KR101314488B1 - Novel oxadiazole derivatives for differentiation of neural stem cells and medical use thereof - Google Patents

Abstract

The present invention relates to a novel oxadiazole derivative for neural stem cell differentiation regulating agent and its medical use, and can be used to differentiate neural stem cells into neural cells, particularly astrocytic cells, using the oxadiazole derivative, so that the composition comprising the derivative is a stroke. It can be usefully used for the treatment or prevention of neuronal cell damage diseases including Alzheimer's disease, Parkinson's disease or spinal cord injury disease.

Description

Novel oxadiazole derivatives for differentiation of neural stem cells and medical use

The present invention relates to a novel oxadiazole derivative for neural stem cell differentiation regulator and its medical use.

Stroke, Alzheimer's disease, Parkinson's disease, demyelinating disease, spinal cord injury, etc. are disorders of nerve function caused by nerve cell damage. It is difficult to treat because it is not regenerated and drug or surgical operation is performed as symptomatic therapy. However, such treatment is pointed out as a problem by damaging temporary or normal cells.

Recently, a cell therapeutic agent that supplies cells destroyed or damaged by diseases from the outside has been suggested to be effective. Neural stem cells (NSCs) are in the spotlight as such cell therapeutics.

Neural stem cells are a subtype of progenitor cells in the nervous system and have the ability to differentiate into astrocytes, oligodendrocytes, and neurons. It can be isolated from the central nervous system (CNS) and the peripheral nervous system (PNS) to make multicellular neurospheres, which will differentiate into glia and nervous systems under different conditions (Sally Temple et. al . 2001).

Unlike other tissues, the cranial nervous system has almost no immune rejection reaction, so when transplanted neural stem cells, long-term survival of the transplanted cells can be expected, and as a cell therapy for various neurological diseases caused by nerve cell damage Much research is being done.

However, in order to increase the usefulness of neural stem cells as cell therapeutics, a technique for efficiently dividing neural stem cells into specific cells is required.

Accordingly, the present inventors completed the present invention by discovering that the novel oxadiazole derivatives are neural stem cell differentiation regulators that differentiate neural stem cells into specific cells, that is, astrocytes.

An object of the present invention is to provide a novel oxadiazole derivative having a neuronal stem cell differentiation control activity and a method for producing the same.

In addition, another object of the present invention is to provide a composition for inducing differentiation of neural stem cells into neurons comprising the oxadiazole derivative.

In addition, another object of the present invention to provide a method for differentiating neural stem cells into neurons, comprising culturing the composition with neural stem cells.

In addition, another object of the present invention to provide a pharmaceutical composition for treating or preventing neuronal cell damage diseases comprising the oxadiazole derivatives.

In order to achieve the above object, the present invention provides a 1,3,4-oxadiazole derivative represented by the following formula (1) or a salt thereof:

[Formula 1]

In Formula 1, R ₁ is hydrogen, hydroxy group, halogen, C1 to C6 alkyl or C1 to C6 alkoxy, R ₂ is benzyl, phenyl, which is optionally substituted with halogen or C1 to C4 alkyl, It is either naphthyl or anthryl, and X can be either SO ₂ or CO.

The present invention also provides a composition for inducing differentiation of neural stem cells into neurons, including the 1,3,4-oxadiazole derivative represented by Formula 1 or a salt thereof.

The present invention also provides a method for differentiating neural stem cells into neurons, comprising culturing the composition with neural stem cells.

The present invention also provides a pharmaceutical composition for treating or preventing neuronal cell damage diseases, including the 1,3,4-oxadiazole derivative represented by Formula 1 or a salt thereof.

Since the 1,3,4-oxadiazole derivatives according to the present invention can be used to differentiate neural stem cells into neurons, particularly astrocytes, the composition comprising the derivatives may be used to prevent stroke, Alzheimer's disease, Parkinson's disease or spinal cord injury. It can be usefully used for the treatment or prevention of neuronal cell damage diseases.

1 shows the induction of neural stem cells into astrocytes by 1,3,4-oxadiazole derivatives according to the present invention, (A) is an analysis of GFAP positive cells, which are astrocytic markers, (B ) Shows immunofluorescence images of GFAP.
Figure 2 shows the increase in GFAP mRNA expression in neural stem cells by 1,3,4-oxadiazole derivatives according to the present invention, (A) and (B) is a semi-quantitative amount using GFAP and βIII tubulin, respectively Results of RT-PCR analysis, (C) shows the results of real-time PCR analysis for GFAP and βIII tubulin gene expression.

 The terms, techniques, and the like described in the present invention are used in the meaning commonly used in the technical field to which the present invention belongs, unless otherwise specified. In addition, all documents referred to in this specification are included in the present specification as a document for explaining the present invention.

Hereinafter, the present invention will be described in more detail.

The present invention provides a 1,3,4-oxadiazole derivative represented by the following formula (1) or a salt thereof:

[Formula 1]

In Formula 1, R ₁ is any _one of hydrogen, a hydroxy group, halogen, C 1 to C 6 alkyl or C 1 to C 6 alkoxy, preferably hydrogen or halogen; R ₂ is benzyl, phenyl, naphthyl or anthryl, optionally substituted with halogen or C1 to C4 alkyl, preferably benzyl or phenyl; X may be either SO ₂ or CO.

Preferred compounds of formula (1) according to the present invention include 2-phenyl- N- (phenyl (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) acetamide (7), N -(( 4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) -2-phenylacetamide (8), N -((4-fluorophenyl) (5- Phenyl-1,3,4-oxadiazol-2-yl) methyl) benzamide (9), N -((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazole-2 -Yl) methyl) benzenesulfonamide (10), N -((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) -1-phenylmethanesulfonamide (11) etc. are mentioned.

The 1,3,4-oxadiazole derivatives of formula (1) according to the invention are phenyl (5-phenyl-1,3,4-oxadiazol-2-yl) methanamine (5) or (4-fluorophenyl )-(5-phenyl-1,3,4-oxadiazol-2-yl) methanamine (6) and a suitable sulfonyl chloride or carboxylic acid.

In this case, methaneamine having 1,3,4-oxadiazole-core may be prepared according to a synthetic route represented by Scheme 1 below. That is, the amine group for the final amine coupling protects the Boc group formed by Boc ₂ O and NaHCO ₃ in a water-dioxane solvent. Then, 2,5-disubstituted from Boc-protected amino acids (1,2) and benzohydrazide using carbonyl diimidazole (CDI) for activation of the carboxylic acid and CBr ₄ and PPh ₃ for dehydration 1,3,4-oxadiazole (3,4) is synthesized in one-pot. The N-Boc group is then deprotected by trifluoroacetic acid (TFA) to give phenyl (5-phenyl-1,3,4-oxadiazol-2-yl) methanamine (5) or (4- Fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methanamine (6) is synthesized.

[Reaction Scheme 1]

In addition, the synthesis of sulfonamide and amide having 1,3,4-oxadiazole-core prepared above may be prepared according to the synthetic route shown in Scheme 2 below. That is, the appropriate sulfonyl chloride (10, 11) is prepared by coupling the appropriate sulfonyl chloride to intermediate compound 5 or 6 using Et ₃ N, and 1-ethyl-3- (3-dimethyl of the appropriate carboxylic acid. Aminopropyl) carbodiimide hydrochloride (EDCI) coupling can be used to prepare the related amides (7-9).

[Reaction Scheme 2]

The 1,3,4-oxadiazole derivatives according to the invention can be prepared with the corresponding salts by known methods. Such salts are preferably water-soluble and non-toxic. Preferred salts include salts of alkali metals such as potassium, sodium and the like; Salts of alkaline earth metals such as calcium, magnesium, and the like; And amines such as tetramethylammonium, triethylamine, methylamine, dimethylamine, cyclopentylamine, benzylamine, phenethylamine, piperidine, monoethanolamine, diethanolamine, tris (hydroxymethyl) amine, lysine, arginine, And salts of pharmaceutically acceptable amines such as N-methyl-D-glucamine and the like.

The 1,3,4-oxadiazole derivatives used in the present invention can be prepared with the corresponding acid addition salts by known methods. Such acid addition salts are preferably water soluble with no toxicity. Preferred acid addition salts include inorganic acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate, phosphate and nitrate, or acetates, lactates, tartarates, oxalates, fumarates, maleates, citrates, benzoates, methane Organic acid salts such as sulfonate, ethanesulfonate, benzenesulfonate, toluenesulfonate, isethionate, glucuronate and gluconate.

The 1,3,4-oxadiazole derivatives or salts thereof used in the present invention can be prepared as a hydrate by a known method.

As shown in Figure 1, the experimental group treated with 1,3,4-oxadiazole derivatives or salts thereof according to the present invention significantly induced differentiation of neural stem cells into astrocytes compared to the control group without any compound treatment. In particular, it is possible to exhibit more excellent differentiation activity in a compound having an amide group than a compound having a sulfonamide group. Thus, the 1,3,4-oxadiazole derivatives or salts thereof according to the present invention promote the differentiation of neural stem cells into neurons, in particular astrocytes, thereby balancing the nerve cells to treat or prevent neuronal damage disorders. It can be usefully used.

In addition, the present invention provides a composition for inducing differentiation of neural stem cells into neurons, comprising a 1,3,4-oxadiazole derivative represented by Formula 1 or a salt thereof as an active ingredient:

[Formula 1]

In Formula 1,

R ₁ is hydrogen, a hydroxy group, halogen, C 1 to C 6 alkyl or C 1 to C 6 alkoxy, R ₂ is benzyl, phenyl, naphthyl or anthryl unsubstituted or substituted with halogen or C 1 to C 4 alkyl It may be any one of, X may be either SO ₂ or CO.

In particular, the composition according to the present invention preferably comprises the 1,3,4-oxadiazole derivative or salt thereof in an amount of 1 to 10 μM.

Neural stem cells that can be differentiated by the present invention will differentiate into neurons through the steps of neural progenitor cells that produce specific nervous system cells. Therefore, the cell is not particularly limited as long as it is in an undifferentiated state and has a function of infinite proliferation and differentiation into neurons. For example, it may be selected from embryonic neural stem cells, adult neural stem cells, embryonic neural stem cells and embryonic tumor stem cells.

Neurons differentiated from the neural stem cells may be neurons, astrocytes, oligodendrocytes or microglia cells.

The present invention also provides a method for differentiating neural stem cells into neurons, comprising culturing the composition with neural stem cells.

The culture may be performed in a cell culture medium such as DMEM (Dulbecco's modified Eagle's medium, Hyclone) / F12 medium, the culture medium is B27, fibroblast-derived growth factor (FGF), epidermal growth factor Growth factors such as (epidermal growth factor, EGF) and the like may be further added. The incubation period is preferably 3 to 10 days.

In another aspect, the present invention provides a pharmaceutical composition for treating or preventing neuronal cell damage diseases comprising a 1,3,4-oxadiazole derivative represented by the following formula (1) or a salt thereof as an active ingredient:

[Formula 1]

In Formula 1,

R ₁ is hydrogen, a hydroxy group, halogen, C 1 to C 6 alkyl or C 1 to C 6 alkoxy, R ₂ is benzyl, phenyl, naphthyl or anthryl unsubstituted or substituted with halogen or C 1 to C 4 alkyl It may be any one of, X may be either SO ₂ or CO.

The neuronal cell diseases include Parkinson's disease, Alzheimer's disease, Pick's disease, Huntington's disease, amyotriophic lateral sclerosis, ischemic brain disease, stroke, demyelinating disease And spinal cord injury.

More specifically, when the neuron is administered in a therapeutically effective amount to a damaged area of a subject in need of treatment of a neuronal cell disease, the neural progenitor cells or nerve stem cells of the peripheral central nervous system or peripheral nervous system are differentiated into neurons. It can restore impaired nerve function and cure nerve damage disease. In this case, the subject may be a mammal including a human.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive in addition to the active ingredient.

The pharmaceutical composition of the present invention may be formulated in a unit dosage form suitable for administration in the body of a patient according to conventional methods in the pharmaceutical art. Formulations suitable for this purpose are preferably parenteral administration preparations such as injection or oral administration. At this time, a commonly used diluent such as a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, or an excipient may be used together.

The single dose of neurons may be administered at 1 × 10 ⁵ cells / kg (body weight), preferably once or in several doses. However, the actual dosage of the active ingredient may be determined in consideration of several relevant factors such as the amount of neurons to be differentiated and multiplied, the route of administration, the patient's weight, age and gender, and therefore the dosage may be determined in any form. It does not limit the scope of the invention.

Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Production Example 1 2- ( Rat -Butoxycarbonylamino) -2-phenylacetic acid (1) synthesis

Compound 1 was synthesized according to methods known in the literature (J. Labeled Comp. Radiopharm. 2004, 47, 599-608).

Production Example 2 2- ( Rat -Butoxycarbonylamino) -2- (4-fluorophenyl) acetic acid (2) Synthesis

2-amino-2- (4-fluorophenyl) acetic acid (1 g, 5.73 mmol) was dissolved in a solution of water and dioxane (1: 1, 140 mL) and then sodium bicarbonate (8.2 g, 97.4 mmol) was slowly Then, di- tert -butyldicarbonate (2.7 g, 12.0 mmol) was added. The reaction mixture was stirred overnight, diluted with water and extracted with ethyl ether (X3). The resulting aqueous layer was adjusted to pH 3.4 using citric acid solution (20 mL) dissolved in EtOAc, and the organic layer was separated. The organic layer was washed with water (X2), dried over anhydrous MgSO ₄ , filtered under reduced pressure and concentrated. The crude product thus obtained was used in the next step without further purification.

≪ Preparation Example 3 & Rat -Butylphenyl (5-phenyl-1,3,4-oxadiazol-2-yl) methylcarbamate (3) synthesis

Compound 3 was synthesized according to methods known in the literature (Tetrahedron Lett. 2006, 47, 4827-4830).

≪ Preparation Example 4 & Rat -Butyl (4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methylcarbamate (4) synthesis

CDI (670 mg, 4.31 mmol) was added to a solution of compound 2 (1.06 g, 3.94 mmol) dissolved in CH ₂ Cl ₂ (36 mL) at 0 ° C. After stirring for 40 minutes, benzoylhydrazide (547 mg, 3.94 mmol) was added. After the coupling reaction was performed at 0 ° C. for 50 minutes, CBr ₄ (2.64 g, 7.87 mmol) and PPh ₃ (2.08 mg, 7.87 mmol) were added. After maintaining the reaction mixture at 0 ° C. for 2 hours, the solvent was evaporated and the crude residue was purified by flash column chromatography on silica gel (EtOAc: n -hexane: CH ₂ Cl ₂ = 1: 4: 1). Compound 4 (793 mg, 55%) was prepared:

¹ H-NMR (CDCl ₃ , 300 MHz) δ 7.93 (dd, 2H, J = 7.6, 1.4 Hz), 7.43 (m, 3H), 7.33 (m, 2H), 7.00 (t, 2H, J = 8.6 Hz) , 5.69 (s, 1 H), 5.23 (s, 1 H);

HRMS (FAB) Calcd for C ₂₀ H ₂₁ FN ₃ O ₃ (M + H ⁺ ): 370.1567, Found: 370.1571.

Preparation Example 5 Synthesis of Phenyl (5-phenyl-1,3,4-oxadiazol-2-yl) methanamine (5)

TFA (0.93 mL, 12.1 mmol) was added to a solution of compound 3 (533 mg, 1.517 mmol) dissolved in dry CH ₂ Cl ₂ (7.0 mL) at room temperature under argon atmosphere. After monitoring reaction completion for 4 hours by TLC, the reaction mixture was quenched with water (7.0 mL), extracted with CH ₂ Cl ₂ , and washed with saturated NaHCO ₃ aqueous solution and brine. The organic layer was dried over MgSO ₄ , filtered and concentrated. The crude residue was purified by flash column chromatography on silica gel (EtOAc: n -hexane = 1: 1) to give compound 5 (348 mg, 91%):

¹ H-NMR (CDCl ₃ , 300 MHz) δ 7.93 (dd, 2H, J = 7.7, 1.4 Hz), 7.33 (m, 9H), 5.41 (s, 1H).

Preparation Example 6 Synthesis of (4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methanamine (6)

To a solution of compound 4 (790 mg, 2.14 mmol) dissolved in dry CH ₂ Cl ₂ (12 mL) at room temperature under argon atmosphere, TFA (1.32 mL, 17.1 mmol) was added. After monitoring reaction completion for 12 hours by TLC, the reaction mixture was quenched with water, extracted with CH ₂ Cl ₂ and washed with saturated NaHCO ₃ aqueous solution and brine. The organic layer was dried over MgSO ₄ , filtered and concentrated. The crude product thus obtained was used in the next step without further purification.

Example 1 2-phenyl- N Synthesis of-(phenyl (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) acetamide (7)

To a solution of compound 5 (1.0 equiv) dissolved in dry CH ₂ Cl ₂ (0.1 M) and phenylacetic acid (1.2 equiv) at room temperature, 4-dimethylaminopyridine (DMAP) (1.5 equiv) and EDCI (1.2 equiv) were added. . The reaction mixture was stirred at room temperature until the completion of the reaction was confirmed by monitoring via TLC (2 hours to overnight), followed by quenching with aqueous 2N HCl solution and extraction with EtOAc. The resulting organic layer was washed with saturated aqueous NaHCO ₃ and brine, dried over anhydrous MgSO ₄ , filtered and concentrated under reduced pressure. The crude residue was purified by flash column chromatography on silica gel (EtOAc: n -hexane = 1: 4) to give compound 7 (18 mg, 56%):

¹ H-NMR (CDCl ₃ , 500 MHz) δ 7.93 (d, 2H, J = 7.2 Hz), 7.46 (m, 3H), 7.31 (m, 10H), 6.63 (d, 1H, J = 7.8 Hz), 6.46 (d, 1H, J = 8.0 Hz), 3.66 (s, 2H);

¹³ C-NMR (CDCl ₃ , 125 MHz) δ 170.6, 165.8, 165.5, 136.8, 134.5, 132.3, 129.8, 129.8, 129.5, 129.5, 129.4, 129.4, 129.4, 129.4, 129.3, 127.9, 127.6, 127.6, 127.3, 127.3 , 123.8, 50.5, 43.8;

HRMS (FAB) Calcd for C ₂₃ H ₂₀ N ₃ O ₂ (M + H ⁺ ): 370.1556, Found: 370.1545.

<Example 2> N Synthesis of-((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) -2-phenylacetamide (8)

DMAP (1.5 equiv) and EDCI (1.2 equiv) were added to a solution of Compound 6 (1.0 equiv) dissolved in dry CH ₂ Cl ₂ (0.1 M) and phenylacetic acid (1.2 equiv) at room temperature. The reaction mixture was stirred at room temperature until the completion of the reaction was confirmed by monitoring via TLC (2 hours to overnight), followed by quenching with aqueous 2N HCl solution and extraction with EtOAc. The resulting organic layer was washed with saturated aqueous NaHCO ₃ and brine, dried over anhydrous MgSO ₄ , filtered and concentrated under reduced pressure. The crude residue was purified by flash column chromatography on silica gel (EtOAc: n -hexane = 1: 3 to 1: 2) to give compound 8 (43 mg, 100%):

¹ H-NMR (CDCl ₃ , 300 MHz) δ 7.93 (dd, 2H, J = 8.0, 1.4 Hz), 7.45 (m, 3H), 7.28 (m, 7H), 7.01 (t, 2H, J = 8.5 Hz) , 6.65 (d, 1H, J = 7.5 Hz), 6.43 (d, 1H, J = 7.5 Hz), 3.65 (s, 2H);

HRMS (FAB) Calcd for C ₂₃ H ₁₉ O ₃ S (M + H ⁺ ): 388.1461, Found: 388.1457.

<Example 3> N Synthesis of-((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) benzamide (9)

DMAP (1.5 equiv) and EDCI (1.2 equiv) were added to a solution of Compound 6 (1.0 equiv) dissolved in dry CH ₂ Cl ₂ (0.1 M) and benzoic acid (1.2 equiv) at room temperature. The reaction mixture was stirred at room temperature until the completion of the reaction was confirmed by monitoring via TLC (2 hours to overnight), followed by quenching with aqueous 2N HCl solution and extraction with EtOAc. The resulting organic layer was washed with saturated aqueous NaHCO ₃ and brine, dried over anhydrous MgSO ₄ , filtered and concentrated under reduced pressure. The crude residue was purified by flash column chromatography on silica gel (EtOAc: n -hexane = 1: 3) to give compound 9 (40 mg, 98%):

¹ H-NMR (CDCl ₃ , 300 MHz) δ 7.94 (dd, 2H, J = 8.3,1.4 Hz), 7.80 (dd, 2H, J = 8.6,1.4 Hz), 7.43 (m, 9H), 7.02 (t, 2H, J = 8.6 Hz), 6.60 (d, 1 H, J = 7.5 Hz);

HRMS (FAB) Calcd for C ₂₂ H ₁₇ O ₃ S (M + H ⁺ ): 374.1305, Found: 374.1299.

<Example 4> N Synthesis of-((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) benzenesulfonamide (10)

Phenylsulfonyl chloride dissolved in dry CH ₂ Cl ₂ (0.1 M) at 0 ° C. in a solution of compound 6 (1.0 equiv) dissolved in dry CH ₂ Cl ₂ (0.05 M) and triethylamine (1.7 equiv) at room temperature ( 1.0 equiv) was added. The reaction mixture was stirred at 0 ° C. until completion of reaction by monitoring via TLC, then quenched with aqueous 2N-HCl solution and extracted with EtOAc. The resulting organic layer was washed with saturated aqueous NaHCO ₃ and brine, dried over anhydrous MgSO ₄ , filtered and concentrated under reduced pressure. The crude residue was purified by flash column chromatography on silica gel (EtOAc: n -hexane = 1: 3) to give light yellow Compound 10 (13 mg, 29%):

¹ H-NMR (CDCl ₃ , 300 MHz) δ 7.80 (dd, 2H, J = 8.4,1.6 Hz), 7.68 (dd, 2H, J = 8.4,1.6 Hz), 7.44 (m, 3H), 7.28 (m, 5H), 6.92 (t, 2H, J = 8.6 Hz), 5.84 (s, 1H);

HRMS (FAB) Calcd for C ₂₁ H ₁₇ O ₃ S (M + H ⁺ ): 410.0975, Found: 410.0977.

<Example 5> N Synthesis of-((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) -1-phenylmethanesulfonamide (11)

Phenylmethanesulfonyl chloride dissolved in dry CH ₂ Cl ₂ (0.1 M) at 0 ° C. in a solution of compound 6 (1.0 equiv) dissolved in dry CH ₂ Cl ₂ (0.05 M) and triethylamine (1.7 equiv) at room temperature (1.0 equiv) was added. The reaction mixture was stirred at 0 ° C. until completion of reaction by monitoring via TLC, then quenched with aqueous 2N-HCl solution and extracted with EtOAc. The resulting organic layer was washed with saturated aqueous NaHCO ₃ and brine, dried over anhydrous MgSO ₄ , filtered and concentrated under reduced pressure. The crude residue was purified by flash column chromatography on silica gel (EtOAc: n -hexane = 1: 3) to give light yellow Compound 11 (12 mg, 33%):

¹ H-NMR (CDCl ₃ , 300 MHz) δ 7.89 (dd, 2H, J = 8.4, 1.6 Hz), 7.45 (m, 3H), 7.30 (m, 5H), 7.17 (m, 5H), 5.73 (s, 1H), 4.21 (q, 2H, J = 28.0, 13.7 Hz);

HRMS (FAB) Calcd for C ₂₂ H ₁₉ O ₃ S (M + H ⁺ ): 424.1131, Found: 424.1135.

Experimental Example 1 NSC Cell Culture

NSCs were cultured from the cortex of Sprague-Dawley rats embryos of E14. NSC (200,000 / ml) was DMEM / F12 medium (Gibco, Carlsbad, CA) supplemented with 2% B27 (Invitrogen), 20 ng / ml EGF (Chemicon, CA), and 20 ng / ml FGF-2 (Chemicon, CA) CA) to grow neurosphere for 7 days. At this time, the medium was replaced once every two days. For differentiation, neurospheres were dispersed in single cell suspensions with accutase for 10 minutes at 37 ° C. and aliquoted onto 0.01% poly-L-lysine and 10 μg / ml laminin (Sigma-Aldrich, MO). At this time, no growth factors were included at the time of dosing but it was reinforced with 2% B27. Cells treated with SMXs or DMSO were incubated in a 5% CO ₂ incubator, followed by determination of cell differentiation for 4 days.

Experimental Example 2 Immunocytochemical Analysis

For immunocytochemical analysis, the cell cultures were fixed in 4% paraformaldehyde for 30 minutes and washed with phosphate buffered saline (PBS). Fixed cells were broached with 0.2% Triton X-100 dissolved in 5% normal goat serum and PBS, β-tubulin III (TuJ1) (monoclonal; 1: 1,000; Sigma-Aldrich, Mo), glial Cultured with first antibody against glial fibrillary acidic protein (GFAP) (polyclonal; 1: 1,000; Dako, Carpinteria, CA). After washing with PBS, the cells were incubated with the second antibody conjugated to Cy3 (1: 1000, Molecular Probes, Calif.) For 30 minutes. After completion of the second antibody incubation by nuclear staining, 4,6-diimidino-2-phenylindole (DAPI) (1: 10,000 in PBS) was added for 5 minutes. Images were acquired using a reversed-phase fluorescence microscope (DMIL; Leica, Wetzlar).

As a result, the 1,3,4-oxadiazole derivatives synthesized in the Example as shown in Figure 1 was found to significantly promote differentiation from neural stem cells to astrocytes compared to the control group not treated with these compounds. It became. In particular, it was found that Compounds 7 to 9 having amide groups exhibited more excellent differentiation activity into astrocytic cells than Compound 10 having sulfonamide groups.

Experimental Example 3 Real-Time and Semi-quantitative PCR Analysis

Total RNA was extracted using TRIzol reagent (Invitrogen, MD). First strand cDNA was synthesized from 2 μg of total RNA in 20 μl reaction using oligo (dT) primers and RevertAid reverse transcriptase (Fermentas). Real-time PCR experiments for β-tubulin III and GFAP were performed with a specific primer set designed for each gene using the SYBR Green master mix (Bio-Rad). At this time, the following primer sets were used:

β-tubulin III, agccctctacgacatctgct (forward, SEQ ID NO: 1) and attgagctgaccagggaatc (reverse, SEQ ID NO: 2);

GFAP , agcggctctgagagagattc (forward, SEQ ID NO: 3) and agcaacgtctgtgaggtctg (reverse, SEQ ID NO: 4);

GAPDH , agttcaacggcacagtcaag (forward, SEQ ID NO: 5) and gtggtgaagacgccagtaga (reverse, SEQ ID NO: 6).

The housekeeping gene, GAPDH, was used as an internal control. Relative change in relative mRNA expression was measured using the 2 ^-ΔΔCT method ( Methods 2001, 25 , 402).

For semiquantitative PCR, DNA was initially incubated at 94 ° C. for 5 minutes, followed by 0.5 cycles at 94 ° C., 0.5 minutes at 55 ° C.-58 ° C., 26 cycles of 0.5 minutes at 72 ° C., and 10 at 72 ° C. Amplification by extension for minutes. The PCR product thus obtained was separated by electrophoresis on 1.5% agarose gel and visualized by ethidium bromide staining.

As a result, all of the 1,3,4-oxadiazole derivatives synthesized in Example as shown in FIG. 2 induced GFAP mRNA expression, an astrocytic marker, without affecting β-tubulin III expression. Real-time PCR confirmed the induction of significant differentiation of GFAP by compound 7.

Therefore, it can be seen from these results that the 1,3,4-oxadiazole derivatives according to the present invention promote astrocytic differentiation in neural stem cells.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Attach an electronic file to a sequence list

Claims (9)

1,3,4-oxadiazole derivatives represented by the following formula (1) or salts thereof:
[Formula 1]

In Chemical Formula 1,
R ₁ is hydrogen, a hydroxy group, halogen, C 1 to C 6 alkyl or C 1 to C 6 alkoxy, R ₂ is benzyl, phenyl, naphthyl or anthryl unsubstituted or substituted with halogen or C 1 to C 4 alkyl Any one of which X is either SO ₂ or CO. The method of claim 1, wherein the 1,3,4-oxadiazole derivative is 2-phenyl- N- (phenyl (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) acetamide, N -((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) -2-phenylacetamide, N -((4-fluorophenyl) (5- Phenyl-1,3,4-oxadiazol-2-yl) methyl) benzamide, N -((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) Methyl) benzenesulfonamide and N -((4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl) methyl) -1-phenylmethanesulfonamide , 3,4-oxadiazole derivatives or salts thereof. A composition for inducing differentiation of neural stem cells into neurons, comprising a 1,3,4-oxadiazole derivative represented by Formula 1 or a salt thereof as an active ingredient:
[Formula 1]

In Chemical Formula 1,
R ₁ is hydrogen, a hydroxy group, halogen, C 1 to C 6 alkyl or C 1 to C 6 alkoxy, R ₂ is benzyl, phenyl, naphthyl or anthryl unsubstituted or substituted with halogen or C 1 to C 4 alkyl Any one of which X is either SO ₂ or CO. The composition for inducing differentiation of neural stem cells into neurons according to claim 3, comprising 1,3,4-oxadiazole derivative or salt thereof in an amount of 1 to 10 μM. The composition for inducing differentiation of neural stem cells into neurons according to claim 3, wherein the neural stem cells are selected from the group consisting of embryonic neural stem cells, adult neural stem cells, embryonic neural stem cells and embryonic tumor neural stem cells. The composition for inducing differentiation of neural stem cells into neurons according to claim 3, wherein the neurons are neurons, astrocytes, oligodendrocytes or microglia cells. . delete 1,3,4-oxadiazole derivative represented by the following formula (1) or a salt thereof, comprising as an active ingredient, a neurological damage disease treatment or preventive pharmaceutical composition:
[Formula 1]

In Chemical Formula 1,
R ₁ is hydrogen, a hydroxy group, halogen, C 1 to C 6 alkyl or C 1 to C 6 alkoxy, R ₂ is benzyl, phenyl, naphthyl or anthryl unsubstituted or substituted with halogen or C 1 to C 4 alkyl Any one of which X is either SO ₂ or CO. The method of claim 8, wherein the neuronal damage disease is Parkinson's disease, Alzheimer's disease, Pick's disease, Huntington's disease, amyotriophic lateral sclerosis, ischemic stroke, demyelination disease A pharmaceutical composition for treating or preventing neuronal damage diseases selected from the group consisting of demyelinating disease and spinal cord injury.

Images