KR101303699B1 - Detecting method of several food-poisoning bacteria using PNA chip - Google Patents

Abstract

The present invention relates to a method for detecting food poisoning bacteria using a PNA (Peptide Nucleic Acid) microarray chip, a PNA probe and a PNA microarray chip used therein, and when using the same, it detects six food poisoning bacteria at once with excellent specificity and sensitivity. It is possible to provide safe crops through easy and systematic food poisoning management.

Description

Detecting method of several food-poisoning bacteria using PNA chip}

The present invention relates to a PNA (Peptide Nucleic Acid) probe, a PNA chip immobilized on a microarray substrate, and a method for detecting food poisoning bacteria using the same.

Recently, as the demand for fresh vegetables increases worldwide, cases of food poisoning contamination are increasing rapidly. In order to secure the safety of agricultural microbial hazards, major industrialized countries have developed and applied advanced molecular biology techniques including polymerase chain reaction (PCR) for the rapid detection of food poisoning bacteria and the tracking of pollutants. As part of this, a multiplex PCR method for simultaneously identifying 13 food poisoning-related bacteria has been developed and applied, a real time PCR method for rapid detection and quantification has been applied, and PFGE (Pulsed Field) for sub-typing between the same food poisoning bacteria. Various molecular biological techniques such as Gel Electrophoresis (RAPD), Randomly Amplified Polymorphic DNA (RAPD), and Multiple-Locus Variable-number tandem-repeat Assay (MLVA) have been used.

However, since most of the food poisoning bacteria content in the crop is insignificant, the food poisoning bacteria could not be effectively detected by the above methods, and thus a more sensitive detection method was required.

Accordingly, the problem to be solved by the present inventors is a method for detecting food poisoning bacteria using a PNA (Peptide Nucleic Acid) microarray chip, which can simultaneously detect six food poisoning bacteria with excellent specificity and sensitivity, and a PNA probe used therein. To provide.

In order to achieve the above object, the present invention provides a PNA (Peptide Nucleic Acid) probe for detecting food poisoning bacteria selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 1 to 7.

The PNA probe consisting of the nucleotide sequence of SEQ ID NO: 1 may specifically bind to Bacillus cereus , and the PNA probe consisting of the nucleotide sequence of SEQ ID NO: 2 may be Listeria monocytogenes ( Listeria). monocytogenes ), and the PNA probe consisting of the nucleotide sequence of SEQ ID NO: 3 can specifically bind to Staphylococcus aureus , and the nucleotide sequence of SEQ ID NO: 4 The PNA probe may be specifically bound to Yersinia enterocolitica, and the PNA probe consisting of the nucleotide sequence of SEQ ID NO: 5 may specifically bind to Salmonella enterica . The PNA probe consisting of the nucleotide sequences of SEQ ID NO: 6 and SEQ ID NO: 7 may specifically bind to E. coli 0157: H7.

As used herein, the term "PNA (Peptide Nucleic Acid)" means that the phosphodiester bond of DNA is replaced by a peptide bond, and has adenine, thymine, guanine and cytosine such as DNA. It can cause hybridization with DNA or RNA in a specific way, and refers to a synthetic material that is neutral due to the structural properties of the backbone changed into a peptide bond form.

As used herein, the term "Peptide Nucleic Acid (PNA) probe" refers to a fragment of PNA that corresponds to polynucleotides, from short to whiskers to hundreds of bases, capable of specific binding with their complementary polynucleotides. Labeling can confirm the presence or absence of specific polynucleotides and their complementary polynucleotides.

When designing the PNA probe, there are various constraints such as the A, G, C, T content ratio, length, Tm, and prevention of probe dimer formation of the probe, and other conditions are required to distinguish the DNA probe.

As having been developed for, PNA probes these requirements provided by the present invention, as the sikjungdokgyun detection include a sample in a very small amount as possible, discontinued sikjungdokgyun detection, as well as of six kinds sikjungdokgyun (Bacillus cereus (Bacillus cereus ), Listeria monocytogenes ( Listeria) monocytogenes ), Staphylococcus aureus ), Yersinia enterocolitica ), Salmonella enterica , and E. coli 0157: H7) can all be detected simultaneously with high specificity and sensitivity.

The probes represented by the base sequences of SEQ ID NOs: 1 to 7 according to the present invention may also include base sequences in which one or more bases are deleted, substituted, or added to the base sequence of each probe.

Probes according to the present invention may include additional features that do not change the basic properties. That is, the nucleotide sequence can be modified using many means known in the art. Examples of such modifications include methylation, capping, substitution of one or more homologs of nucleotides and uncharged linkages, such as phosphonates, phosphoresteres, phosphoramidates or carbamates, or phosphorothioates or phosphorodithioates. Modifications to charged connectors, etc. are possible. In addition, PNA may contain one or more of nucleases, toxins, antibodies, signal peptides, proteins such as poly L-lysine, intercalating agents such as acridine or psoralen, chelating agents and alkylating agents such as metals, radioactive metals, and iron oxidizing metals. It may have additional covalently linked residues.

In addition, the nucleotide sequence of the probe according to the present invention can be modified using a label capable of directly or indirectly providing a detectable signal. Labels that can be detected using the probe spectroscopy, photochemistry, biochemistry, immunochemistry or chemical means. Useful labels include ³² P, fluorescent dyes, electron dense reagents, enzymes (commonly used in ELISAS), biotin or hapten and proteins for which antiserum or monoclonal antibodies are available.

In addition, the probes according to the invention may comprise the functional groups necessary for immobilization such as amines or thiols, for example at the N-terminus, in order to efficiently immobilize on the substrate.

In another aspect, there is provided a PNA microarray chip for detecting food poisoning bacteria comprising at least one PNA probe selected from the group of PNA probes consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 7.

The PNA microarray chip means that a PNA probe is immobilized on a microarray substrate. Probes may be immobilized on, for example, silica, semiconductors, plastics, gold, silver, magnetic molecules, nylon, poly (dimethylsiloxane, PDMS) polymer compounds, cellulose or nitrocellulose. And is preferably immobilized on a substrate such as a glass slide. The shape of the substrate is not particularly limited, and may be, for example, a thin plate that can be held by hand such as a glass slide, as well as a tube or a bead of 0.1 mm or less that can be mixed and transported in a liquid. Can be. The surface of the substrate can be functionalized with functional groups such as aldehyde groups, carboxyl groups, epoxy groups, isothiocyanate groups, N-hydroxysuccinimidyl groups, activated ester groups, in particular epoxy groups. However, after the probe is fixed, in order to reduce the background signal, the probe may be stabilized by blocking the remaining functional group.

The present inventors confirmed that by using the PNA probe according to the present invention and the PNA microarray chip immobilized on the microarray substrate, all six food poisoning bacteria can be detected with high specificity and sensitivity at once.

Thus, in another aspect, the present invention comprises the steps of contacting the sample with the PNA probe of claim 1 or 2 to hybridize the PNA probe with the target sequence in the sample; And it provides a method for detecting food poisoning bacteria in a sample comprising the step of detecting the signal generated through the hybridization.

In the following, the method will be described step by step.

The sample may be any sample suspected of containing food poisoning bacteria, preferably a crop suspected of containing food poisoning bacteria.

Crops, in particular, often contain a very small amount of contaminated food poisoning bacteria. Therefore, when preparing a sample as is conventionally known, sensitive detection of food poisoning bacteria is difficult. Thus, the present inventors have confirmed that the recovery of food poisoning bacteria significantly improved by preparing the sample sequentially through the following steps, and as a result, the sensitivity of the food poisoning bacteria detection was improved, resulting in six or more food poisoning bacteria contained in the sample. It was confirmed that all food poisoning bacteria can be clearly detected at once:

Separating food poisoning bacteria by sonication from the crops suspected of containing food poisoning bacteria, enriching the isolated food poisoning bacteria, amplifying the target gene of the expanded food poisoning bacteria, and chemically reacting the amplified genes with the chip. And the final result. In this stage, the DNA chip has a limitation in using several probes at the same time for enrichment. However, due to the high specificity of PNA, it is possible to chemically amplify specific parts of six bacteria with only one ITS amplification. In the diagnostic method using the PNA chip, six bacteria can be diagnosed simultaneously by amplification using two or three PCR probes.

By sequentially preparing the samples in the above order, the present inventors can prevent PCR from being inhibited by some substances secreted from the crop when first increasing the concentration and subsequently separating the bacteria, thereby effectively amplifying the target gene. However, the present invention is not limited thereto.

In addition, the present inventors confirmed that the food poisoning bacteria were most effectively detected after increasing the time for 6 hours, 12 hours, and 48 hours by increasing the time of enrichment for 6 hours. The enrichment time is therefore preferably 4-8 hours, more preferably 5-7 hours, most preferably 5.5-6.5 hours. Enough enrichment is difficult when enrichment is less than 4 hours, and specificity is much inhibited when enrichment is greater than 8 hours. This may be because the proliferation of contaminating bacteria inhibits the proliferation of specific bacteria to be diagnosed, thereby reducing the specific reactions.

Various PCR methods known in the art can be used for the amplification, for example, Hot-start PCR, Nested PCR, Multiplex PCR, Degenerate oligonucleotide primer (DOP) PCR, Quantitative RT-PCR, In-Situ PCR, Micro PCR, or Lab-on a chip PCR may be used, but preferably Nested PCR (Nested polymerase chain reaction) method may be used. When the amplified target gene using Nested PCR, the present inventors confirmed that the recovery rate of food poisoning bacteria significantly improved, and as a result, the sensitivity of food poisoning bacteria detection was improved. In addition, more preferably Asymmetric PCR method can be used, the preferred amount of forward primer: reverse primer is 1: 40-50, more preferably 1: 50.

The target gene is five kinds of food poisoning bacteria, namely Bacillus cereus , Listeria monocytogenes ( Listeria) monocytogenes ), Staphylococcus aureus ), Yersinia enterocolitica , and Salmonella enterica are internal Transcribed Spacer (ITS) regions, and E. coli 0157: H7 is the eae A gene and the per gene .

For amplification of the target gene, primer pairs represented by the nucleotide sequences of SEQ ID NO: 8 and SEQ ID NO: 9 may be used for all five food poisoning bacteria, preferably for amplification of the ITS region, and E. coli 0157: H7). The primer pair consisting of a base pair represented by SEQ ID NO: 10 and SEQ ID NO: 13 and a base pair represented by SEQ ID NO: 10 and SEQ ID NO: 11 for eae A gene amplification can be used. The primer pairs were subjected to cloning and restriction enzyme digestion of appropriate sequences and to phosphoester ester methods such as Narang (1979, Meth, Enzymol. 68: 90-99), diethylphosphoramidite such as Beaucage, etc. Any other well-known methods can be chemically synthesized, including methods (1981, Tetrahedron Lett. 22: 1859-1862), and direct chemical synthesis, such as the solid support method of US Pat. No. 4,458,066. Primers represented by the nucleotide sequence of SEQ ID NO: 8 to 13 may also include a base sequence in which one or more bases are deleted, substituted or added to the base sequence of each primer.

The sample is then contacted with a PNA probe according to the invention to hybridize the PNA probe with the target sequence in the sample.

As used herein, the term "hybridization" refers to the process of combining the PNA probe and the complementary strand of the target gene to form a double-stranded molecule (hybrid).

The PNA probe may use a PNA microarray chip, which is immobilized on a microarray substrate.

Finally, the signal generated through the hybridization is detected. Signal detection is possible using a variety of methods known in the art, for example, a fluorescent signal detection method is used in the case of using fluorescent labeled food poisoning bacteria.

Using the method of detecting food poisoning bacteria using the PNA (Peptide Nucleic Acid) microarray chip and the PNA probe used therein, it is possible to detect 6 kinds of food poisoning bacteria at once in a short time with excellent specificity and sensitivity. It is possible to provide safe crops through.

1 is a table showing the genetic information used for the production of a PNA probe according to the present invention.
2 is an example of sequences used to find bacterial specific ITS partial information.
3 is a photographic result showing evaluation results of candidate probes for selecting an optimal probe.
4 is a view schematically showing the type and position of the probe in the PNA chip manufactured and used in the embodiment of the present invention.
Figure 5 is a result of electrophoresis of amplification results of specific pathogens carried out under the PCR conditions according to the present invention.
6 is a view showing a process for measuring the recovery rate of harmful bacteria contaminated with agricultural products that do not go through the enrichment process.
7 and 8 are the results of electrophoresis of the experiment to determine the lowest detectable concentration by a general PCR detection method.
9 is a schematic diagram showing the enrichment process after bacterial separation according to the present invention.
10 is a PCR result of the sample according to the enrichment time (1-3: 10 ⁴ , 4-6: 10 ² , 7-9: 10).
11 is an evaluation result of the detection limit of the sample according to the enrichment time using the PNA chip according to the present invention.
12 is an electrophoresis result of measuring the detection limit of food poisoning bacteria by performing nested PCR.

Hereinafter, preferred examples and comparative examples are presented to aid in understanding the present invention. However, the following examples are only for illustrating the present invention, and the present invention is not limited thereto.

Example  One. PNA Probe  making

Bacillus cereus (Bacillus cereus ), Listeria monocytogenes ( Listeria) monocytogenes ), Staphylococcus aureus , Yersinia enterocolitica , Salmonella enterica enterica ), and to detect E. coli 0157: H7 PNA probe was designed by examining the total sequencing and ITS portion of the existing available bacteria. PNA probes were first screened with a bacteria-specific part of the ITS portion E. coli 0157: H7 et al. Found no specificity and used other specific genes as probes. Targeted ITS portions and examples are shown in FIGS. 1 and 2, respectively.

Specifically, it was prepared similar to the method of Korean Patent No. 464,261. PNA oligomers were synthesized by solid phase synthesis from functionalized resins with PNA monomers protected with Benzothiazolesulfonyl (Bts) groups. 8- (9H-fluorene-9-ylmethoxycarbonylamino) -3,6-dioxa-octanoic acid was used twice as a spacer at the N-terminus. PNA was attached to the resin and used for the next reaction. The PNA attached to the prepared resin was treated with DMF (dimethylformamide) solution of 1 M piperidine for 20 minutes to remove the N-terminal Fmoc protecting group and washed three times with DMF (process (a)). One equivalent of bis Fmoc monomer was added with one equivalent of HOBt (1-hydroxybenzotriazole), two equivalents of diisopropylcarbodiimide (DIC) and DMF, followed by shaking for one hour, followed by washing three times with DMF (process (b)). DMF containing 5% acetic anhydride and 6% lutidine was added, shaken for 5 minutes at room temperature, and washed three times with DMF (process (c)). The steps (a) to (c) were repeated two to three times and finally the procedure was repeated to remove the Fmoc protecting group. Repeated 2 times with 4 amine groups and 3 repeated with 8 amine groups. The PNA-attached resin was treated with m-cresol / trifluoroacetic acid (TFA) solution (1/4 v / v) for 2 hours to separate the PNA from the resin, treated with ether to precipitate, and purified by HPLC. To prepare a probe containing a multi amine group as shown in Table 1 below.

PNA chips were prepared using these probes, and then high-specificity probes were selected through the selection process for these probes. As a result of excluding probes showing non-specific responses, the yellow probes were selected from the table. Probe screening results are shown in FIG. 3. Through the screening process for the candidate probes over the second stage, the probe with the highest specific reaction singal intensity was selected as the optimal probe without showing a non-specific response. The results were analyzed by confirming the positive probe through SBR analysis of the PNA chip image and the ratio of the background to the signal intensity per probe, and then identifying the target strain.

As shown in the evaluation results of Table 1 and 3, PNA probe (AACTATCTCTCATATATAAATGTA), Listeria monocyto, consisting of the nucleotide sequence of SEQ ID NO: 1 specifically binding to Bacillus cereus through various evaluation experiments Listeria monocytogenes ), a PNA probe consisting of the nucleotide sequence of SEQ ID NO: 2 that specifically binds (GAAATACAAATAATCATATCC), and a PNA probe consisting of the nucleotide sequence of SEQ ID NO: 3 that specifically binds to Staphylococcus aureus (TCACAAGATTAATAACGCCG) ), Yersinia PNA probe consisting of the nucleotide sequence of SEQ ID NO: 4 specifically binding to enterocolitica ) (ACCTCAGATACGCATTGC), PNA probe consisting of the nucleotide sequence of SEQ ID NO: 5 specifically binding to Salmonella enterica (GAAGCGTACTTTGCAGTG, table above) Not shown in 1), and a PNA probe (TGTCATCAAGATCTGAACTT, eaeA, not shown in Table 1 above) and SEQ ID NO: consisting of the nucleotide sequence of SEQ ID NO: 6 that specifically binds to E. coli 0157: H7. A PNA probe (GCACCCTATAGCTGAG, per, not shown in Table 1) consisting of the nucleotide sequence of 7 was invented.

Example  2. PNA  Chip production

One) PNA chip  design

The purified PNA oligomers of the selected SEQ ID NOS: 1 to 7 of the present invention were diluted to 50 mM in spotting buffer and spotted in a pin manner on a glass plate functionalized with an epoxy group, and left to stand at room temperature for 4 hours at constant humidity. It was. After that, it was added to DMF and ultrasonically cleaned for 15 minutes. Was added to DMF to which 0.1 M succinic anhydride was added and the unreacted amine group was removed at 40 ° C for 2 hours. After the reaction, the reaction solution was removed and ultrasonically washed for 15 minutes in the order of DMF and third distilled water. Then, 100 mM Tris buffer (Tris-HCl) containing 0.1 M ethanolamine was added to inactivate the remaining epoxy groups on the solid surface. The glass substrate was repeatedly washed twice with 15 minutes of tertiary distilled water for 5 minutes, then treated with boiling water for 5 minutes, washed with tertiary distilled water for 5 minutes and dried. Then, the prepared silicon reactor was put on a glass plate so that 100 μl of the hybridization solution could be contained. 4 schematically illustrates the types and positions of probes located in the PNA chip.

2) primer  design

Sikjungdokgyun PCR primers are Bacillus cereus (Bacillus cereus ), Listeria monocytogenes ( Listeria) monocytogenes ), Staphylococcus aureus ), Yersinia enterocolitica ), and Salmonella enterica used a primer site capable of detecting the Internal Transcribed Spacer (ITS) region, and E. coli 0157: H7) detected the eae A gene and the per gene. Primer sites were used. These primers have the base sequence as shown in Table 2 below.

Target Primer Primer sequence (5 '→ 3') PCR product size (bp) ITS 16S-1387F GCCTTGTACACWCCGCCC
(SEQ ID NO: 8) 500 to 900 23S-200R ACTTAGATGTTTCAGTTC
(SEQ ID NO: 9) eaeA
(only for E. coli O157: H7) eaeA-F CAATTTTTCAGGGAATAACATTG
(SEQ ID NO: 10) 120 eaeA-R AAAGTTCAGATCTTGATGACATTG
(SEQ ID NO: 11) per
(only for E. coli O157: H7) per-F CGATGCCAATGTACTCGGAAAAATA
(SEQ ID NO: 12) 120 per-R TTCGATAGGCTGGGGAAACTAGGTA
(SEQ ID NO: 13)

As a result of increasing the PCR annealing temperature by 2 ℃ between 54 and 64 ℃ to find the appropriate PCR condition, it was confirmed that the most efficient PCR was possible when annealing at 60 ℃. Other PCR conditions were established, shown in Table 3 below.

In addition, as a result of comparing the amount of the forward primer amount: the reverse primer amount which shows the best effect when amplifying the chip signal by PCR through Asymmetric PCR, the ratio is 1:50 among 1: 1, 1:10, 1:50. In the case of it was confirmed that the best PCR results. The results are shown in Table 3 below.

The electrophoresis results performed on the sample strains of Table 4 below with the above-mentioned experimental conditions are shown in FIG. 5.

Lane Strain Lane Strain M 100 bp ladder One 7-1 B. cereus 13 V. parahaemolyticus 2 7-2 B. cereus 14 Y. enterocolitica-1 (ATCC 9610) 3 4-1 L. monocytogenes 15 Y. enterocolitica-2 (ATCC 55075) 4 4-2 L. monocytogenes 16 3-1 Salmonella enterica 5 4-3 L. monocytogenes 17 3-2 Salmonella enterica 6 L. monocytogense (LMC ScottA) 18 3-3 Salmonella enterica 7 L. monocytogense (LO 28) 19 E. coli O157: H7 8 6-1 S. aureus 20 2-1 Enterobactersakazakii 9 6-3 S. aureus 21 5-1 Shigellasonnei 10 6-11 S. aureus 22 5-2 Shigellafleneri 11 C. perfringens H3 23 5-3 Shigellafleneri 12 Clostridium perfringens N Negative control

Experimental Example  1. Recovery of bacteria contaminated with agricultural products

When recovering the harmful bacteria contaminated with agricultural products, the recovery rate of harmful bacteria in the case of not undergoing the enrichment process was investigated according to the method of FIG. 6, and the results are shown in Table 5 below.

PCR was performed to determine the detection limit (the annealing Tm was 50 ° C.), and the results are shown in FIGS. 7 and 8.

As shown in Figures 7 and 8, the general PCR method was confirmed that only at least about 10,000 bacteria can be detected.

Experimental Example  2. How to increase bacterial recovery rate Enrichment  process)

(1) bacterial isolation sonication ) Enrichment

In order to be detected even if there are one or two harmful bacteria, the enrichment process was added, and among the various methods, the enrichment process was best performed by separating germs from vegetables.

The process of enrichment and separation of bacteria that might be contaminated with agricultural products was divided into two methods: 1) separation after line enrichment and 2) enrichment after line separation (see Figure 9). Was much better. If it is enriched before separation, it is estimated that foreign substances from plants melt together and act as inhibitors in PCR amplification process.

(2) bacteria Enrichment  time

Escherichia coli 0157: H7, Salmonella In contrast to the enrichment time targets typhimurium, Yersinia enterocolitica and played the PCR results, all the bacteria that were the most outstanding sensitivity when cultured for 6 hours. In addition, it was found that after 6 hours of enrichment, only 10 or 100 or more bacteria in the vegetables were detected.

PCR results of the sample after 6 hours enrichment are shown in FIG. 10, and the detection results using the PNA chip according to the present invention are shown in FIG. 11.

Experimental Example  3. Bacterial recovery rate increase method ( nested PCR )

As a result of amplifying the target gene using nested PCR in order to increase the detection sensitivity, it was confirmed that the sensitivity was significantly improved. The results are shown in Fig. Finally, the degree of detection was evaluated by hybridization with PNA chip. Using Nested PCR, 100 bacteria were able to diagnose harmful bacteria with PNA chips.

Attach an electronic file to a sequence list

Claims (13)

A PNA probe consisting of a nucleotide sequence of SEQ ID NO: 1 capable of specifically binding to Bacillus cereus; A PNA probe consisting of the nucleotide sequence of SEQ ID NO: 2 capable of specifically binding to Listeria monocytogenes; A PNA probe consisting of the nucleotide sequence of SEQ ID NO: 3 capable of specifically binding to Staphylococcus aureus; A PNA probe consisting of the nucleotide sequence of SEQ ID NO: 4 capable of specifically binding to Yersinia enterocolitica; And a PNA probe comprising a nucleotide sequence of SEQ ID NO: 5 capable of specifically binding to Salmonella enterica. The food poisoning bacterium detection according to claim 1, further comprising a PNA probe which is capable of specifically binding to E. coli 0157: H7 consisting of the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 7. PNA probe set for use. A PNA microarray chip for detecting food poisoning bacteria, comprising the PNA probe set for detecting food poisoning bacteria according to claim 1. delete Contacting the sample with the PNA probe set for detecting food poisoning bacteria according to claim 1 or 2 to hybridize the PNA probe set for detecting food poisoning bacteria with the target sequence in the sample; And
Detecting a signal occurring through the hybridization,
Method for detecting food poisoning bacteria in a sample. The method of claim 5, wherein the food poisoning bacteria detection PNA probe set is immobilized on a microarray substrate. The method of claim 5, wherein the sample is prepared by sequentially performing the following steps:
Separating food poisoning bacteria by sonication from the crops suspected of containing food poisoning bacteria, enriching the isolated food poisoning bacteria, and amplifying a target gene of the increased food poisoning bacteria. The method of claim 7, wherein the enrichment is performed for 4-8 hours. The method of claim 7, wherein the food poisoning bacteria in the sample is characterized by performing nested polymerase chain reaction (PCR) for the amplification. According to claim 7, Bacillus cereus (Listeria monocytogenes), Staphylococcus aureus (Yersinia enterocolitica), and Salmonella entero of the food poisoning bacteria Method for detecting food poisoning bacteria in a sample characterized by the use of a primer pair consisting of the nucleotide sequence represented by SEQ ID NO: 8 and SEQ ID NO: 9 for amplification of the internal Transcribed Spacer (ITS) region of Salmonella enterica. The method of claim 7, wherein the amount of the forward primer: reverse primer used in the amplification is 1:50. The food poisoning bacterium in a sample according to claim 7, wherein a primer pair consisting of the nucleotide sequences represented by SEQ ID NO: 10 and SEQ ID NO: 11 is used for amplifying the E. coli 0157: H7 eae A gene. How to detect. According to claim 7, wherein the food poisoning bacteria in the sample characterized in that the primer pair consisting of the nucleotide sequence represented by SEQ ID NO: 12 and SEQ ID NO: 13 for the amplification of E. coli 0157: H7 per gene How to detect.

Images