC press), hybridization reaction using a cDNA microarray (Sambrook et al., Molecular Cloning . A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001)) or in situ (in situ ) Hybridization reaction (Sambrook et al., Molecular Cloning . A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001)).

When carrying out according to the RT-PCR protocol, first, total RNA is isolated from the cells treated with the sample, and first strand cDNA is prepared using oligo dT primer and reverse transcriptase. Subsequently, the first chain cDNA is used as a template, and PCR reaction is performed using the ABCD2 and ELOVL1 gene-specific primer sets. ABCD2 and ELOVL1 gene-specific primer sets are illustrated in SEQ ID NOs: 3 and 4. Then, PCR amplification products are electrophoresed and the formed bands are analyzed to measure changes in expression levels of the ABCD2 and ELOVL1 genes.

According to a more preferred embodiment, the X-linked adrenoleukodystrophy (X-ALD) of the present invention is a pediatric cerebral type X-ALD pediatric cerebral type X-ALD (Childhood Cerebral form ALD, CCALD) Or adrenal spinal neuropathy (adrenomyeloneuropathy, AMN).

According to a more preferred embodiment, the differentiated cells of the present invention is characterized in that the oligodendrocytes, but is not necessarily limited to oligodendrocytes.

According to another aspect of the present invention, the step of differentiating the reverse differentiation induced pluripotent stem cells prepared by the step (a), (b), (c) of the present invention into oligodendrocyte (post-c- Neural Rosette structure of X-linked adrenoleukodystrophy (X-ALD) patients differentiated from dedifferentiation-induced pluripotent stem cells prepared by the method comprising 1 to c-4). to provide.

According to another aspect of the present invention, the step of differentiating the reverse differentiation induced pluripotent stem cells prepared by the step (a), (b), (c) of the present invention into oligodendrocyte (post-c Neuronal precursors (SNMs) of X-linked adrenoleukodystrophy (X-ALD) patients differentiated from inverted induced pluripotent stem cells prepared by methods comprising -1 to c-4). ).

According to another aspect of the present invention, the step of differentiating the reverse differentiation induced pluripotent stem cells prepared by the step (a), (b), (c) of the present invention into oligodendrocyte (post-c Oligodendrocyte precursor cells of X-linked adrenoleukodystrophy (X-ALD) patients differentiated from dedifferentiation-induced pluripotent stem cells prepared by methods comprising -1 to c-4) , OPCs).

According to another aspect of the present invention, the step of differentiating the reverse differentiation induced pluripotent stem cells prepared by the step (a), (b), (c) of the present invention into oligodendrocyte (post-c Provided are oligodendrocytes of X-linked adrenoleukodystrophy (X-ALD) patients differentiated from pluripotent induced pluripotent stem cells prepared by the method comprising -1 to c-4).

Instead of directly administering a drug candidate to the patient, a neural rosette structure, a neural precursor, may be obtained by re-differentiating pluripotent stem cells obtained by dedifferentiating the somatic cells of the patient into oligodendrocytes. autologous oligodendrocytes can be produced through spherical neural masses (SNMs) and oligodendrocyte precursor cells (OPCs), and indirectly by self-heeding without the direct administration of drugs to patients. Decreased long-tailed fatty acid may be determined by treating drugs on oligodendrocytes. As a result, it is possible to select a patient-specific medicine, which is the drug that shows the best effect regardless of the efficacy of the drug substance that can be different for each individual, there is an advantage that can be confirmed in advance which drug among the various drugs is not the most cytotoxic.

The features and advantages of the present invention are summarized as follows:

(a) According to the present invention, induction of pluripotent stem cells from human fibroblasts derived from X-linked adrenoleukodystrophy (X-ALD) patients can be prepared.

(b) Screening of candidate drugs for X-linked adrenal protein dystrophy by using oligodendrocytes differentiated into pluripotent stem cells can confirm the efficacy of the drug.

(c) patient-specific treatment is possible by preparing autologous oligodendrocytes using a method of preparing pluripotent stem cells.

1 is a photograph showing the characteristics of iPSC derived from skin fibroblasts of X-ALD patients. CCALD-iPSC and AMN-iPSCs from 6 and 32 year old patients, respectively, formed tightly packed colonies as opposed to the spindle form of fibroblasts. CCALD-iPSC-10 and AMN-iPSC-3 cell line alkaline phosphatase (AP) staining and immunofluorescence analysis of the omnipotent markers NANOG and Tra 1-60 showed that the CCALD- and AMN-iPSCs showed ESC-like properties. Indicated. The scale bar is 100 탆.
Figure 2 is a photograph showing the characteristics of iPSC derived from dermal fibroblasts of X-ALD patients, any abnormal characteristics in the teen passaged chromosome karyotype analysis (46, XY) of CCALD-iPSC-10 and AMN-iPSC-3 Shows that it did not appear.
Figure 3 is a photograph showing the characteristics of iPSC derived from dermal fibroblasts of X-ALD patients, the formation of teratoma observed after injecting CCALD- and AMN-iPSC into SCID / beige mice secreted epithelium (ectoderm, PAS), Intestinal epithelium (endoderm, H & E) and cartilage (mesoderm, Alicia blue) are illustrated as three types of germ layers.
Figure 4 is a photograph showing the characteristics of iPSC derived from dermal fibroblasts of X-ALD patients between CCALD- or AMN-iPSC and CCALD- or AMN-fibroblasts (left panel) and CCALD- and H9 hESC (right panel). This is a multiscatter plot comparing the overall gene expression profile of. Red dots indicate cases where the difference in gene expression between two samples is more than twofold.
5 is a schematic diagram of the oligodendrocyte differentiation protocol for the generation of oligodendrocytes from the control group (WT), CCALD and AMN. DM is dosomorphin and SB is SB431542.
6 is a representative photograph showing morphological changes during oligodendrocyte differentiation for the generation of oligodendrocytes from control (WT), CCALD and AMN. Phase difference picture of CCALD-SNM, CCALD-OPC and CCALD-OL. CCALD-OPC showed PDGF-R ⁺ (red arrow) (inset: PDGF-R, green & DAPI, blue). A typical, finally differentiated highly branched oligodendrocyte (arrow) was observed in CCALD-OL. The scale bar is 20 μm.
FIG. 7 shows OPC markers of A2B5 (red) and PDGF-R (green) occurring in WT-CCALD and AMN-iPSCs for the generation of oligodendrocytes from control (WT), CCALD and AMN. Cells with typical OPC forms were shown. The scale bar is 20 μm.
FIG. 8 shows mature oligodendrocytes of Myelin basic protein (MBP) -immune reactive differentiated from WT-, CCALD- and AMN-OPCs against development of oligodendrocytes from control (WT), CCALD and AMN. Glial cells were observed after 3-4 weeks in N2 medium containing thyroid hormone (T3). Highly branched dendrites were observed in WT-oligodendrocytes, CCALD-oligodendrocytes, and AMN-diligate glial cells. OL is a oligodendrocyte and the scale bar is 20 micrometers.
9 shows a comparison of X-ALD-related phenotypes between CCALD- and AMN-oligodendrocytes and pharmacological efficacy, with hESC, WT-iPSC, WT-oligodendrocytes, CCALD-iPSC and CCALD-oligodendrocytes VLCFA concentration is indicated. The fat was extracted and the derivative was modified with methyl ester and separated by gas chromatography. The C26: 0 / C22: 0 ratio was confirmed by methyl esters compared to known standards. This data represents the ratio of C26: 0 to C22: 0. OL is a oligodendrocyte. All values are mean ± standard deviation. n = 4; ^* P <0.05.
10 shows a comparison of X-ALD-related phenotypes between CCALD- and AMN-oligodendrocytes and pharmacological efficacy, with hESC, WT-iPSC, WT-oligodendrocytes, CCALD-iPSC and CCALD-oligodendrocytes The relative expression level of EVOVL1 gene in the stomach was shown. All values are mean ± standard deviation. n = 4; ^** P <0.001.
FIG. 11 shows a comparison of X-ALD-related phenotypes between CCALD- and AMN-oligodendrocytes and pharmacological efficacy, showing VLCFA concentrations of both neurons and oligodendrocytes differentiated from WT-, CCALD- and AMN-iPSCs. Showed respectively. This data represents the ratio of C26: 0 to C22: 0. n = 4; ^* P <0.05, ^** P <0.001.
FIG. 12 shows a comparison of the X-ALD-related phenotype between CCALD- and AMN-oligodendrocytes and pharmacological efficacy, where lovastatin but not 4-PBA significantly reduced the C26: 0 / C22: 0 ratio. The oligodendrocytes differentiated from CCALD-iPSC and WT-iPSC were treated with the indicated drug for 6 days and the VLCFA ratio was measured. All values are mean ± standard deviation. n = 4; ^** P <0.001.
FIG. 13 shows a comparison of X-ALD-related phenotypes between CCALD- and AMN-oligodendrocytes and pharmacological efficacy, with 4-PBA or lovastatin treatment showing ABCD2 in oligodendrocytes in both CCALD-iPSC and WT-iPSC. Was induced. The oligodendrocytes were treated with the indicated drug for 3 days and quantitative RT-PCR was used. Transcription levels were normalized to beta-actin expression. n = 5; ^* P <0.05, ^** P <0.001.
14 is a fluorescence photograph of iPSCs derived from dermal fibroblasts of ALD patients. Similar features were shown. The scale bar is 100 탆.
Figure 15 is a RT-PCR analysis of the characteristics of iPSC derived from dermal fibroblasts of ALD patients, a large deletion of 8-10 exons by genomic sequencing of the ABCD1 gene. RT-PCR analysis showed that ABCD1 gene transcription for a particular region of exon 10 (*: cDNA starting region 3206-3534 base) occurred in fibroblast control, iPSC control and hESC, whereas CCALD-fibroblast and CCALD- It did not appear in the iPSC cell line. 1. distilled water (DW); 2. fibroblast-control; 3. CCALD-fibroblasts; 4. hESC; 5. iPSC-control; 6. CCALD-iPSC-2; 7.CCALD-iPSC-10
Figure 16 shows the pluripotency of CCALD-fibroblasts (1), CCALD-iPSC-2 (2), CCCALD-iPSC-10 (3), and hESC (4) for the characteristics of iPSCs derived from dermal fibroblasts from ALD patients. RT-PCR result photo for the expression of markers OCT4, SOX2, NANOG, hTERT, REX1 and GDF3.
FIG. 17 is an RT-PCR photograph of the characteristics of iPSCs derived from dermal fibroblasts of ALD patients, with little expression of retroviral transgenes found in iPSC cell lines. Semi-quantitative RT-PCR analysis of the expression of retroviral transgenes in CCALD-fibroblasts, CCALD-iPSCs and hESCs, as a whole, endogenous (endo) and retrovirus delivered (trans) genes (OCT4, SOX2, Relative expression levels of MYC and KLF4) can be determined. GAPDH was used as the loading control. 1. Control WT-fibroblasts; 2. CCALD-fibroblasts; 3. CCALD-iPSC-2; 4. CCALD-iPSC-6; 5. CCALD-iPSC-10; 6. CCALD-iPSC-14; 7. hESC.
FIG. 18 shows bisulfite genomic sequencing analysis of OCT4 and NANOG promoter regions in CCALD-fibroblasts, CCALD-iPSC-2 and CCALD-iPSC-10 for the characteristics of iPSCs derived from dermal fibroblasts from ALD patients. . Open or closed circles represent unmethylated CpG and methylated CpG, respectively, in the indicated promoter regions. The numbers in the left row indicate the CpG regions relative to the transcription start position.
FIG. 19 shows that the iPSC-based differentiation of iPSCs derived from dermal fibroblasts from ALD patients results in all three germ cells: ectoderm (Nestin, green; Sox1, red), endoderm (AFP (α-fetus). Protein), green; HNF3β, red) and mesoderm (sproutitis, green). The scale is 100 μm.
FIG. 20 relates to OPC development from hESCs, WT-iPSCs, CCALD-iPSCs, and AMN-iPSCs, wherein the percentage of A2B5- (panel A) and PDGF-R-expressing cells (panel B) in total proteins was WT-, CCALD -And approximately> 70% similar to OPC derived from ANM-iPSC. All values are mean ± standard deviation, n = 10.
FIG. 21 is an immunofluorescence picture (panel A) and plot (panel B) for the development of neurons in WT-iPSC, CCALD-iPSC and AMN-iPSC. Nerve differentiation from WT-, CCALD- and AMN-iPSCs was not affected. Tuj-1-expressing cells in total cells are approximately 75% or more similar to those derived from WT-, CCALD- and AMN-iPSCs (red, Tuj-1 and blue, DAPI). Immunofluorescence images (red, Tuj-1 and blue, DAPI) (panel A) of neurons from WT-, CCALD- and AMN-iPSCs show panel differentiation (Panel B) of Tuj-1 ⁺ cells. All values are mean ± standard deviation, n = 10.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Experimental Materials and Experimental Methods

Human iPSC Generation

Retroviral vectors were purchased from Addgene (Cambridge, Mass.). In brief, human X-ALD-fibroblasts (GM04496 and GM17819, Coriell Inst.) Were seeded in 12-well plates at 5 × 10 ⁴ cells / well. The next day fibroblasts were transformed for 24 hours with supernatant containing four viral vectors in the presence of 5 mg / ml protamine sulfate (antagonist of heparin). Five days after transformation, fibroblasts were re-inoculated onto a plate with a feeder layer of STO cells (ATCC) treated with Mitomycin-C (MMC). Twenty days after transformation, colonies with human Embryonic Stem Cell (hESC) morphology were mechanically digested.

Cell culture

Fibroblasts were collected from Dulbecco's modified Eagle's medium (DMEM), 15% or 10% fetal bovine serum (GIBCO), 1 mM glutamine (GIBCO), 1% non-essential amino acids (Invitrogen) and penicillin / streptomycin (Invitrogen). ) Was cultured in the medium for fibroblasts. HESC medium supplemented with 10% KnockOut Serum Replacement (Invitrogen), 1 mM glutamine (Invitrogen), 1% non-essential amino acids (Invitrogen), 0.1 mM β-mercapto ethanol (Sigma) and 4 ng / ml bFGF Human-induced Pluripotent Stem Cell (hiPSC) and hESC cell lines were maintained on an MMC-inactive feeder layer in (DMEM / F12 (Invitrogen)). Passage was performed once every 5-7 days, in which case collagenase type IV (Invitrogen) of 1.5 mg / ml was used. hESC cell line H9 was incubated in MMC-inactivated Mouse Embryonic Fibroblasts (MEFs) according to the manufacturer's protocol. For embryonic body (EB) -based differentiation, hESC / hiPSC colonies were collected into 1.5 mg / ml collagenase type 4, separated from feeder cells using gravity, and finely ground Non-adhesive floating culture dishes (Corning) were incubated for 10 days in DMEM with 15% FBS added.

Oligodendrocytes and neural differentiation

Differentiation of oligodendrocytes was carried out by the above-mentioned method (19). Briefly, the hESC / hiPSC colonies are separated into colonase type IV, and EB is removed from the basic fibroblast growth factor-deficient with the small molecule chemical dorsomorphin (SB431542) or SD431542. and formed by culturing in depleted, bFGF-depleted) ES cell culture medium (20). After 4 days, EB was inoculated onto a culture dish coated with Matrigel (BD) in DMEM / F12 medium containing N2 additive (R & D System) and 20 ng / ml bFGF (21). After 5 days, the neural rosette structure was mechanically isolated and suspended-cultured with 10 ng / ml of bFGF to produce spherical neural mass (SNM). (22). SNM was advanced to increase neural precursor cell (NPC). SNM was re-inoculated onto a Matrigel-coated culture dish and oligodendrocyte precursor in N2 medium containing 10 ng / ml bFGF and 10 ng / ml epidermal growth factor receptor (EGF, PeproTech). cells, OPC) for 4-8 days. Thereafter, cells were further cultured for 8 days in N2 medium to which 10 ng / ml bFGF and 10 ng / ml platelet-derived growth factor (PDGF, PeproTech) were added. Final differentiation of oligodendrocytes was induced by removing the growth factor and adding 30 ng / ml of 3,3′5-triido-L-tyronein (T3) (Sigma) for 3-4 weeks. (Medium constitution: DMEM / F12 with N2 and T3 added) (19, 23, 24). Differentiation of neurons proceeded with some modifications to existing methods (19, 25).

VLCFA Assay

The VLCFA analysis was conducted at the Seoul Medical Research Institute (SCL, http://www.scllab.co.kr) and Seoul Hanaro Medical Center (http://www.hanaromf.com). The methyl ester of VLCFA was determined according to the known Moser approach (26). Briefly, 100 μl of heptacosanoic acid (C27: 0) (20 μg / ml) was added to a 250 μd sample by internal standard (2 × 10 ⁵ cells in 300 μl of dPBS). Thereafter, 1 ml of 25% (v / v) methylene chloride and 200 µl of acetyl chloride were added to methanol solvent, and heated at 75 ° C. for 1 hour to synthesize methyl ester. After cooling, 7.0 weight percent of 4 ml K ₂ CO ₃ was added to neutralize to stop the reaction. The final product of fatty acid methyl ester was extracted with 5 ml of hexane, then polar molecules were removed and purified using 2.5 ml of acetonitrile. The hexane layer was evaporated with a weak stream of nitrogen gas. The dry residue was reconstituted in 100 μl of hexane for analysis by gas chromatography (GC).

RNA Identification and PCR Analysis

Total RNA was isolated using an RNeasy Mini Kit (iNtRON Biotechnology) containing on-column DNase I digestive enzyme or Trizolreagent (Invitrogen). Complementary DNA was obtained from 1-4 μg of total RNA using a Power cDNA synthesis kit (iNtRON Biotechnology). RT-PCR and / or qRT-PCR were performed using specific primer sequences as previously described (27, 28)

For ABCD1, forward primer, GCACTGCCTGCCAAGCGAGA;

Reverse fryer, CTCCGCAGACAGCTCCCCCT;

Forward fryer for ABCD2, CTGGCCTGTGTATGAAGGAGT;

Reverse primer, TCCCGAAGACTTCCAAGAGA

Karyotyping and DNA Fingerprinting

Standard G- banding chromosome analysis was performed by GenDix Inc (Republic of Korea, http://www.gendix.com). To confirm that CCALD-iPSCs are derived from CCALD-fibroblasts, Short Tamdem Repeat (STR) analysis was used (HumanPass Inc., Korea, http://www.humanpass.co.kr). QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) and genomic DNA were isolated from CCALD-iPSC using CCALD-fibroblasts and quantitative fluorometry. Multiplex PCR using 1-2 ng of target DNA according to the manufacturer's instructions was performed on 15 STR positions (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, THO1, D13S317, D16S539, D2S1338, D19S433, VWA, TPOX, D18S51, D5S818). And FGA) containing AmpFISTR Identifiler PCR Amplification Kit (Applied Biosystems, Forster City, CA, USA).

The amplified product of PCR was subjected to capillary electrophoresis of the ABI PRISM 310 Genetic Analyzer instrument (Applied Biosystems, Forster City, Calif., USA). GeneScan collection and analysis software packages were used to determine data collection and size of fluorescently labeled DNA fragments. Genotyper solfware (version 3.7) was used for automated genotyping using standard samples and kitotype macros with kits.

Teratoma  formation

The beige mice with severe combined immunodeficient (SCID) were used to test the teratoma-forming ability of CCALD- and AMN-iPSCs as described below. About 1 × 10 ⁶ iPS cells in 20 μl dPBS were injected into the testis of SCID mice (Charles River Laboratories, Yokohama, Japan). 3-4 months after injection, xenograted groups were collected, fixed, inserted in paraffin and incised. Tissue sections were stained using hematoxylin / eosin, Alicia Blue and Periodic acid-Schiff (PAS) staining. The experiment was reviewed and approved by the Animal Experimentation Ethics Committee. All procedures were performed in accordance with the guidelines for the use and care of laboratory animals (NIH publication no. 85-23, revised 1996).

Microarray  analysis

Total RNA isolated from H9 hESCs, CCALD-iPSC-2, CCALD-iPSC-10, CCALD-iPSC-14, AMN-iPSC-3 and fibroblasts was analyzed by Macrogen Inc. (http://dna.macrogen.com/eng/ ). To obtain biotinylated cRNA, total RNA was amplified and purified using an Ambion Illumina RNA amplification kit (Ambion, Austin, USA) according to the manufacturer's instructions. According to the manufacturer's instructions (Illumina, Inc., San Diego, USA), 750 ng of labeled cRNA sample was hybridized with each human-8 expressing bead array for 16-18 hours at 58 ° C. Array signal detection was performed using Amersham fluorolink streptavidin-Cy3 (GE Healthcare Bio-Sciences, Little Chalfont, UK) according to the instructions in the Bead Array Manual. The array was scanned with an Illumina bead array Reader confocal scanner according to the manufacturer's instructions. Array data delivery processing and analysis was performed using Illumina BeadStudio v3.1.3 (Gene Expression Module v3.3.8). Hybrid quality and overall chip performance were monitored by visual inspection of both internal quality control and raw scan data. Raw data was extracted using manufacturer-provided software (Illumina BeadStudio v3.1.3 (Gene Expression Module v3.3.8). All probe signal values were numerically transformed by log and quantile normalization. Comparative analysis between sample samples was performed using fold-change, hierarchical clustering analysis using full association and Euclidean distance with similar measurements All data analysis and significant genes (DEG) ) Was visualized using ArrayAssist (Stratagene, La Jolla, USA), and R statistical language v. 2.4.1 Biological ontology-based analysis using a Panther database (http://www.pantherdb.org).

Bisulfite ( bisulfite ) gene Sequencing

Genomic DNA was isolated from patient fibroblasts and iPSCs using the Qiagen kit. Genomic sequencing was performed at Yonsei University Laboratory (Dr. Jin-Sung Lee, Seoul, Korea). To determine the validity of sequencing, general PCR was used. For bisulfite genomic sequencing, genomic DNA samples were extracted from CCALD-fibroblasts and CCALD-iPSCs. Bissulphite treatment of genomic DNA was performed using the CpGenome DNA Modification Kit (Chemicon) according to the manufacturer's instructions. The converted genomic DNA was amplified by PCR using NANOG primers (28, 29). The primer sequence was used for PCR amplification of OCT4, and Nanog promoter sequences were respectively,

5'- TAGTTGGGATGTGTAGAGTTTGAGA-3 ', 5'- TAAACCAAAACAATCCTTCTACTCC -3' and 5'- GAGTTAAAGAGTTTTGTTTTTAAAAATTAT-3 ', 5'-TCCCAAATCTAATAATTTATCATATCTTTC-3'.

PCR products were cloned in bacteria using gel-purified and T-easy vectors (Promega). Bisulfite conversion of non-CpG cytosine ranged from 80% to 99% for each clone of each sample.

Immune cell chemistry

Cells were fixed in 4% paraformaldehyde, permeated with buffer containing Triton X-100 and stained by attachment of primary antibody [Nanog (R & D systems), Oct4 (Santa Cruz), SOX2 (Chemicon), SSEA4 (Chemicon), TRA-1-81 (Chemicon), TRA-1-60 (Chemicon), HNF3γ (Santa Cruz), Brachyury (Santa Cruz), PAX6 (DSHB), Tuj1 (COVANCE), Nestin (Chemicon), A2B5 (R & D systems), NG2 (Chemicon), PDGF-R (R & D systems), and MBP (Chemicon)]. Secondary antibodies (Molecular Probes) and / or DAPI counterchromosomes labeled with the appropriate Alexa Fluor 488- or 568 were used for visualization.

Experiment result

X- ALD  Obtained from two main types of patient fibroblasts iPSC Differentiation and properties of

Dermal fibroblasts (named CCALD-fibroblasts) from 6-year-old CCALD boys and cutaneous fibroblasts (named AMN-fibroblasts) from 32-year-old AMN males were identified as four reprogramming genes (or transgenes) ( OCT4 , Retroviral vectors comprising SOX2 , KLF4 and c- MYC ) were transformed. Four weeks after viral transformation, 16 and four ES-like colonies were obtained in CCALD- and AMN-fibroblasts, respectively (FIG. 1). These cells named CCALD-iPSC or AMN-iPSC have been successfully grown by mechanical passage. CCALD-iPSC-2 or 10 and AMN-iPSC-3 clones were used for further evaluation in this study. All of these exhibiting potent basic phosphatase activity showed human embryonic stem cell (hESC) morphological properties and expressed as omnipotent differentiation markers including OCT4, NANOG, SOX2, SSEA4, TRA1-60 and TRA1-81. (FIG. 1 and FIG. 14) showed normal karyotype (46 XY) in teenage passages (FIG. 2). Genomic DNA sequencing found a macrodeletion of the ABCD1 gene in both types of ALD-fibroblasts; Exon 8-10 of CCALD-fibroblasts and exon 7-10 of AMN-fibroblasts, respectively (FIG. 15, no data).

RT-PCR confirmed that full-length ABCD1 transcription did not occur from CCALD-fibroblasts as well as CCALD-iPSC (FIG. 15). DNA fingerprinting analysis via microsatellite markers demonstrated that both CCALD- and AMN-iPSC cell lines were derived from their previous generation dermal fibroblasts (Tables 1 and 2).

Table 1 shows the genetic identity of CCALD-iPSC and CCALD-fibroblasts at 16 independent sites through DNA fingerprinting of CCALD-iPSC.

Table 2 shows the genetic identity of AMN-iPSC and AMN-fibroblasts at 16 independent sites through DNA fingerprinting of AMN-iPSC.

Through RT-PCR endogenous omnipotence-related genes OCT4, SOX2, NANOG, hTERT, REX1 and GDF3 is like the hESC was found that actively expressed in iPSC (16), whereas it retroviral expression of delivery transgene Was hardly found in iPSC strains (FIG. 17). Promoters of OCT4 and NONOG resulted in decreased methylation in iPSCs (FIG. 18). The omnipotence of iPSCs was assessed by embryonic body mass formation in vitro (25). Both immunostaining and RT-PCR analysis showed that iPSC cell lines can spontaneously differentiate into three embryonic germ layers (ectoderm, endoderm and mesoderm) (FIG. 19).

Injection of CCALD- and AMN-iPSCs into SCID mice resulted in the formation of teratomas consisting of mature cysts representing the three germ layers of all embryonic stages (FIG. 3), furthermore indicating that X-ALD-iPSCs remain omnipotent. Confirmed. Overall gene expression patterns of CCALD- and AMN-iPSCs were similar to those of H9-hESC than CCALD- and AMN-fibroblasts (FIG. 4).

Overall, the present invention demonstrated that both CCALD- and AMN-iPSCs are very similar to hESCs, and that the ability to differentiate into all cell types in the human body is maintained.

WT -, CCALD - and AMN - iPSC Glial cell differentiation from

The oligodendrocytes are one of the major cell types that affect X-ALD. To confirm which site of the ABCD1 gene affects oligodendrocyte differentiation, oligodendrocytes were prepared from WT-, CCALD and AMN-iPSC following a slight modification of the original protocol established by the inventors (19). , 25). First, incubated for 4 days with doxomorphine (DM) and SB431542 before attaching to the Matrigel-coated dish (FIG. 5) (25). After 5 days, these cultures developed with neural rosette structures expressed preferentially with the neural stem cell markers Nestin and Pax6 (FIG. 5, not shown in data).

Subsequently, neural precursors (SNMs) formed in the neural rosette structure were used to proliferate to neural precursors cells (NPCs) (19, 23, 24) (FIGS. 5 and 6). For further differentiation into oligodendrocyte precursor cells (OPCs), neural precursors (SNMs) were inoculated onto Matrigel-coated dishes, EGF (epidermal growth factor) and platelet-derived growth factor (EPC). Cultured for about 2 weeks in the presence of PDGF (FIGS. 5 and 6). Immunostaining experiments with A2B5 and PDGF-R antibodies revealed that induced cells express markers for committed OPCs (FIG. 7). ). During induction of OPC, there is no difference in cell morphology or differentiation capacity among the various OPCs differentiated from hESCs, WT-, CCALD-, and AMN-iPSCs; hESC-, WT-, CCALD-, and AMN-OPCs were [83.6 ± 0.90%, 73.1 ± 2.39%, 79.2 ± 2.06% (CCALD-iPSC-2 cell line; 74.7 ± 2.01%) in A2B5 ⁺ cells among total cells, respectively And 75.2 ± 2.16%], and in of PDPD-R ⁺ cells [82.5 ± 2.25%, 90.27 ± 1.25%, 82.7 ± 1.27% (CCALD-iPSC-2 cell line; 68.0 ± 2.21) and 70.9 ± 1.46% ] Occurred (FIG. 20).

Two weeks after inoculation, OPCs were incubated in the presence of Thyroid Hormone (T3) for the next 3-4 weeks for final differentiation (FIG. 5). Myelin basic protein (MBP, marker for mature oligodendrocytes) -immunoreactive cells were observed after differentiation (FIG. 8). We failed to find a difference in the differentiation capacity of oligodendrocytes among hESCs, WT-iPSCs, CCALD-iPSCs, and AMN-iPSCs, which are not directly correlated to the deletion of the ABCD1 gene during oligodendrocyte differentiation and developmental stages. To indicate.

X- ALD The characteristics of the relevant phenotype

Abnormal accumulation of saturated VLCFAs in skin fibroblasts from X-ALD patients has been reported with high C26: 0 / C22: 0 ratios (30). We analyzed VLCFA concentrations in CCALD-oligodendrocytes and CCALD-iPSCs to determine if these cells represent the biochemical properties seen in X-ALD. Interestingly, the VLCFA concentration of CCALD-iPSC was kept low in hESCs, WT-iPSCs and WT-oligodendrocytes. However, CCALD-oligodendrocytes differentiated from CCALD-iPSC showed a very high C26: 0 / C22: 0 ratio (about 5.18-fold increase) compared to CCALD-iPSC (FIG. 9). This result suggests that VLCFA was increased during oligodendrocyte differentiation of CCALD-iPSC.

VLCFA homeostasis is balanced between endogenous synthesis of ELOVL1 protein and degradation via peroxysome beta-oxidation, and we have seen whether ELOVL1 gene expression is upregulated in oligodendrocytes. As expected, the expression levels of ELOVL1 genes in WT- and CCALD-oligodendrocytes were significantly increased compared to WT- and CCALD-iPSC, respectively (FIG. 10). These results indicate that the looks, because the balance is broken VLCFA homeostasis resulting in increased expression of the mutant gene and ABCD1 a high concentration of an abnormal gene ELOVL1 VLCFA in CCALD- diluent projection glial cells. In an effort to uncover all the differences between the subtypes of X-ALD, we measured the concentration of VLCFA in oligodendrocytes and neurons differentiated from CCALD- and AMN-iPSCs (FIGS. 9-13, 21). As expected, the concentration of VLCFA in oligodendrocytes and neurons of both X-ALD subtypes was very high compared to the concentration of their WT-controls. Remarkably, CCALD-oligodendrocytes contained a much higher concentration of VLCFA (C26: 0 / C22: 0) than AMN-oligodendrocytes (FIG. 11) and severe demyelination in the CCALD-type postmortem brain. It was first observed to be associated with (15). On the other hand, no statistically significant change in VLCFA concentration was found between AMN- and CCALD-neurons (FIG. 11). These results all suggest that a serious clinical picture in CCALD may be associated with abnormal VLCFA accumulation in oligodendrocytes, and our model system provides a clue to the typical phenotype of the X-ALD brain.

X- ALD Pharmacological characteristics of oligodendrocytes

4-PBA and lovastatin effectively lower VLCFA concentrations in X-ALD fibroblasts via upregulation of the ABCD2 gene (10, 31). To date, however, it has not been demonstrated whether these drugs also affect VLCFA accumulation in oligodendrocytes in X-ALD patients. We therefore sought to investigate the effects of 4-PBA and lovastatin on VLCFA concentrations in CCALD-fibroblasts.

After treatment with lovastatin (1 mM for 6 days) and 4-PBA (1 mM for 6 days), C26: 0 / C22: 0 in CCALD-fibroblasts decreased 64.6% and 26.4%, respectively (FIG. 12), VLCFA The concentration shows a significant decrease by these drugs. The moderate effect by 4-PBA seems to be due to the low dose (1 mM) of the drug used in this study: If the dose of 4-PBA is 5 mM, a sharp decrease in the concentration of VLCFA in CCALD-fibroblasts is rare. It has been shown to have high cytotoxicity to dendritic cells and OPC (not shown in data). We also found that drug treatment significantly increased ABCD2 mRNA concentrations in WT- and CCALD-fibroblasts (FIG. 13). These results suggest that a decrease in VLCFA concentration in CCALD-fibroblasts by drugs is associated with increased ABCD2 gene expression. All considered, the iPSC-based cell model of the present invention not only measures the therapeutic efficacy of a drug, but also provides a useful basis for studying the mechanisms underlying drug efficacy.

In summary, the X-ALD-iPSC model of this study summarizes important phenomena of disease progression (eg, VLCFA builds up in oligodendrocytes), provides clues for better understanding of disease, and Early diagnosis and accurate diagnosis are possible. To the best of our knowledge, this is the first paper in iPSCs derived from X-ALD patients, which may provide a new therapeutic basis along with the basis for the X-ALD study.

discussion

X-ALD is a progressive disease that primarily affects oligodendrocytes in the brain, spinal cord axons and peripheral nerves, testicular lady cells, and adrenal cortex cells. Despite more than 100 years of research since its first case was reported in 1919 (32), a detailed understanding of the molecular mechanisms underlying the causative pathophysiology of the disease and the development of efficient treatment regimens have not yet been resolved. .

The presence of a wide variety of phenotypes, even from the same mutations in the ABCD1 gene, and the lack of reliable cell or animal models representing all subtypes of this disease have always delayed progress in X-ALD studies. The recent introduction of iPSC technology has opened new avenues for disease models as well as cell replacement therapy (33). In this study, we have successfully constructed two major X-ALD subtype iPSC cell lines from patients' fibroblasts and differentiated them in the most severe CCALD, late AMD and oligodendrocytes, the cell type mainly X -ALD affected the brain.

Interestingly, X-ALD-iPSCs contain as little VLCFA as hESCs and WT-iPSCs, despite mutations in the ABCD1 gene (FIG. 9). A plausible explanation for this phenomenon involves the rapid dilution of accumulating VLCFAs by massive cell proliferation, and the slow VLCFA biosynthesis is due to a limited amount of ELOVL1 protein and an increase in alternative transporters such as ABCD2 . The data of the present invention will relate at least in part to the low expression of the ELOVL1 gene in X-ALD-iPSC (FIG. 10). Cerebral demyelination resulting from the degeneration of oligodendrocytes is the most lethal phenotype of X-ALD, and we have identified two forms of X-ALD-iPSC (CCALD- and AMN-iPSC) by differentiating oligodendrocytes. It was evident that there was no difference in oligodendrocyte differentiation from WT- and X-ALD-iPSCs, meaning that the ABCD1 gene did not affect the differentiation stage. This concept is supported by the absence of developmental disorders in the brain of human X-ALD patients and ABCD1 knockout mice prior to the onset of the disease.

Surprisingly, the results showed that VLCFA concentrations increased significantly after differentiation of X-ALD-iPSCs in oligodendrocytes (FIGS. 9 and 11). Furthermore we have shown that at least to some extent the VLCFA concentration is due to an increase in the expression of the ELOVL1 gene (FIG. 10). This novel invention is in line with previous findings of high microsomal VLCFA kidney activity during myelin development around 20 days after birth of mice (34, 35). More impressively, the results of the present invention showed that the VLCFA concentration was higher in CCALD-oligodendrocytes than in AMN-oligodendrocytes (FIG. 11), which illustrates the observations made in post-mortem brain; Asheuer et al., VLCFA concentrations in CCALD brain whites were three times higher than those in (normal) control brains, but only 1.9 times higher in AMN whites (16).

It is clear that the i-PSC-derived cell model system of the present invention offers the only opportunity to provide valuable information specific to a particular X-ALD subtype, which was not possible in previous model systems. Although X-ALD Preimplantation Genetic Diagnosis (PDG) -ESC has been established (36), no characterization has been performed and subtype-specific cell models in the absence of genotypic-phenotype correlation of the disease. Did not get. In addition, the ABCD1 knockout mouse model only reflects the therapeutic and pathological abnormalities for mild of human X-ALD, AMN, but not CCALD (18). Moreover, lack of access to human oligodendrocytes and neurons in X-ALD patients makes it an unusable option for primary culture cell lines as a cell model of X-ALD. Thus, the X-ALD cell model system of the present invention provides a systematic description of subtype-specific mechanisms in the causative pathophysiology of X-ALD and in the development of new effective therapies.

The efficacy of a definite therapeutic regimen for X-ALD patients is strictly dependent on the specific disease phenotype, which means that early and accurate diagnosis of the disease subtype of the patient is of great importance. Since VLCFA concentrations in plasma or fibroblasts (eg, C26: 0 / C22: 0) do not show a good correlation with disease subtypes, the iPSC-derived patient specific oligodendrocytes of the present invention are not treated effectively. May be an essential choice for predicting the patient's X-ALD subtype.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

references

(1) Mosser J, Douar AM, Sarde CO et al. Putative X-linked adrenoleukodystrophy gene shares unexpected homology with ABC transporters. Nature . , 361: 726-730 (1993)

(2) Singh I, Moser AE, Goldfischer S, Moser HW. Lignoceric acid is oxidized in the peroxisome: implications for the Zellweger cerro-hepato-renal syndrome and adrenoleukodystrophy. Proc Natl Acad Sci US A. 81: 4203-4207 (1984)

(3) Igarashi M, Schaumburg HH, Powers J et al. Fatty acid abnormality in adrenoleukodystrophy. J Neurochem . 26: 851-860 (1976)

(4) Powers JM, Moser HW, Moser AB, Schaumburg HH. Fetal adrenoleukodystrophy: the significance of pathologic lesions in adrenal gland and testis. Hum Pathol . 13: 1013-1019 (1982)

(5) Moser HW, Mahmood A, Raymond GV. X-linked adrenoleukodystrophy. Nat Clin Pract Neurol . 3: 140-151 (2007)

(6) Kemp S, Pujol A, Waterham HR et al. ABCD1 mutations and the X-linked adrenoleukodystrophy mutation database: role in diagnosis and clinical correlations. Hum Mutat . 18: 499-515 (2001)

(7) Wilichowski E, Ohlenbusch A, Korenke GC et al. Identical mitochondrial DNA in monozygotic twins with discordant adrenoleukodystrophy phenotype. Ann Neurol . 43: 835-836 (1998)

(8) Peters C, Charnas LR, Tan Y et al. Cerebral X-linked adrenoleukodystrophy: the international hematopoietic cell transplantation experience from 1982 to 1999. Blood . 104: 881-888 (2004)

(9) Cartier N, Hacein-Bey-Abina S, Bartholomae CC et al. Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy. Science . 326: 818-823 (2009)

(10) Kemp S, Wei HM, Lu JF et al. Gene redundancy and pharmacological gene therapy: implications for X-linked adrenoleukodystrophy. Nat Med . 4: 1261-1268 (1998)

(11) Pai GS, Khan M, Barbosa E et al. Lovastatin therapy for X-linked adrenoleukodystrophy: clinical and biochemical observations on 12 patients. Mol Genet Metab . 69: 312-322 (2000)

(12) Naidu S, Bresnan MJ, Griffin D et al. Childhood adrenoleukodystrophy. Failure of intensive immunosuppression to arrest neurologic progression. Arch Neurol . 45: 846-848 (1988)

(13) Boles DJ, Craft DA, Padgett DA et al. Clinical variation in X-linked adrenoleukodystrophy: fatty acid and lipid metabolism in cultured fibroblasts. Biochem Med Metab Biol . 45: 74-91 (1991)

(14) Moser AB, Kreiter N, Bezman L et al. Plasma very long chain fatty acids in 3,000 peroxisome disease patients and 29,000 controls. Ann Neurol . 45: 100-110 (1999)

(15) Paintlia AS, Gilg AG, Khan M et al. Correlation of very long chain fatty acid accumulation and inflammatory disease progression in childhood X-ALD: implications for potential therapies. Neurobiol Dis . 14: 425-439 (2003)

(16) Asheuer M, Bieche I, Laurendeau I et al. Decreased expression of ABCD4 and BG1 genes early in the pathogenesis of X-linked adrenoleukodystrophy. Hum Mol Genet . 14: 1293-1303 (2005)

(17) Singh I, Khan M, Key L, Pai S. Lovastatin for X-linked adrenoleukodystrophy. N Engl J Med . 339: 702-703 (1998)

(18) Lu JF, Lawler AM, Watkins PA et al. A mouse model for X-linked adrenoleukodystrophy. Proc Natl Acad Sci USA . 94: 9366-9371 (1997)

(19) Kang SM, Cho MS, Seo H et al. Efficient induction of oligodendrocytes from human embryonic stem cells. Stem Cells . 25: 419-424 (2007)

(20) Kim DS, Lee JS, Leem JW et al. Robust Enhancement of Neural Differentiation from Human ES and iPS Cells Regardless of their Innate Difference in Differentiation Propensity. Stem Cell Rev. 2010

(21) Brustle O, McKay RD. The neuroepithelial stem cell concept: implications for neuro-oncology. J Neurooncol . 24: 57-59 (1995)

(22) Zhang SC, Wernig M, Duncan ID et al. In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat Biotechnol . 19: 1129-1133 (2001)

(23) Cho MS, Hwang DY, Kim DW. Efficient derivation of functional dopaminergic neurons from human embryonic stem cells on a large scale. Nat Protoc . 3: 1888-1894 (2008)

(24) Cho MS, Lee YE, Kim JY et al. Highly efficient and large-scale generation of functional dopamine neurons from human embryonic stem cells. Proc Natl Acad Sci USA . 105: 3392-3397 (2008)

(25) Kim DS, Lee JS, Leem JW et al. Erratum to: Robust Enhancement of Neural Differentiation from Human ES and iPS Cells Regardless of their Innate Difference in Differentiation Propensity. Stem Cell Rev. 2010

(26) Paik MJ, Kim KR, Yoon HR, Kim HJ. Diagnostic patterns of very-long-chain fatty acids in plasma of patients with X-linked adrenoleukodystrophy. J Chromatogr B Biomed Sci Appl . 760: 149-157 (2001)

(27) Park IH, Arora N, Huo H et al. Disease-specific induced pluripotent stem cells. Cell . 134: 877-886 (2008)

(28) Park IH, Zhao R, West JA et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature . 451: 141-146 (2008)

(29) Park IH, Lerou PH, Zhao R et al. Generation of human-induced pluripotent stem cells. Nat Protoc . 3: 1180-1186 (2008)

(30) Moser HW, Moser AB, Kawamura N et al. Adrenoleukodystrophy: elevated C26 fatty acid in cultured skin fibroblasts. Ann Neurol . 7: 542-549 (1980)

(31) Singh I, Pahan K, Khan M. Lovastatin and sodium phenylacetate normalize the levels of very long chain fatty acids in skin fibroblasts of X- adrenoleukodystrophy. FS Lett . 426: 342-346 (1998)

(32) Haberfeld W, Spieler F. Zur diffusen Hirn-Rim Kindesalter. Dtch . Z. Nervenh. 40: 436-463 (1910)

(33) Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell . 126: 663-676 (2006)

(34) Bourre JM, Piciotti M. Alterations in eighteen-carbon saturated, monounsaturated and polyunsaturated fatty acid peroxisomal oxidation in mouse brain during development and aging. Biochem Mol Biol Int . 41: 461-468 (1997)

(35) Tvrdik P, Westerberg R, Silve S et al. Role of a new mammalian gene family in the biosynthesis of very long chain fatty acids and sphingolipids. J Cell Biol . 149: 707-718 (2000)

(36) Verlinsky Y, Strelchenko N, Kukharenko V et al. Human embryonic stem cell lines with genetic disorders. Reprod Biomed Online. 10: 105-110 (2005)

Claims (14)

A method for preparing autologous oligodendrocytes for diagnosing X-linked adrenoleukodystrophy (X-ALD) comprising the following steps:
(a) introducing into the vector one or more genes selected from the group consisting of OCT4, SOX2, KLF4 and c-MYC as transgenes;
(b) transforming the transgene-inserted vector into human somatic cells derived from a patient to be diagnosed;
(c) culturing the human somatic cells after transformation to produce dedifferentiation-induced pluripotent stem cells; And
(d) differentiating the prepared pluripotent stem cells into oligodendrocytes.
The method of claim 1, wherein the vector is a retrovirus.
The method of claim 1, wherein the X-linked adrenoleukodystrophy (X-ALD) is Childhood Cerebral form ALD (CCALD) or Adrenomyeloneuropathy (AMN). Characterized in that the method.
delete The method of claim 1 wherein step (d) comprises the following substeps:
(d-1) culturing the prepared differentiated induced pluripotent stem cells to obtain an embryonic body cell mass (EB) and differentiating it into a neural rosette structure;
(d-2) differentiating the neural rosette structure into spherical neural masses (SNMs);
(d-3) differentiating the neural precursor into oligodendrocyte precursor cells (OPCs); And
(d-4) differentiating the oligodendrocyte precursors into oligodendrocytes.
delete Screening methods for X-linked adrenoleukodystrophy (X-ALD) therapeutic candidates comprising the following steps:
(a) treating a therapeutic candidate with oligodendrocytes differentiated from dedifferentiation-induced pluripotent stem cells prepared by dedifferentiation from cells of X-ALD patients; And
(b) analyzing a decrease in the amount of long long-chain fatty acid (VLCFA), upregulation of the expression of ABCD2 gene or downregulation of the expression of ELOVL1 gene in the oligodendrocytes .
8. The method of claim 7, wherein the X-linked adrenoleukodystrophy (X-ALD) is Childhood Cerebral form ALD (CCALD) or Adrenomyeloneuropathy (AMN). Characterized in that the method.
delete delete X-linked adrenoleukodystrophy (X-ALD) diagnostic composition comprising an autologous oligodendrocyte prepared by the method of claim 1 as an active ingredient. delete delete delete

Images