KR101308940B1 - Pharmaceutical composition comprising a proteasome inhibitor and a down regulator of Galpha12/Galpha13 protein function - Google Patents

Abstract

The present invention relates to growth inhibition, alleviation or treatment of tumors, in combination with proteasome inhibitors and inhibitors or downregulators of Gα12 and / or Gα13 protein function. The present invention also relates to growth inhibition, alleviation or treatment of tumors resistant to proteasome inhibitors, in combination with proteasome inhibitors and inhibitors or downregulators of Gα12 and / or Gα13 protein function.

Description

Pharmaceutical composition comprising a proteasome inhibitor and a down regulator of Galpha12 / Galpha13 protein function}

FIELD OF THE INVENTION The present invention relates to the growth inhibition, alleviation or treatment of tumors, using a proteasome inhibitor and a combination of inhibitory or down-regulation of mualpha12 and / or mualpha13 (Gα12 / Gα13) protein function. .

The research for the present invention is a world-class research-oriented university development project (WCU) [Task No .: R32-2009-000-10098-0 Project name: Discovery of aberrant cell differentiation and growth regulator] and Excellent Research Center (ERC [Task Title: 20100001706 Assignment Name: Center for New Drug Development for Metabolic and Inflammatory Diseases].

Proteasomes are large molecule protease complexes found in the cytoplasm and nucleus of various eukaryotic cells. Two 20S proteasomes of the penetrating 20S proteasome having protease activity constitute two 26S proteasomes. The 11S complex is an octet that binds to both ends of the 20S proteasome like the 19S complex (Tanaka, K et al., J. Cell Physiol. Vol. 139, pp 34-41, 1989). Protein degradation by the proteasome-ubiquitin pathway consists of the following steps. First, proteins in cells are ubiquitinated by binding to ubiquitin by ubiquitin activating enzyme (E1), binding enzyme (E2), and transferase (E3). When polyubiquitin chains are combined with proteins, polyubiquitin is recognized. It binds to the 19S portion of the proteasome that has a domain. The ubiquitin is then released from the protein by a deubiquitinating enzyme. The protein attached to the proteasome is defolded into the 20S portion of the proteasome. The 20S subunit has protease activity, which cuts proteins entering the 20S into small stranded amino acid sequences.

Proteasomes are involved in proteolytic pathways essential for a variety of cellular functions such as cell division, antigen processing, oncoproteins or transcription factors, and degradation of regulatory proteins such as cyclins. Many recent studies have demonstrated that inhibition of proteasome has an inhibitory effect on cancer cell proliferation. Voltezomib (Bortezomib, PS-341, Velcade ^TM ), which inhibits the ubiquitin-proteasome circuit, for example, is a new class of anticancer drugs approved by the US FDA for the treatment of recurrent multiple myeloma and mantle cell lymphoma. In use in the clinic. Other proteasome inhibitors include boltezomib, polypeptideboronates such as DFLB, immunoproteasome inhibitors such as IPSI-001, peptidealdehydes such as MG132, MG115, PSI, ALLN, and sulfontripeptides such as NLVS , Epoxomicin, dihydroeponemycin, epoxketones such as carfilxomib, chymotrypsin-like inhibitors such as lactacystin, and actinomycetes Salinospora CNB-392 Salinosporamide A and its analogues, cinnabaramides from Streptomyces, withaferin A from Indian medicinal plants, and physalin B from tropical plants Physalis angulata are known.

The results of clinical trials of Voltezomib performed in solid cancer patients were positive (Papandreou CN et al., Journal of clinical oncology, 22, 2108-2121, 2004; Shah MH et al., Clinical cancer research, 10, 6111-6118, 2004; Davis NB et al., Journal of clinical oncology, 22, 115-119, 2004). Voltezomib, however, has also been reported with clinically resistant patients (Cheriyath V et al., Drugs R & D, 8, 1-12, 2007). This resistance has been reported to be due to mutations or overexpression of Volteozomib, an important target molecule, proteolytic active core subunit 5 (PSMB5) (Lu et al., Experimental hematology, 36, 1278-1284, 2008; Lu et al., Experimental) hematology, 37, 831-837, 2009).

G proteins present in cells are important proteins that mediate the signaling of molecules with numerous biological activities through binding to the G Protein Coupled Receptor (GPCR). In general, the proteins of the G protein family exist as heterotrimeric proteins, which are complexes of alpha (α-), beta (β-), and gamma (γ-) units, and Gα _s , Gαi / o, Gαq, and Gα12 Classified into major families (Moers, A. et al . Nat . Med . 2003 9, 1418-1422). Among them, Gα12 family constructs, including Gα12 and Gα13, are known to be involved in cell growth and malignant cell transformation in connection with ligand stimulation such as sphingolipids, TXA2 or lysophosphatidic acid (Chan AM et al. , Molecular and cellular biology, 13, 762-768, 1993; Xu et al., Proceedings of the national academy of Sciences USA, 90, 6741-6745, 1993). In particular, increased expression of Gα12 has been reported in breast cancer and prostate patients (Kelly P et al., Proceedings of the national academy of Sciences USA, 103, 8173-8178, 2006; Kelly P et al., The journal of biological chemistry , 281, 26483-26490, 2006).

Liver cancer is the fifth most common tumor in the world, and it is known to be caused by hepatitis B and hepatitis C virus (Llovet JM et al., Lancet, 362, 1907-1917). 2003). Liver cancer is very malignant and resistant to conventional cell proliferation inhibitors (Burroughs A et al., Lancet oncology, 5. 409-418, 2004). Despite advances in surgical procedures, long-term results are unsatisfactory even after surgical resection of liver cancer. Therefore, there is a need for the development of new tumor therapies that can replace existing therapies.

On the other hand, the correlation between G protein and proteasome inhibitor resistance is not known worldwide. In addition, there are no reports of pharmaceutical compositions targeting Gα12 protein in tumors to date. There is no example of discovering new drug targets by systematic study of cell signal mapping for the development of tumor therapeutic drugs, especially in the field of tumor research. Protein signal studies are insignificant.

Drugs currently used as tumor treatments still have many side effects and disadvantages, and thus the present invention seeks to find a new method and composition for tumor treatment.

In addition, the present invention seeks to find a method and composition for treating tumors resistant to proteasome inhibitors.

Accordingly, the present inventors have repeatedly conducted research on a technique for searching for cellular signals mediating changes in major gene expression related to proteasome inhibitor resistance, and as a result, the inhibition of Gα12 and Gα13 among Gα12 family proteins is proteasome inhibitor. It has been found to improve resistance, and based on this, a method of inhibiting growth, alleviating and treating tumors co-administering a proteasome inhibitor and a down-regulatory agent of Gα12 and / or Gα13 activity or function, and a novel tumor comprising the same Provided are compositions for growth inhibition, alleviation and treatment.

Concomitant administration of a proteasome inhibitor and a down-regulatory agent of Gα12 and / or Gα13 protein activity or function according to the present invention has the effect of inhibiting tumors, in particular, improving the resistance of proteasome inhibitors. Therefore, a composition comprising a proteasome inhibitor according to the present invention and a down-regulatory agent for inhibiting the activity or function of Gα12 and / or Gα13 protein may be used for inhibiting the growth of tumors, reducing and treating tumors or inhibiting the growth of proteasome inhibitors, It can be used for relief and treatment. In addition, the composition of the present invention can be applied as a means for enhancing the sensitivity to proteasome inhibitors. The present invention can also be utilized in methods of screening for tumor growth inhibition, alleviation or therapeutic actives and for predicting the likelihood that the tumor is a proteasome inhibitor resistant tumor.

The present invention is an advanced technology that discovers new targets for tumor therapy by systematic studies of intracellular signal transduction and cell signal mapping. Inhibitors or downregulatory functions of Gα12 and / or Gα13 proteins can be utilized as tumor therapeutic targets with high efficiency and safety.

1 shows the difference in sensitivity to proteasome inhibitors between epithelial cell carcinoma cells (Huh7, SNU886) and mesenchymal cell carcinoma cells (SK-Hep1, SNU449). Compared with epithelial cell tumor cells, mesenchymal cell tumor cells showed a much slower decrease in cell viability with boltezomib (a) or MG132 (b), which showed resistance to proteasome inhibitors. ** indicates that there is statistically significant (p <0.01) compared to vehicle administration group.
Figure 2 compares the expression levels of Gα12 / Gα13 protein in mesenchymal cell carcinoma cells (SK-Hep1, SNU449) compared with epithelial cell carcinoma cells (Huh7, SNU886).
3 is an OLYMPUS IX70 optical micrograph (X200) of cells permanently overexpressing pCMV, Gα12 or Gα13 in Huh7, an epithelial cell tumor.
Figure 4 compares the effect of the administration of the proteasome inhibitor boltetezomib on cell viability in cells overexpressing Gα12 and Gα13 permanently in Huh7 epithelial cell tumor cells and wild type cells, respectively. Overexpression of Gα12 or Gα resulted in resistance to proteasome inhibitors. *, ** indicates that there is significance (* p <0.05, ** p <0.01) compared to wild type cells.
5 is a comparison of the effects of the administration of boletezomib, a proteasome inhibitor, on cell viability to wild-type cells and cells overexpressing Gα12 and Gα13 mini-genes, respectively, in SK-Hep1 cells, which are mesenchymal cell types. It is. Treatment of Gα12 or Gα13 minigenes improved the susceptibility to Voltezomib of SK-Hep1 cells. *, ** indicates statistical significance (* p <0.05, ** p <0.01) compared to wild-type cell line.

The present invention relates to a method for inhibiting, reducing or treating tumor growth by administering a proteasome inhibitor and a muco12 and / or mualpha13 (Gα12 and / or Gα13) protein activity inhibitory or down-regulatory agent. will be.

The present invention also relates to a composition for inhibiting, reducing or treating tumor growth, comprising a proteasome inhibitor and a downregulator of mualpha 12 and / or mualpha 13 (Gα12 and / or Gα13) protein activity or function. . The composition may be a composition for inhibiting, alleviating or treating proteasome inhibitor resistant tumors. The composition of the present invention may further comprise other cytotoxic agents, chemotherapeutic agents, anticancer agents.

The present invention also relates to a kit for inhibiting, reducing or treating tumor growth comprising a proteasome inhibitor and a down-regulatory agent for the inhibition or function of mualpha12 / muralpha13 (Gα12 and / or Gα13) protein activity.

In another embodiment of the present invention, (a) culturing a cell line comprising a Gα12 and / or Gα13 gene with each of the samples and (b) selecting a sample that inhibits the expression of the Gα12 and / or Gα13 genes. It provides a method for screening the growth inhibitory, alleviating or therapeutic active material comprising a tumor.

Another embodiment of the present invention comprises the steps of (a) adding each of the samples to Gα12 and / or Gα13 protein and measuring the biological activity of the Gα12 and / or Gα13 protein and (b) the biological of the Gα12 and / or Gα13 protein. Screening methods for screening active substances for inhibiting, reducing or treating tumors, which include selecting a sample that inhibits activity.

The invention also includes the steps of (a) measuring the amount of Gα12 and / or Gα13 mRNA or protein and (b) confirming that the amount of the mRNA or protein is higher than normal, wherein the tumor is a proteasome inhibitor resistant tumor. An embodiment includes a method of predicting the likelihood.

Hereinafter, the present invention will be described in more detail.

All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined. Also, preferred methods or samples are described in this specification, but similar or equivalent ones are also included in the scope of the present invention. The contents of all publications referred to herein are incorporated herein by reference.

The present invention is based on the world's first discovery that Gα12 / Gα13 signals modulate the resistance of proteasome inhibitors. The inventors of the present invention have investigated the technology of searching for cellular signals mediating changes in key gene expression associated with proteasome resistance. Surprisingly, inhibition of Gα12 and Gα13 in the Gα12 family protein inhibits the proteasome subunit PSMB5. By controlling the resistance of the proteasome inhibitor.

The inventors of the present invention treated the hepatocellular carcinoma cell line with boltezomib, a proteasome inhibitor, and reduced the dose-dependent cell viability in epithelial tumor cells, whereas the mesenchymal tumor cells showed a dose response of boltezomib. It could not be observed (FIG. 1A). Another proteasome inhibitor, MG132, showed similar results (FIG. 1B).

Meanwhile, the inventors of the present invention revealed that the expression of Gα12 / Gα13 protein was higher in mesenchymal cell tumor cells compared to epithelial cell tumor cells (FIG. 2). From this, the mesenchymal with high protein expression of Gα12 / Gα13 was found. It was found that there is resistance of proteasome inhibitors in cell type tumor cells.

The inventors also found that overexpression of Gα12 / Gα13 genes in epithelial cell tumor cells resulted in the conversion of the cells into mesenchymal hepatocellular carcinoma cells (FIG. 3), and to boltezomib similar to those in mesenchymal tumor cells. It was observed that the resistance to the resulting (Fig. 4). From this, it was found that overactivity of Gα12 / Gα13 in tumor cells is a factor causing resistance to Voltezomib.

In addition, the inventors of the present invention treated the mini gene for Gα12 / Gα13, a representative inhibitor of Gα12 / Gα13 protein, to SK-Hep1 cell line, which is a mesenchymal cell that showed resistance to Voltezomib, to inhibit the expression of Gα12 / Gα13. It was confirmed that the susceptibility to Voltezomib is increased (FIG. 5). Therefore, it can be seen that inhibition of Gα12 / Gα13 protein expression or activity can be utilized for the treatment of tumors by enhancing the sensitivity of proteasome inhibitors. This is confirmed by the experimental results that the treatment of Gα12 or Gα13 mini genes in solid cancer cell lines inhibits the expression of several subunits, including PSMB5, which is known to be the main cause of bolezomib resistance among proteasome subunits (Table 2).

Based on these experimental results, the present invention provides a pharmaceutical composition or kit for inhibiting, reducing and treating tumor growth, comprising a proteasome inhibitor and a Gα12 and / or Gα13 function inhibitor. The present invention also provides a proteasome inhibitor and a pharmaceutical composition or kit for inhibiting, reducing and treating proteasome inhibitor resistant tumors, comprising a proteasome inhibitor and a Gα12 and / or Gα13 function inhibitor. The Gα12 and / or Gα13 protein function inhibitors include substances that inhibit the activity of Gα12 and / or Gα13 proteins or inhibit the expression of Gα12 and / or Gα13 proteins. Also included are substances that bind Gα12 and / or Gα13 receptors and inhibit the reaction of Gα12 and / or Gα13 proteins with receptors. For example, antisense oligonucleotides for Gα12 and / or Gα13 genes, Gα12 and / or Gα13 target siRNAs, antibodies to Gα12 and / or Gα13 proteins, minigenes encoding the C-terminus of Gα12 and / or Gα13, Gα12 And / or antipeptides against Gα13, antipeptide antibodies against Gα12 and / or Gα13 proteins, antibodies against Gα12 and / or Gα13 protein receptors, and antagonists against Gα12 and / or Gα13 protein receptors.

Accordingly, the present invention provides a pharmaceutical composition comprising an antisense oligonucleotide for the Gα12 / Gα13 gene that inhibits the expression of the Gα12 / Gα13 protein. The pharmaceutical composition is an oligo that is antisense to the initiation codon region, coding region, 5 ′ or 3 ′ intron-axon junction or regions within 2 to 10 nucleotides of the Gα12 / Gα13 gene, or antisense to mRNA complementary to the gene. Nucleotides.

SiRNA has been widely studied as a method of inhibiting gene expression and treating the disease. The present invention provides a therapeutic agent for a tumor comprising Gα12 and / or Gα target siRNA. Gα12 and / or Gα13 target siRNAs can be appropriately designed by finding target sites within a gene with reference to methods known in the art. For example, siRNA sequences for inhibiting the expression of Gα12 and / or Gα13 are each comprised of a Gα12 siRNA sense strand (Sense Strand 1: CCAGUAAGCAAGACAUCCU, Sense Strand 2: GCAUCACAUCUAUCCUGUU, Sense Strand 3: CUCUGCUGUUGAUCUGUAA), and its complementary strand, and Gα13 siRNA sense strands, including but not limited to those consisting of one or more selected from the group consisting of Sense Strand 1: GCAAGUUGUUAGCAUCAAA, Sense Strand 2: GGAAGGGCUGUUAGAGAAA, Sense Strand 3: CCAUACAUGCUGUCACUAA, and their complementary strands thereof. Ki et al., J Biol Chem, 2007, 285 (3), 1938-1947. The siRNA included in the pharmaceutical composition of the present invention is from about 17 nucleotides to about 29 nucleotides, preferably about An isolated siRNA comprising short double-stranded RNA consisting of 19 to about 25 nucleotides, the siRNA is complementary to the sense RNA strand. Antisense RNA strands The sense and antisense strands of an siRNA of the invention comprise two complementary and single stranded RNA molecules, or two complementary portions form base pairs and are covalently bound by a single strand of hairpin region It may comprise a single molecule.

SiRNA included in the present invention can be obtained using a number of techniques known to those skilled in the art. For example, siRNA can be chemically synthesized using a method known in the art, or produced by recombinant methods.

Those skilled in the art can readily determine the effective amount of the antisense oligonucleotide and siRNA of the present invention to be administered to a subject in consideration of factors such as the subject's size and weight, the extent of disease progression, age, health condition, sex, route of administration and local or systemic administration. Can decide. In general, the effective amounts of the antisense oligonucleotides and siRNAs of the invention comprise an intracellular concentration of about 1 nM to about 100 nM at or near the disease site. If necessary, it may be administered higher or lower than the concentration. Antisense oligonucleotides and siRNAs of the invention can be administered to a subject as such or in combination with a delivery reagent, or as recombinant plasmids or viral vectors expressing them. Suitable delivery reagents include lipofectin, lipofectamine, celfectin, macrocationic (eg polylysine) or liposomes. Pharmaceutical compositions comprising an antisense oligonucleotide and siRNA of the present invention can be delivered using a gene gun, ultrasound or electric shock.

The C-terminus of the Gα subunit of the G protein is an important contact with the receptor and determines G protein receptor selectivity (Hamm, HE et al., Curr. Opin. Cell Biol. 8, 189-196, 1996). In addition, Gα C-terminal peptides act as competitive inhibitors at the G protein binding site of GPCRs. Accordingly, the present invention overcomes proteasome inhibitor resistance, including antipeptides against Gα12 and / or Gα13, to provide therapeutic agents for tumors. Antipeptides for Gα12 and / or Gα13, which can act as competitive inhibitors at the G protein binding site, can be designed and made according to known methods. For example, MGX, MX and MZX, where M is methionine, G is glycine, Z is an amino acid residue other than glycine, and X is a C-terminal amino acid sequence of the Ga12 / Ga13 protein that binds to the GPCR. And having at least three or more contiguous to at least 54 contiguous amino acids). For example, MGLHDNLKQLMLQ or MGLQENLKDIMLQ may be included. In addition, substitution, addition, deletion or insertion of amino acids of the antipeptide may be possible within a range that does not interfere with receptor binding. For example, in the case of the C-terminal region comprising an antipeptide, it may include MGL-XX-NLK-XX-MLQ or portions thereof (substitution, addition, deletion or insertion of amino acids indicated by X is possible). The amino acid to be substituted may be substituted with one having similar properties to the amino acid to be substituted as follows. For example, alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine and tryptophan are classified as nonpolar amino acids, which have similar properties to each other. Charged amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine, acidic amino acids include aspartic acid, glutamic acid, and basic amino acids include lysine, arginine and histidine. The antipeptide can be prepared by synthetic or recombinant methods known in the art.

The C-terminal polypeptide of Gα12 and / or Gα13 may be expressed in vivo using a minigene encoding it. "Mini gene" plasmid vectors designed to infect mammalian cells to express relatively short polypeptide sequences have been used to study the interaction of G proteins with their G protein-coupled receptors (GPCRs). Gilchrist A. et al., J. Biol. Chem. 274 (10), 6610-6616, 1999. We have also reported the specific inhibitory effects of receptor-Gaq through experiments with minigenes expressing more than 55 amino acids of Gaq. (Akhter, SA et al., Science 280, 574-577, 1998.) The minigenes encoding the C-terminus of Gα12 / Gα13 of the invention include, for example, MGX, MX and MZX, where M is methionine, G is Glycine, Z are amino acid residues other than glycine, X is the C-terminal amino acid sequence of the Gα subunit of the Gα12 / Gα13 protein, which binds to the GPCR and has at least three consecutive to at least 54 consecutive amino acids. The mini-gene encoding the C-terminus of Gα12 and / or Gα13 comprises a sequence encoding MGLHDNLKQLMLQ or MGLQENLKDIMLQ. As long as there is no disruption in binding, a sequence encoding an amino acid sequence of an antipeptide substituted, added, deleted and / or inserted into an amino acid is included. For example, in the case of Gα12 and / or GαC-terminal sites, the sequence encoding some of the sequences of MGL-XX-NLK-XX-MLQ (substituting, adding, deleting and / or inserting amino acids represented by X are possible). Include.

The minigene may further include a promoter, a ribosomal binding site, a transcription initiation codon, and / or a transcription termination codon. Plasmid vectors containing the minigenes are described in J. Biol. Chem. 276 (28), 25672-25679.

The invention also provides antibodies to Gα12 and / or Gα13 proteins and antibodies to GPCRs, and antipeptide antibodies to Gα12 and / or Gα13 proteins, which inhibit Gα12 and / or Gα13 protein-receptor responses. Antibodies of the invention include polyclonal antibodies, monoclonal antibodies, human antibodies and humanized antibodies. Examples of antibody fragments include Fab, Fab ', F (ab') 2 and Fv fragments; Diabody; Linear antibodies (Zapata et al., Protein Eng. 8 (10): 1057-1062 (1995)); Single chain antibody molecules; And multispecific antibodies formed from antibody fragments and the like. Upon digestion of the antibody into papain, two identical antigen binding fragments are generated, one for each "Fab" fragment with a single antigen binding site, and the remainder "Fc" fragments. Treatment of pepsin produces an F (ab ') 2 fragment that has two antigen binding sites and is still cross-linked to the antigen. Fv is a minimal antibody fragment containing complete antigen recognition and binding sites. This site is composed of a duplex of one heavy chain and one light chain variable region and is tightly bonded by non-covalent bonds.

G protein is a molecule that has numerous biological activities through binding to GPCR

Mediate their signaling. The present invention relates to G protein receptors and Gα12 and / or Gα13

Pharmaceutical compositions comprising an antagonist that inhibits interaction with the protein.

 Proteasome inhibitors that may be included in the compositions of the present invention include polypeptide boronates such as boltezomib, DFLB, immunoproteasome inhibitors such as IPSI-001, peptidealdehydes such as MG132, MG115, PSI, ALLN, NLVS Sulfone tripeptide, such as epoxomicin, dihydroeponemycin, carfilxomib, epoxetone, microorganism-derived chymotrypsin-like inhibitors, such as lactacystin, Salinosporamide A and its analogues isolated from actinomycetes Salinospora CNB-392, cinnabaramides from Streptomyces, withaferin A from Indian medicinal plants, and physalin B from tropical plant Physalis angulata.

Tumors to be treated by the compositions of the present invention include, but are not limited to, carcinoma, sarcoma, lymphoma, leukemia, germ cell tumor, blastoma.

The composition of the present invention may include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" includes all substances suitable for pharmaceutically administration with an active ingredient.

The composition of the present invention can be administered by formulating it into a unit dosage form or injection suitable for oral administration according to conventional methods in the pharmaceutical art. Formulations for oral administration suitable for this purpose include hard or soft capsules, tablets, powders, suspensions, syrups and the like. Such oral preparations include, in addition to two or more pharmacologically active ingredients, one or more pharmaceutically inert common carriers such as excipients such as starch, lactose, carboxymethylcellulose, kaolin, water, gelatin, alcohols. , Additives such as binders such as glucose, gum arabic, tragacanta rubber, disintegrants such as starch, dextrin, sodium alginate, and lubricants such as talc, stearic acid, magnesium stearate, liquid paraffin, etc. have. In the present invention, a dissolution aid for dissolution may also be added.

The pharmaceutical compositions of the invention are also administered in a manner suitable for the dosage form and therapeutically effective amount of the drug, for example oral, intranasal, intravenous, intraperitoneal, subcutaneous or topical administration. The composition may also use other methods known in the art, such as those described in the latest edition of Remington's Pharmaceutical Science. For example, injectables may be prepared using, but not limited to, physiologically suitable buffers such as Hank's solution, Ringer's solution, and physiological saline buffer. The solution may include suspending, stabilizing and / or dispersing agents. Alternatively, the compositions of the present invention may be prepared in powder form and used with a suitable carrier such as sterile water before use. Or in the form of liposomes, suspensions, or sustained release formulations. The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, hormone therapy, drug therapy and biological response modifiers for the treatment of tumors.

In the present invention, proteasome inhibitors and Gα12 and / or Gα13 function inhibitors may be included together in one formulation or prepared separately in separate formulations. Proteasome inhibitors and Gα12 and / or Gα13 function inhibitors may be administered together at the same time, or Gα12 and / or Gα13 function inhibitors may be administered separately before or after the proteasome inhibitor.

The dose, timing, and method of administering the proteasome inhibitor and Gα12 and / or Gα13 inhibitors of the present invention vary depending on the age, sex, condition, weight, route of administration, frequency of administration, and form of the subject. The daily dose of proteasome inhibitors and Gα12 and / or Gα13 function inhibitors is about 0.01 ug / kg to 1 g / kg, preferably 0.1 ug / kg to 100 mg / kg.

When the composition of the present invention is used as a gene therapy agent, the nucleic acid may be directly injected or a transporter (vector) containing the nucleic acid may be administered. Nucleic acid molecule

The dosage depends on the expression vector, the subject to be administered, and the like. For virus vectors, the virus

The amount of recombinant virus containing the vector ranges from 10 ³ to 10 ¹² pfu / kg.

In addition, the Ga12 and / or Ga13 protein function inhibitors of the present invention can be delivered using liposomes, viruses, gene guns, polymers, ultrasound, electric shocks.

The present invention provides a method of inhibiting tumor growth, reducing tumors, or treating tumors by co-administration of proteasome inhibitors and Gα12 and / or Gα13 function inhibitors. Another embodiment of the present invention provides a method of inhibiting growth of, reducing, or treating a tumor of a proteasome inhibitor resistant tumor by co-administration of a proteasome inhibitor and a Gα12 and / or Gα13 function inhibitor.

The present invention provides a method for screening the active agent for inhibiting, reducing and treating tumor growth. The method includes (a) culturing a cell line comprising a Gα12 and / or Gα13 gene with each of the samples, and (b) selecting a sample that inhibits the expression of the Gα12 and / or Gα13 genes. And methods for screening therapeutic actives. The degree of inhibition of the expression of the Gα12 and / or Gα13 genes can be determined, for example, by measuring the amount of Gα12 and / or Gα13 mRNA by Northern blot method or by using an antibody against the Gα12 and / or Gα13 protein. This can be determined by measuring the amount of.

The method for screening active agents for alleviating and treating other tumors provided by the present invention comprises the steps of (a) adding each of the samples to Gα12 and / or Gα13 proteins and measuring biological activity and (b) Gα12 and / or Gα13 It is a method for screening an active substance for reducing or treating tumors, including selecting a sample that inhibits the activity of a protein.

Such methods of the present invention are useful for screening actives for growth inhibition, alleviation or treatment of proteasome inhibitor resistant tumors.

The invention also provides a method for predicting the likelihood of developing a tumor. When the expression of Gα12 and / or Gα13 protein is higher than normal or high in activity, the ability to inhibit the phenomena caused by overexpression of bronchial contractile disease or tumor-related factors is reduced, and thus diseases caused by overexpression of these factors There is a high probability of onset. Therefore, the present invention provides a method for predicting the onset of tumor comprising the steps of (a) measuring the amount of Gα12 and / or Gα13 mRNA or protein and (b) confirming that the amount of the mRNA or protein is higher than normal. do.

The invention also provides a method for predicting the likelihood of being a proteasome inhibitor resistant tumor. Tumor cells expressing higher levels of Gα12 and / or Gα13 proteins are resistant to proteasome inhibitors, so tumor cells overexpressing these factors are more likely to be resistant when proteasome inhibitors are administered. Therefore, the present invention comprises the steps of (a) measuring the amount of Gα12 and / or Gα13 mRNA or protein and (b) confirming that the amount of the mRNA or protein is higher than normal, the tumor is a proteasome inhibitor resistant tumor It provides a way to predict the likelihood.

The invention is illustrated in more detail by the following examples, although the invention is not limited thereto.

< Example  1>

Epithelial cell type tumor cells Mesenchymal cell type  Between tumor cells Proteasome  Comparison of sensitivity differences between inhibitors

Huh7 and SNU886 belong to epithelial cell type tumor cells, and SK-Hep1 and SNU449 are mesenchymal cell types. Huh7, SNU886, SK-Hep1 and SNU449 cells were purchased from Korea Cell Line Bank. Mesenchymal cell types are rounder, fusiform, and bipolar than epithelial cell types, which are large, broad, and expanded.

The four cells were incubated for 24 hours in DMEM (high glucose) containing 10% FBS and 100 μg / ml Normocin at 37 ° C and 5% CO ₂ . Depleted. After that, Voltezomib (LC Laboratory (Woburn, MA, USA)) was diluted with dimethyl sulfoxide and treated with concentrations (0.1, 1, 10 μM), and then empty cells were measured 24 hours later. (MTT) analysis was performed. As a result, the cell viability (Hu7 cell line) showed that the cell viability (%) was 61.7% when treated with 0.1μM of boltezomib, 49.2% when treated with 1μM, and 10μM compared with the control group (100%). 20.4% of the SNU886 cell line compared with the control group (100%) compared with 46.6% of Voltezomib, 33.7% of 1μM, and 25.2% of 10μM. In the SK-Hep-1 cell line, the cells were 73.0% treated with 0.1 μM of boltezomib, 73.5% treated with 1 μM, and 67.6% treated with 10 μM, compared to the control group (100%). 100%), 68.3% treated with Voltezomib, 70.2% treated with 1μM, and 71.3% treated with 10μM.

In epithelial cell tumor cells, boltezomib dose-dependently decreased cell viability, whereas mesenchymal cell tumor cells could not observe boltezomib dose response. Data is mean ± S.E.M of three experiments (FIG. 1A).

MG132 (Sigma Chemical (St. Louis, MO, USA)), known as a proteasome inhibitor, was diluted in dimethylsulfoxide and treated with concentrations (0.5, 1, 5μM), and then analyzed for empty under the same conditions. . As a result, the cell viability (Hu7 cell line) of the epithelial tumor cell line was 59.2% when treated with 0.5μM MG132, 46.4% when treated with 1μM and 5μM compared with the control group (100%). In the SNU886 cell line, 33.6% were treated with 0.5 mg of MG132, 26.5% were treated with 1 μM, and 18.9% were treated with 5 μM compared with the control group (100%). In the SK-Hep-1 cell line, 73.0% was treated with 0.5 mg of MG132, 73.5% was treated with 1 μM, 64.5% was treated with 5 μM compared with the control group (100%). In comparison, 66.0% treated with MG132 0.5μM, 63.7% treated with 1μM, and 65.3% treated with 5μM. Similar to the Voltezomib treatment, the sensitivity of MG132 was observed in epithelial cell tumors, while the resistance of MG132 was observed in mesenchymal cell tumors (FIG. 1B).

<Example 2>

Epithelial cell type tumor cells Mesenchymal cell type  G between tumor cells alpha 12 and G alpha Comparison of 13 Protein Expression Levels

Proteins were isolated from four types of Huh7, SNU886, SK-Hep1, and SNU449 hepatocarcinoma cell lines, and Western blots were used to compare the expression levels of Ga12 and Ga13. In mesenchymal cell tumors SK-Hep1 and SNU449 compared to the epithelial tumor cells Huh7 and SNU886

Protein expression of Ga12 and Ga13 was increased (FIG. 2).

The experimental results of Examples 1 and 2 show that the resistance of proteasome inhibitors is high in mesenchymal cell types with high protein expression of Gα12 and / or Gα13.

< Example  3>

G alpha 12 and G alpha 13 Overexpression in Induced Epithelial Tumor Cells. Voltezomib  Sensitivity to

PCMV, pCMV-Ga12Q229L (gene encoding a protein in which the 229th amino acid Q (glutamine) of Ga12 protein is replaced with L (leucine)), pCMV-Ga13Q226L (Ga13 protein, respectively) in Huh7 cells using FuGENE® 6 (Roche) Gene encoding the protein of which the 226th amino acid Q is substituted for L) was transfected according to the manufacturer's instructions, and stably transfected cells were transferred to a medium containing geneticin (G418). Selection was made by weekly incubation. At least 100 NeoR colonies were combined to obtain cells that were stably transfected.

Stable overexpression of Gα12 and Gα13 in Huh7 epithelial hepatocellular carcinoma cells was converted into round, fusiform and bipolar mesenchymal cell type HCCs through epithelial-to mesenchymal transition (Figure 3). Cells were incubated in DMEM until 70% confluency, and photographed at 200-fold magnification using OLYMPUS IX70 optical microscope.

Cell viability was 82.5% when Voltezomib was treated with 0.1μM boltezomib, 65.4% when treated with 1μM, 45.0% when 10μM treated, and overexpressed Ga12 (12QL) Voltezomib 0.1 71.9% when treated with μM, 67.4% when treated with 1μM, 61.2% when treated with 10μM, and Ga7.1 overexpressed 87.1% when treated with 0.1μM of voltezomib, 86.2% when treated with 1μM, 82.4% when treated with 10μM. As a result, it was observed that cells overexpressing Ga12 and Ga13 by 24 hours of treatment slowed down the inhibition of cell viability when compared to cells expressing the empty vectors. Data is mean ± S.E.M of three experiments.

The result of inhibiting the sensitivity of proteasome inhibitors by Gα12 / Gα13 activation signal by this specific overexpression vector, Gα12QL / Gα13QL, shows that Gα12 and / or Gα13 may be applied as therapeutic targets.

< Example  4>

Voltezomib  G for sensitivity alpha 12 and G alpha Effect of Mini Genes of 13

In order to observe whether the inhibitory effect of proteasome inhibitors by Gα12 or Gα13 activity of Example 3 is related to Gα12 / Gα, pCDNA and mini genes of Gα12 and Gα13 were respectively applied to SK-Hep1 cells, which are mesenchymal cell lines. Transfection.

Gα12 C-terminal region MGLQENLKDIMLQ was used as the Gα12 specific minigene, and Gα13 C-terminal region MGLHDNLKQLMLQ was used as the Gα13 specific minigene. SK-Hep1 cell line overexpresses mock, Gα12 and Gα13 mini-gene expression vectors intracellularly with Fugene®6 and contains no antibiotics (EMEM) containing 1% bovine serum (EMEM). After 18 hours of recovery, the cells were stably overexpressed by obtaining G418 antibiotic resistant cells for 3 weeks.

Cell viability was transfected with the empty vector (WT), 103.6% when treated with 0.1 μM of bolthezomib, 101.7% when treated with 1μM, 90.6% when treated with 10μM, and overexpressed Gα12 minigene (CT12) 85.7% when treated with 0.1μM of zomi, 75.2% when treated with 1μM, 56.9% when treated with 10μM, overexpressed Gα13 minigene (CT13) 77.8% when treated with 0.1μM of bolezomib, 80.2% when treated with 1μM , 60.2% of 10μM treatment, cells overexpressing the Gα12 or Gα13 mini- genes inhibited the activity of G12 and G13, compared to the control group using the empty vector (0.1, 1, 10 μM) 24 Increased sensitivity to time treatment was observed.

These results show that certain mini genes used for the present invention can be applied as a good means of inhibiting Gα12 / Gα13 activation signals.

< Example  4>

Proteasome In subunit  About G alpha 12 and G alpha Effect of Mini Genes of 13

The inventors of the present invention investigated the effect of inhibiting Gα12 / Gα13 activity on mRNA expression of proteasome subunits. After transfecting stably the effect of the Gα12 / Gα13 mini gene on MiaPaCa2 cells, a type of solid cancer cell line, mRNA was isolated and analyzed by real-time PCR.

In the 20S proteasome constituting the active subunit, PSMB5, PSMB6 PSMB7 and PSMA1, PSMA4 PSMC4 constituting the structural subunit, low molecular mass polypeptide 2 (LMP2), LMP7, and multicatalytic endopeptidase complex constituting the immunoproteasome subunit -like-1 (MECL-1) was observed. MRNA levels of regulatory-particle non-ATPase subunit 1 (RPN1) for 19S proteasome and proteasome activator 28α (PA28α) for 11S proteasome were measured.

Voltezomib is known to inhibit the chymotryptic-like activity of 20S proteasome. It is PSMB5 that governs chymotryptic-like activity (Oerlemans et al., Blood, 112, 2489-2499, 2008). The main cause of bolezomib resistance is overexpression of PSMB5 and no effect on other proteasome subunits including PSMB6, PSMB7, PSMA7.

Cells overexpressing the Gα12 and Gα13 mini- genes inhibited the G12 and G13 activity, but significantly reduced the amount of PSMB5 mRNA compared to the control group using the empty vector. In addition, mRNA levels of the immunoproteasome subunit MECL-1 and 11S proteasome PA28alpha were significantly decreased. On the other hand, mRNAs of the structural subunits PSMC4 and 19S proteasome RPN1 were increased by inhibition of Gα12 activity, and the active subunit PSMB6 was decreased and PSMB7 was significantly increased by Gα13 activity inhibition. Data is mean ± S.E.M of three experiments (Table 2).

Data represent the mean ± S.E of three independent experiments (* p <0.05, ** p <0.01 significant compared with WT MiaPaCa2 cells).

These results show that the specific mini-genes used for the present invention can be applied as a good means of inhibiting Ga12 / Ga13 activation signals, thereby increasing the susceptibility to proteasome inhibitors by inhibiting the causative agent of proteasome inhibitor resistance. .

Reference Example  One: MTT Assay

After treatment with cells according to the Mosmann T method (1983), MTT reagent (0.25 mg / ml) (Sigma Chemical) was reacted for 4 hours to stain live cells. Formacan crystals from live cells were dissolved in dimethylsulfoxide and measured at 540 nm absorbance using an ELISA instrument (Tecan, Research Triangle Park, NC). Cell viability is defined as follows. [Eg, survival rate (% control) = 100 × (absorbance of drug treatment group) / (absorbance of control group)].

Reference Example  2: Western Blot

Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed using a Mighty Small II SE 250 apparatus according to the Laemmli UK method (1970). Dissolve the fraction of liver sample in sample dilution buffer [63mM Tris (pH.6.8), 10% glycerol, 2% SDS, 0.0013% bromophenol blue, 5% β-mercaptoethanol] and use 7.5%, 9% gel Electrophoresis was performed in buffer (including Tris 15g, glycine 72g, SDS 5g in 1L solution). The electrophoresis gel was transferred to nitrocellulose paper for 1 hour at 190 mAmps in transition buffer [25 mM Tris, 192 mM glycine, 20% v / v methanol (pH.8.3)] using a transfer electrophoresis device. After reacting Anti-SREBP-1 as a primary antibody, Horseradish peroxidase-conjugated goat anti-rabbit IgG was reacted with secondary antibody for 1 hour and developed using ECL chemiluminecence system (Amersham, Gaithesberg, MA). The homogeneity of the protein content in the samples was confirmed using anti-β-actin antibodies (Sigma, St. Louis, MO).

Reference Example 3: Real time-RT PCR

CDNA was obtained by PCR using total RNA (2 μg), d (T) ₁₆ primer and AMV reverse transcriptase extracted from the cells. Relative amounts of genes were quantified by real-time PCR using SyBr green-I kit (Takara). Real-time PCR was performed using Roche (Mannheim, Germany) Light-cycler ^1.5 . The relative amounts of each gene were analyzed using the Light-cycler software 4.0 program.

Reference Example  4: Analysis method

The data presented in the following examples were analyzed using a pharmacological calculation program, and the significance of various experimental groups was analyzed by one-way square deviation analysis (Fisher, RA, Statistical Methods). for Research Workers , Edinburgh : Oliver & Boyd , 1925) Newman-Kells test (Norman GR et al., Biostatistics: The Bare Essentials, 20000) (* p <0.5, ** p <0.01) (1925).

Attach an electronic file to a sequence list

Claims (13)

One or more Gα12 inhibitors or Gα13 inhibitors and proteasome inhibitors selected from the group consisting of a minigene encoding the C-terminal MGLHDNLKQLMLQ of the Gα12 protein and a minigene encoding the C-terminal MGLQENLKDIMLQ of the Gα13 protein, and a pharmaceutically acceptable A pharmaceutical composition for inhibiting, alleviating or treating a proteasome inhibitor resistant tumor, comprising a possible carrier. One or more Gα12 inhibitors or Gα13 inhibitors and proteasome inhibitors selected from the group consisting of an antipeptide of Gα12 protein consisting of the sequence of MGLHDNLKQLMLQ, an antipeptide of the Gα13 protein consisting of the sequence of MGLQENLKDIMLQ, and a pharmaceutically acceptable carrier A pharmaceutical composition for inhibiting, alleviating or treating the growth of a proteasome inhibitor resistant tumor comprising a. The pharmaceutical composition according to claim 1 or 2, wherein one or more inhibitors selected from the group consisting of Gα12 protein function inhibitors and Gα13 protein function inhibitors and proteasome inhibitors are administered simultaneously or separately. delete The pharmaceutical composition according to claim 1, wherein the minigene further comprises one or more selected from the group consisting of a promoter, a ribosomal binding site, a transcription initiation codon, and a transcription stop codon. delete delete Gα12 siRNA sense strand (Sense Strand 1: CCAGUAAGCAAGACAUCCU, Sense Strand 2: GCAUCACAUCUAUCCUGUU, Sense Strand 3: CUCUGCUGUUG) and its complementary strand, Gα13 siRNA sense strand (Sense Strand 1: GCAAGUUGUUAGCAUCAAAGA SGAGUGAGAGA And a Gα12 function inhibitor or a Gα13 inhibitor and a proteasome inhibitor, which are at least one selected from the group consisting of the complementary strands thereof and the Gα12 or Gα13 target siRNAs thereof, and a pharmaceutically acceptable carrier. A pharmaceutical composition for inhibiting, reducing or treating growth of a proteasome inhibitor resistant tumor. delete The proteasome inhibitor of any one of claims 1, 2, 5 and 8, wherein the proteasome inhibitor is boltezomib, DFLB, IPSI-001, MG132, MG115, PSI, ALLN, NLVS, epoxymycin ( A pharmaceutical composition selected from the group consisting of epoxomicin) dihydroeponemycin, carfilxomib, lactacystin, salinosporamide A, cinnabaramides, withaferin A and physalin B. (a) culturing a cell line comprising one or more genes selected from the group consisting of Gα12 and Gα13 genes with each of the samples, and (b) inhibiting the expression of one or more genes selected from the group consisting of Gα12 and Gα13 genes. A method for screening an active substance for inhibiting, alleviating, or treating a proteasome inhibitor resistant tumor comprising the step of selecting a sample. (a) adding each of the samples to at least one protein selected from the group consisting of Gα12 protein and Gα13 protein and measuring the biological activity of at least one protein selected from the group consisting of Gα12 protein and Gα13 protein and (b) Gα12 protein and A method for screening an active agent for inhibiting growth, alleviating, or treating a proteasome inhibitor resistant tumor comprising selecting a sample that inhibits the biological activity of at least one protein selected from the group consisting of Gα13 protein. (a) measuring the amount of at least one mRNA selected from the group consisting of Gα12 mRNA and Gα13 mRNA or at least one protein selected from the group consisting of Gα12 protein and Gα13 protein and (b) whether the amount of the mRNA or protein is higher than normal A method of analyzing a sample to provide information for predicting the likelihood that the tumor is a proteasome inhibitor resistant tumor, comprising the step of identifying.

Images