KR101309902B1 - Metastatic Breast Cancer Cell Line TUBO-P2J - Google Patents

Abstract

The present invention relates to a metastatic breast cancer cell line TUBO-P2J, an anticancer screening method using the cell line, and a tumor animal model into which the cell line is transplanted.
The metastatic breast cancer cell line TUBO-P2J of the present invention is a metastatic malignant cell line dedifferentiated from TUBO, which is a non-metastatic breast cancer cell line, and may be usefully used for the development of diagnosis and treatment related to cancer metastasis, invasion, and the like.

Description

Metastatic Breast Cancer Cell Line ＴＵＢＯ－Ｐ２Ｊ {Metastatic Breast Cancer Cell Line TUBO-P2J}

FIELD OF THE INVENTION The present invention relates to metastatic breast cancer cell lines, and more particularly to a novel metastatic breast cancer cell line TUBO-P2J, which caused metastatic changes.

In order to understand the course of cancer progression and metastasis, a suitable animal model for causing spontaneous metastasis is essential. In cancer transplantation experiments, much research has been made on how to prepare an animal model to be similar to actual cancer development and metastasis, and the phenomenon of metastasis is observed depending on the site of transplantation and the cancer cell line to be transplanted. In fact, when a breast cancer cell line is implanted or ectopically implanted in a subcutaneous or breast fat pad, it is most similar to the transplantation process of a real malignant breast cancer patient, whereas lung transplantation occurred when a cancerous line was injected into the tail blood vessel. The transplant resulted in a liver transplant.

Depending on the donor and recipient of the cancer cell line, the cancer transplantation model is divided into syngeneic or xenograft. Heterologous transplantation is simple by transplanting human cancer cell lines into immune-inactivated mice, ie nude or SCID mice, and has the advantage that genetic or pharmaceutical modification of the transplanted cell line is possible. However, this xenograft model does not allow for the review of immune mechanisms that function during the actual transplantation process in that the immunological response is excluded, stromal tissue is not derived from cancer cells, and human cell lines may be perfectly adapted in the mouse environment. There is a disadvantage.

Allogeneic transplantation, on the other hand, involves the transplantation of cancer-derived cancer cells into another mouse with the same genetic background, without the immune response between the implant and the recipient being intact, and involving an intact immune response similar to the actual cancer metastasis mechanism. There is an advantage that can be formed. Therefore, allogeneic transplantation models are mainly used to construct organ-specific metastasis models and to select metastatic cell lines through transplantation / metastasis process. However, although this spontaneous metastasis model is essential for studying the immune system in cancer metastasis, the number and related studies are insufficient.

Accordingly, the present invention seeks to provide a TUBO-P2J novel cancer cell line which causes spontaneous metastasis and a spontaneous metastasis model into which such cell line has been transplanted.

In order to solve the above problems, the present invention provides a metastatic breast cancer cell line TUBO-P2J (KCLRF-BP-00272).

In another aspect, the present invention comprises the steps of implanting the cell line in the subcutaneous of normal animals except humans to induce a tumor; Treating the tumor-inducing animal with an anticancer drug candidate; Measuring growth or metastasis of tumor cells in the animal treated with the anticancer agent; It provides an anticancer screening method comprising a.

The present invention also provides a tumor animal model in which the cell line is transplanted subcutaneously in a normal animal except human.

The metastatic breast cancer cell line TUBO-P2J of the present invention is a metastatic malignant cell line dedifferentiated from TUBO, which is a non-metastatic breast cancer cell line, and may be advantageously used for diagnosis and treatment related to cancer metastasis and invasion.

Figure 1 is a graph showing the survival rate of the target mice according to the date after TUBO and TUBO-P2J subcutaneous transplant (A) and pictures of the lung of the mouse 30 days after the transplant.
Figure 2 is a small animal PET-CT photographed result. Result photographs for A after 7 days of cell transplantation, B after 14 days, and C after 28 days.
Figure 3 is a photograph of the results of in vitro Scratch wound analysis. A is the experimental result for TUBO cells, B is the experimental result for TUBO-P2J cells.
Figure 4 shows the results of MMP expression analysis, A shows the RT-PCR results, B shows the zymography results.
5 shows the results of expression analysis of the EMT gene. A is the epithelial marker and B is the mesenchymal marker.

The present invention relates to the metastatic breast cancer cell line TUBO-P2J.

The inventors of the present invention, while studying to prepare a suitable animal model for understanding and studying cancer progression and metastasis process, constructed a metastatic TUBO-P2J cell line derived from a non-metastatic TUBO cancer cell line, wherein the cell line is a normal animal. When transplanted to the subcutaneous of the high spontaneous metastatic activity was confirmed that the present invention was completed. The TUBO-P2J cell line of the present invention was deposited with the Korea Cell Line Bank on August 3, 2011 with accession number KCLRF-BP-00272. The cell line of the present invention can provide a spontaneous metastasis model with excellent metastasis activity, and can be usefully used for cancer metastasis related studies.

In another aspect, the present invention comprises the steps of grafting the TUBO-P2J cell line subcutaneous to normal animals except humans to induce tumors; Treating the tumor-inducing animal with an anticancer drug candidate; Measuring growth or metastasis of tumor cells in the animal treated with the anticancer agent; It provides an anticancer screening method comprising a.

In one embodiment of the invention, the animal may be any animal except human, preferably a mammal, more preferably a mouse, rat, pig or monkey, most preferably a Balb / c mouse. .

As used herein, the term "normal animal" refers to an animal in which a tumor has not developed.

In another embodiment, the TUBO cell lines there is implanted under the skin (subcutaneous) of the normal animal, wherein the amount of the tumor cells to be implanted on the basis of the common mouse 1x10 ⁴ to 1x10 ⁸ cells, preferably from 1x10 ⁴ to 1x10 ⁶ cells. The implanted site may be the back side, but is not limited thereto.

In another embodiment of the invention, the tumors induced by the TUBO-P2J cell line of the invention are breast cancer, colon cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, gastric cancer, liver cancer, hematological cancer, bone cancer, pancreatic cancer, Skin cancer, head and neck cancer, skin melanoma, intraocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer, anal cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vulvar cancer, vaginal cancer, esophageal cancer, small intestine Cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue tumor, female urethral cancer, penile cancer, prostate cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney Cancer, ureter cancer, renal cell carcinoma, renal carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, myeloma, brain stem glioma or pituitary adenoma, but is not limited thereto. More specifically, epidermal growth factor receptor ) May be involved in epithelial cell carcinoma, more specifically non-small cell lung cancer, breast cancer, colon cancer, head and neck cancer or prostate cancer.

As used to refer to the screening method of the present invention, the term “anticancer candidate” refers to an unknown substance used in screening to test whether it has inhibitory activity on growth or metastasis of tumor cells. The candidates include, but are not limited to, chemicals, peptides, proteins, antibodies and natural extracts. Candidates analyzed by the screening methods of the present invention are single compounds or mixtures of compounds (eg, natural extracts or cell or tissue cultures). Candidates can be obtained from libraries of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co., Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA) ) And MycoSearch (USA). Candidates can be obtained by a variety of combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the required synthetic library method, “1-bead 1-compound” library method, and synthetic library method using affinity chromatography screening. Methods of synthesizing molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. USA 90, 6909, 1993; Erbet al. Proc. Natl. Acad. Sci. USA 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, and the like.

The anticancer drug candidate is treated in a tumor-inducing animal. Specifically, when using a mouse, an anticancer agent may be administered to the tumor-inducing mouse, but is not limited thereto.

In another embodiment of the present invention, when measuring the metastasis of tumor cells, the metastasis of tumor cells can be measured in tissues or organs other than the site where the tumor cells are transplanted, Lymph nodes or lungs may correspond, but are not limited to.

In another embodiment of the present invention, the measurement of the growth or metastasis of tumor cells can be made by measuring the expression level or microvascular density of fibroblast growth factor (FGF-2), and visual observation, or tools such as calipers It may be measured using, but preferably may be made non-invasive through Small-animal PET-CT imaging. If further growth or metastasis of tumor cells is inhibited, it may be determined that the candidate anticancer agent for analysis is effective as an anticancer agent.

The present invention also provides a tumor animal model in which the metastatic breast cancer cell line TUBO-P2J has been implanted subcutaneously in normal animals except humans.

Since the tumor animal model of the present invention is an animal model used in the above-described method, the common content between the two is omitted in order to avoid excessive complexity of the specification according to the repetitive description.

Since the TUBO-P2J cell line of the present invention is derived from Balb / c mice, when this cell line is transplanted into Balb / c mice, it has the advantage of being able to study the intact immune response that acts upon allogeneic transplantation.

Hereinafter, the present invention will be described in detail with reference to Examples. However, the following examples are merely to illustrate the content of the present invention is not limited to the scope of the present invention. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

< Example  1> metastatic TUBO  Cell Separation and Replication

One. Mice

Female Balb / c mice 5-8 weeks old were purchased from Orient bio. Each mouse underwent at least one week of acclimation at an animal care center at Inje University Medical College (Busan, South Korea). Mice were stored in plastic cages under conditions of repeating 23 ° C., 50% relative humidity, 6 hours to 12 hours of light and 12 hours of dark cycle. Mice were 6 to 20 weeks old in all experiments and the experiments were performed in accordance with animal testing guidelines established and approved by the Institutional Animal Care and Use Committee of Inje University.

2. Cell line

TUBO cell lines were cloned from spontaneous mammary tumor species of BALB Neu Tg mouse. TUBO contains 10% heat-inactivated fetal bovine serum (sigma), 10% NCTC 109 medium, 2 mmol / l-glutamine, 0.1 mmol / l MEM non-essential amino acid, 100 units / ml penicillin, and 5% CO ₂ conditions, and The cells were cultured in vitro in 10% DMEM medium containing 100 mg / ml streptomycin.

3. Cancer Transplantation

Cancer cells of 70-80% confluence were isolated by treatment with 0.25% trypsin solution (GibcoBRL) at 37 ° C. for 3 minutes and washed with PBS. The isolated cells were neutralized in 10% FBS culture medium and washed twice with PBS. The concentration of cell suspension was adjusted to 1-2 x 106 cells / ml. Subcutaneous infusion of 200 μl of cancer cell suspension was made in the dorsal region of anesthesia Balb / c mice with a mixture of ketamine (90 mg / kg) and xylazine (10 mg / kg).

4. metastatic pulmonary nodules metastatic lung nodule And culture of cancer cells

Metastatic TUBO cells were isolated by treating 1.5 mg / mL collagenase and 100 ug / mL DNase at 37 ° C. for 20 minutes at metastatic pulmonary nodules and gently pipetted into 0.01 M ethylene diamine tetraacetic acid (EDTA) for 1 minute. Single cell suspensions were incubated with G418 (500 ug / ml) in the same medium used for TUBO cell suspensions.

5. Results

TUBO cells did not show metastaticity when implanted subcutaneously. In vivo experiments using the TUBO subcutaneous cancer infusion model, subject mice became very debilitating with cachexia. An autopsy was performed to determine the cause of the disease, with large lymph nodes and spleen and large numbers of nodules found in the lungs.

Lung nodule was isolated by treatment with collagenase and subcutaneously injected in vivo to separate from metastatic lung sections. After three cycles, the isolated cells were finally subcloned using 96-well culture plates and at least one cell was dispensed per month. The cloned cells were examined for in vivo metastasis to the lung after subcutaneous transplantation, and the finally constructed metastatic cell line was named TUBO-P2J. To investigate when metastasis of TUBO-P2J cells takes place, TUBO and TUBO-P2J cells were subcutaneously injected and surgically removed 14 days after infusion and then evaluated for metastasis. The results are shown in Fig. Figure 1 A is a graph showing the survival rate of the target mouse according to the date after cell injection, B is a photograph showing the lung of the mouse 30 days after cell injection.

Referring to FIG. 1, all the mice injected with TUBO-P2J were all dead 40 days after the injection, but the mice injected with TUBO survived up to 100 days after the injection. In addition, referring to the lung of the dead TUBO-P2J, it can be seen that the cancer cells metastasize to the lung and died. These results suggest that TUBO-P2J transition occurs at least 14 days before injection.

< Example  2> Small animal PET - CT  shooting

To confirm that non-invasive imaging systems can detect cancer metastasis, mice bearing cancer cells were photographed with small animal PET-CT using [ ¹⁸ F] FDG at 7 day intervals after cell injection.

After subcutaneous injection, mice were visualized using small-animal positron emission tomography / computed tomography (PET / CT) at 7 day intervals. Mice were anesthetized with a mixture of ketamine and xylazine. [ ¹⁸ F] FDG PET images were used to investigate metabolic and structural changes in induced metastatic cancer. Images were acquired at three positions (30 minutes in total for 10 minutes) with an axial resolution of 1.2 mm using a GE Explore Vista dedicated small-animal PET scanner (GE Healthcare).

The results are shown in Fig. Result photographs for A after 7 days of cell injection, B after 14 days, and C after 28 days.

Referring to Figure 2, the primary cancer mass by TUBO-P2J can be easily detected by PET scan, metastasis to the lung was not detected until after 21 days, it can be seen that at 28 days.

< Example  3> TUBO - P2J Cell Increased  For mobility in vitro Scratch wound  analysis

To determine whether TUBO-P2J has the high migration activity necessary for spontaneous metastasis, an in vitro migration assay using scratch wounds was performed.

2 x 10 ⁶ cells of TUBO cells and 1 x 10 ⁶ cells of TUBO-P2J cells were dispensed into 6-well culture plates. After 12 hours of dispensing, the site of injury was prepared by mechanical scratching with a pipette tip, and after 3 days of scratching, cell migration was compared by cells at the site of injury.

The results are shown in Fig. FIG. 3A shows experimental results of TUBO cells, and FIG. 3B shows experimental results of TUBO-P2J cells.

Referring to FIG. 3, after 3 days of scratching, TUBO-P2J cells appear to have moved to fill the site of injury, but TUBO cells can be seen that only a very small number of cells migrate to the site of injury.

< Example  4> MMP  Expression analysis and metastasis Marker  Examination of characteristic change through comparison of expression

One. RNA  Extraction and Reverse transcription - PCR

Total RNA extracted from the cultured cells was used as a template for reverse transcription. cDNA samples were amplified using the primers in Table 1. After initial denaturation at 94 ° C. for 5 minutes, 30 cycles of 30 second denaturation at 94 ° C., 30 second annealing at 55 ° C., and 60 second elongation at 72 ° C. were performed. The reaction product was analyzed on 1.5% agarose gel. Amplified DNA fragments were cloned and sequenced to confirm that they were PCR products.

NAME NCBI No. FORWARD REVERSE SIZE MMP1a NM_032006 AGACTTCTCTGGTTGCCG AGAGCCTCCAATCACTGTGC 210 MMP2 NM_008610 CTATTCTGTCAGCACTTTGG CAGACTTTGGTTCTCCAACTT 309 MMP3 NM_010809 TGTACCAGTCTACAAGTCCTCCA CTGCGAAGATCCACTGAAGAAGTAG 659 MMP7 NM_010810 CTGCCACTGTCCCAGGAAG GGGAGAGTTTTCCAGTCATGG 175 MMP8 NM_008611 TGACTCTGGTGATTTCTTGCTAA GTGAAGGTCAGGGGCGATGC 164 MMP9 NM_013599 CTCAGAGATTCTCCGTGTCCTGTA GACTGCCAGGAAGACCTTGGTTA 241 MMP10 NM_019471 AGTTGCTCCTGCATGTTCTG TGCATCCTCTCACCTACTGC 120 MMP11 NM_008606 CCGGAGAGTCACCGTCATC GCAGGACTAG GGACCCAATG 110 MMP14 NM_008608.3 CTGATGACGATCGCCGTGGCATCC GCGTCTGAAGAAGAAGACAGCGAGG 878 CDH1 NM_009864 CCATTTTCACGCGCGCTG CGCGAGCTTGAGATGGAT 396 CDH2 NM_007664 AGCGCAGTCTTACCGAAGG TCGCTGCTTTCATACTGAACTTT 110 Krt18 NM_010664 CAGCCAGCGTCTATGCAGG CCTTCTCGGTCTGGATTCCAC 123 Claudin1 NM_016674 GGGGACAACATCGTGACCG AGGAGTCGAAGACTTTGCACT 100 Occludin NM_008756 TTGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG 129 Ctnna1 NM_009818 AAGTCTGGAGATTAGGACTCTGG ACGGCCTCTCTTTTTATTAGACG 115 Ctnnb1 NM_007614 ATGGAGCCGGACAGAAAAGC CTTGCCACTCAGGGAAGGA 108 Jup NM_010593 TGGCAACAGACATACACCTACG GGTGGTAGTCTTCTTGAGTGTG 135 DDR2 NM_022563 ATCACAGCCTCAAGTCAGTGG TTCAGGTCATCGGGTTGCAC 116 Fibronectin NM_010233 AGAGCAAGCCTGAGCCTGAAG TCGCCAATCTTGTAGGACTGACC 192 FOXC2 NM_013519 AACCCAACAGCAAACTTTCCC GCGTAGCTCGATAGGGCAG 130 S100a4 NM_011311 TGAGCAACTTGGACAGCAACA TTCCGGGGCTCCTTATCTGGG 124 SNAI1 NM_011427 CACACGCTGCCTTGTGTCT GGTCAGCAAAAGCACGGTT 133 SNAI2 NM_011415 TGGTCAAGAAACATTTCAACGCC GGTGAGGATCTCTGGTTTTGGTA 131 Acta2 NM_007392 GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA 102 Twist1 NM_011658 GGACAAGCTGAGCAAGATTCA CGGAGAAGGCGTAGCTGAG 146 Vimentin NM_011701 CGGCTGCGAGAGAAATTGC CCACTTTCCGTTCAAGGTCAAG 124 GAPDH NM_008084 TTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGA 250

2. Zymography Zymography )

To analyze proteolytic capacity, TUBO and TUBO-P2J cell supernatants were concentrated with Aquacide (Sigma), diluted to a total protein concentration of 1 mg / ml, containing sodium dodecyl sulfate (SDS), glycerol and bromophenol blue Mixed with sample buffer. The same amount of each sample was electrophoresed on SDS-polyacrylamide gel (7.5%) containing 0.8 mg / ml gelatin (Merck, Darmstadt, Germany). After electrophoresis, the gel was washed twice with Triton X100 for 30 minutes to remove 2.5% SDS and then twice with distilled water and finally incubation buffer (100 mM Tris / HCl, 30 mM CaCl ₂ , 0.01% NaN ₃ ). Balance was maintained at The gel was then incubated at 37 ° C. for 20 hours in incubation buffer. Protein staining was performed for 40 minutes using Coomassie Blue solution (10 ml acetic acid, 40 ml distilled water, 50 ml methanol, 0.25% Coomassie Blue G250 [SERVA, Heidelberg, Germany]). Decolorization was carried out in methanol / acetic acid / distilled water (25: 7: 68 volume ratio). After staining, the enzyme appeared as a white band on a blue gel.

3. Results

One) MMP  Expression

Matrix metalloproteinase (MMP) is a very important enzyme in the penetration of cancer metastasis. To compare the infiltration capacity of TUBO and TUBO-P2J, expression of MMP mRNA and protease activity were compared using RT-PCR and zymography.

The results are shown in Fig. A represents the RT-PCR result and B represents the zymography result. Referring to Figure 4, both TUBO and TUBO-P2J cells express the mRNA of MMP1a, it can be seen that the expression level is constant, both cells did not express MMP8 and MMP14. MMP2 and MMP7 were weakly expressed in TUBO cells but not in TUBO-P2J. MMP3, MMP9, MMP10 and MMP11 were expressed only in TUBO-P2J cells, in particular MMP9 showed enzymatic activity as can be seen from the zymography results of FIG. 4B.

2) in epithelial tissue Into mesenchymal tissue  transition

Epithelial mesenchymal transition (EMT) of epithelial cell carcinoma is an important mechanism for the metastatic properties of non-metastatic cells. To confirm how TUBO-P2J cells acquire mesenchymal characteristics that TUBO cells do not have, expression of known EMT genes was measured by RT-PCR. The results are shown in Fig. 5A shows the epithelial marker and B is the mesenchymal marker.

Referring to FIG. 5, TUBO cells express markers related to epithelial cells and do not express mesenchymal markers, and TUBO-P2J expresses mesenchymal markers but does not express epithelial markers.

Having described the specific parts of the present invention in detail, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Korea Cell Line Research Foundation KCLRFBP00272 20110803

Claims (9)

Metastatic breast cancer cell line TUBO-P2J (KCLRF-BP-00272).
Implanting the cell line of claim 1 subcutaneously in a non-human animal to induce a tumor;
Treating the tumor-inducing animal with an anticancer drug candidate; And
Measuring the growth or metastasis of tumor cells in the animal treated with the anticancer agent; Anticancer screening method comprising a.
The method of claim 2,
The normal animal is a mammalian anti-cancer screening method.
The method of claim 3,
Said mammal is mouse, rat, pig or monkey.
The method of claim 2,
The tumor may be breast cancer, colon cancer, lung cancer, small cell lung cancer, gastric cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin melanoma, intraocular melanoma, uterine sarcoma, ovary Cancer, Rectal cancer, Anal cancer, Fallopian tube cancer, Endometrial cancer, Cervical cancer, Vulvar cancer, Vaginal cancer, Esophageal cancer, Small intestine cancer, Endocrine cancer, Thyroid cancer, Parathyroid cancer, Adrenal cancer, Soft tissue tumor, Female urethral cancer, Penis Cancer, prostate cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney cancer, ureter cancer, renal cell cancer, renal cancer, central nervous system (CNS) tumor, primary CNS lymphoma, myeloma, A method for screening an anticancer agent, which is brain stem glioma or pituitary adenoma.
delete Tumor animal model in which the cell line of claim 1 is implanted subcutaneously in normal animals except humans.
The method of claim 7, wherein
The normal animal is a tumor animal model that is a mammal.
9. The method of claim 8,
The mammal is a tumor animal model of mouse, rat, pig or monkey.

Images