KR101300879B1 - A Composition for Preventing Bird Flu Comprising Interferon gene - Google Patents

Abstract

The present invention is a composition for preventing avian influenza comprising a polynucleotide encoding an interferon α, a polynucleotide encoding an interferon β, or a vector comprising the polynucleotides, which can inhibit intracellular proliferation of avian influenza virus A bird flu prevention DNA vaccine comprising a polynucleotide or a vector and a method for preventing avian influenza comprising administering each polynucleotide, vector, composition or DNA vaccine to an individual. By using the method of the present invention, it is possible to suppress necrosis of cells caused by avian influenza virus and proliferation of avian influenza virus, and thus will be widely used for the prevention of avian influenza caused by avian influenza virus. .

Description

A composition for Preventing Bird Flu Comprising Interferon gene

The present invention relates to a composition for preventing avian influenza comprising an interferon gene, and more specifically, the present invention relates to a polynucleotide encoding an interferon α that can inhibit intracellular proliferation of avian influenza virus, a poly encoding an interferon β. Avian flu prevention composition comprising a nucleotide or a vector comprising each polynucleotide, a bird flu prevention DNA vaccine comprising each polynucleotide or vector, and administering each polynucleotide, vector, composition or DNA vaccine to an individual It relates to a method for preventing bird flu comprising the step of.

Influenza virus is an RNA virus belonging to the family Orthomyxoviridae, and serotypes are divided into three types: A, B or C. Among them, type A is known to be infected by humans, horses, pigs, other mammals, and various kinds of poultry and wild birds, also known as Avian Influenza (Selmons et al., Avian Dis., 18 (1) : 119-124 (1974); Turek R et al., Acta Virol., 27 (6): 523-527 (1983); Webster RG et al., Microbiol Rev., 56 (1): 152-179 ( 1992). The avian influenza is spread quickly and pathogenic, and is infected with various kinds of birds, such as chickens, turkeys, wild birds, mainly acute viral infectious diseases that damage chickens and turkeys. In particular, duck is a disease that does not show any clinical symptoms even if it is infected. Among them, Highly Pathogenic Avian Influenza (HPAI) is required to be reported by the International Water Agency (OIE). Since the first case of human infection caused by avian influenza virus has been reported, it is a disease that is very important in public health.

Serotypes of avian influenza viruses are classified according to the two types of proteins on the surface of the virus, biological glutinin (Hemagglutinin (HA) and neuraminidase (NA), and 144 types (HA protein 16) Species and 9 NA proteins). The HA is responsible for attaching the virus to somatic cells, and NA is known to allow the virus to penetrate into cells (Alexander DJ, Vet. Microbiol., 74 (1-2): 3-13 (2000)). A global epidemiological study of influenza infection in wild birds confirms that all existing 16 HA and 9 NA influenza viruses are infected in wild birds (Selmons et al., Avian Dis. , 18 (1): 119-124 (1974)). Avian influenza virus, classified as type A, is a common infectious disease virus, a non-pathogenic avian influenza that causes mild respiratory symptoms when infected with chickens, and is low pathogenic, causing death and scattering around 1-30%. Low pathogenic avian influenza (LPAI) and high pathogenic avian influenza (HPAI) with a high mortality rate of more than 95% and also called "bird flu" (Alexander DJ, Vet. Microbiol., 74 (1-2): 3-13 (2000)).

High pathogenic avian influenza (HPAI) has been confirmed worldwide since 1980, including the United States, Australia, Pakistan or Hong Kong. In particular, in December 2003, serotype A / H5N1 highly pathogenic avian influenza occurred in Southeast Asia and the Far East Asia, including Vietnam, Japan or Thailand, in 2004. In particular, the highly pathogenic avian influenza in Vietnam and Thailand has been confirmed to be a mutant avian influenza (mutant A / H5N1 HPAI) virus that can infect a human body when contacted with an infected algae, unlike the traditional highly pathogenic avian influenza which does not infect the human body. Song CS et al., Korean J. Poult. Sci., 31 (2): 129-136 (2004).

Influenza viruses infect the respiratory system, causing systemic symptoms, periodic changes in appearance, and not killing the host, but moving to another host before the host dies. Although the vaccine has been developed against it, The magazine is not available yet, and the fundamental virus treatment is not done yet. Meanwhile, amantadine and rimantadine are substances that inhibit the function of M2 ion channel protein of influenza virus and are representative antiviral agents that inhibit the growth of influenza virus in vivo. However, these two antiviral agents have been found to have the disadvantage that the emergence of a mutant virus that does not affect the ion channel function of the influenza virus M2 protein is very easy. Zanamivir and oseltamivir (Tamiflu), which are developed to compensate for these disadvantages, are substances that inhibit the function of the neuraminidase protein of influenza virus and inhibit the proliferation of influenza virus in vivo. Representative antiviral agents. However, zanamivir has the disadvantage of inhalation and intravenous administration, while oseltamivir can be administered orally, but it has been pointed out as a disadvantage due to side effects such as recent reports of the emergence of resistant virus and vomiting and dizziness upon oral administration (Ward P et. al., J. antimicrob. Chemother., 55: 15-121 (2005)).

On the other hand, the Mx protein is a monomeric GTPase, which inhibits viral replication, and thus is generally known to have an antiviral effect (Samuel, Virology 183: 1-11 (1991)). This antiviral effect of Mx has been demonstrated in negative strand RNA viruses (eg, orthomyxovirus), but the Mx protein itself is expressed in all cells with type 1 interferon (IFN) receptors. Genes encoding the Mx protein are known to induce their expression in response to elevated levels of interferon (IFN) in the body induced in response to viral infection (Bazzigher, L., et al., Virology, 186: 154-160, 1992). Since expression of Mx protein is dependent on the level of IFN in the body, the Mx protein is expressed equally in acute and chronic viral infections that increase the level of IFN in the body (Fernandez, M., et al., J. Infectious Diseases, 180: 262-267, 1999).

Under these backgrounds, the present inventors have earnestly studied the relationship between interferon and avian influenza infection, and the interferon-expressing cells are resistant to avian influenza virus infection, thereby preventing cell death by avian influenza virus infection. As well as being able to inhibit the proliferation of avian influenza virus in infected cells, the present invention was completed.

It is an object of the present invention to provide a composition for preventing avian influenza comprising an interferon α or β gene capable of inhibiting the proliferation of avian influenza virus in a cell.

Another object of the present invention is to provide a DNA vaccine comprising an interferon α or β gene capable of inhibiting the proliferation of avian influenza virus in a cell.

Another object of the present invention is to provide a method for preventing avian influenza by administering the interferon α or β gene, the composition or the DNA vaccine to a subject.

In order to achieve the above object, according to an embodiment of the present invention, the present invention is a polynucleotide encoding an interferon α, a polynucleotide encoding an interferon β or a vector containing each polynucleotide as an active ingredient, It provides a pharmaceutical composition for preventing bird flu, including a pharmaceutically acceptable carrier.

The inventors note that the expression of various antiviral proteins such as Mx, RNase L, PKR, OAS, etc., which are known to exhibit antiviral effects, are induced by interferon, and when overexpressing the interferon gene in cells, avian influenza virus It is expected that resistance to infection will be enhanced.

In order to confirm this, the present inventors based on sequence information listed on the gene bank through NCBI (http://www.ncbi.nlm.nih.gov/), the interferon α and β of chickens (interferon α / β, IFN -α / β) gene sequence information (chIFN-α: X92476 / chIFN-β: NM 001024836), based on the recombinant IFN-α gene (SEQ ID NO: 1) and IFN-β gene (SEQ ID NO: 2) Were obtained respectively. As a result of verifying the antiviral activity of the obtained recombinant IFN-α / β gene, in the cells into which the recombinant IFN-α / β gene was introduced, intracellular Mx, RNase L, PKR and OAS known as antiviral proteins were detected. As expression levels increased and resistance to various avian influenza viruses such as H9N2 and H1N1, as well as paramyxoviruses that cause disease in humans such as NDV, was found to increase the resistance of recombinant IFN-α / β Since genes can be resistant to most viral infections, they have been shown to have a universal preventive effect against viral diseases.

In addition, the proliferation of NDV, the gene of recombinant IFN-α shows about 50% inhibition rate, and the recombinant IFN-β gene showed about 70% inhibition rate.

According to another embodiment of the present invention, the present invention comprises a polynucleotide encoding an interferon α, a polynucleotide encoding an interferon β or a vector comprising each of the polynucleotides as an active ingredient, and includes a pharmaceutically acceptable carrier. It provides a DNA vaccine for preventing bird flu.

As used herein, the term "DNA vaccine" refers to a vaccine in the form of a plasmid that encodes a specific antigen and contains a gene as a vaccine different from the existing protein vaccine. The DNA vaccine is introduced into various cells including dendritic cells in the vaccinated body upon immunization, inducing transcription of antigen genes and production of antigens, and presenting antigens to B cells and T cells to induce humoral and cellular immune responses. Therefore, it is possible to induce continuous antigen expression in the body without major adverse effects on the human body, more effective in inducing cellular immune response, easy to manufacture and produce, and stable at room temperature, so that stable storage and distribution are easy. There is this.

According to another embodiment of the invention, the invention provides a polynucleotide encoding interferon α, a polynucleotide encoding interferon β, a vector comprising said polynucleotide, said polynucleotide or composition comprising said vector, or said poly Provided is a method for preventing avian flu, comprising administering a DNA vaccine comprising nucleotides or vectors.

As used herein, the term "prevention" refers to any action of inhibiting or delaying the onset of a disease caused by avian influenza virus infection by administration of a composition comprising the gene encoding the IFN-α / β.

As used herein, the term "individual" refers to poultry such as chickens and ducks having diseases caused by direct and indirect causes due to avian influenza virus infection. By administering the gene, composition or DNA vaccine of the present invention comprising the nucleic acid to the subject, it is possible to effectively prevent diseases such as bird flu caused by the avian influenza virus infection described above. The composition of the present invention may be administered in parallel with an existing avian influenza virus infection disease prevention agent.

As used herein, the term "administration" means introducing a predetermined substance into an individual in any suitable manner, and the route of administration of the composition of the present invention is oral or parenteral via any general route as long as it can reach the target tissue. May be administered. In addition, the composition may be administered by any device capable of transferring the active agent to the target cell. Preferred modes of administration are subcutaneous, intradermal, intramuscular, intravenous, and the like.

The composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level refers to the sex, age, severity, activity of the drug of the individual. , Drug sensitivity, time of administration, route of administration and rate of release, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical arts. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. It may be single or multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art. The effective amount may vary depending on the route of treatment, the use of excipients and the possibility of use with other agents, as will be appreciated by those skilled in the art, but in general the effective dose of the composition of the present invention is 0.01 to 0.2 mg at a time per adult / Kg is preferred and can be administered one or more times at intervals of two to four weeks.

The composition or DNA vaccine of the present invention may be administered alone with the gene encoding IFN-α / β or co-administered with other adjuvants or cytokines known in the art. Cytokines that can stimulate an immune response that can be coadministered include, for example, granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (GCSF), IL-1, IL-2, IL-3, IL -4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, TNF-α, INF-γ, Flt3 ligand, and the like.

Compositions or DNA vaccines of the present invention may be prepared using agents that promote the influx of genes encoding IFN-α / β, such as liposomes, or lipophilic one of many sterols, including cholesterol, cholate and deoxycholic acid. It can also be combined with a carrier. It may also be conjugated to a peptide that is taken up by the cell. Examples of useful peptides include peptide hormones, antigens or antibodies and peptide toxins.

The composition or DNA vaccine of the present invention may be administered with a pharmaceutically acceptable carrier, and upon oral administration, a binder, a suspending agent, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a perfume, etc. In the case of topical administration, bases, excipients, lubricants, preservatives and the like can be used. Injections include non-aqueous solvents such as aqueous solvents such as physiological saline solution and ring gel solution, vegetable oils, higher fatty acid esters (e.g., oleic acid ethyl), and alcohols (e.g., ethanol, benzyl alcohol, propylene glycol, glycerin, etc.). Stabilizers (e.g. ascorbic acid, sodium bisulfite, sodium pyrosulfite, BHA, tocopherol, EDTA, etc.), emulsifiers, buffers for pH control, to prevent microbial development Preservatives such as mercury nitrate, chimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, and the like. The pharmaceutical compositions of the present invention can be prepared in a variety of formulations. For example, in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elesir, suspensions, syrups, wafers, etc., and in the case of injections, may be prepared in unit dosage ampoules or multiple dosage forms.

By using the method of the present invention, it is possible to suppress the proliferation of avian influenza virus due to various antiviral proteins such as Mx, RNase L, PKR, OAS, etc., which are induced by interferon, and thus, avian birds caused by avian influenza virus. It can be widely used to prevent the flu.

Figure 1 is an electrophoresis picture showing the extraction results of the chIFN-α / β gene.
Figure 2 is an electrophoresis picture showing the size of the extracted chIFN-α / β gene.
3 is a diagram showing the nucleotide sequence of the extracted chIFN-α / β gene.
Figure 4 is an electrophoresis picture showing the cloning results.
Figure 5a is a diagram showing the base sequence of the cloned insert chIFN-α.
Figure 5b is a diagram showing the nucleotide sequence of the cloned insert chIFN-β.
Figure 6 is an electrophoresis picture showing the result of the metal affinity chromatography using Ni-NTA resin.
Figure 7 is a photograph showing the expression and expression of Mx protein through TR-PCR.
8 is a graph showing the results of assaying antiviral efficacy by rchIFN-α.
Figure 9 is an electrophoresis picture showing the results of the production of anti-chIFN-α / β polyclonal antibody.
10 is a photograph showing the results of detecting the chIFN-α / β protein using the produced anti-chIFN-α / β polyclonal antibody.
11 is an electrophoresis picture showing the extraction result of the chIFN-α / β gene.
Figure 12 is an electrophoresis picture showing the size of the extracted chIFN-α / β gene.
Figure 13a is a diagram showing the nucleotide sequence of the cloned insert chIFN-α.
Figure 13b is a diagram showing the nucleotide sequence of the cloned insert chIFN-β.
14 is an electrophoresis picture showing the cloning result.
15 is a diagram showing the nucleotide sequence of the cloned insert hIFN-α / β gene.
16 is a photograph showing the results obtained by introducing plasmid vectors of pcDNA 3.1a chIFN-α and β into HeLa cells and confirmed by immunofluorescence analysis.
Figure 17 is a photograph showing the results confirmed by Western blot after introducing the plasmid vectors of pcDNA 3.1a chIFN-α, β into EK-293T cells.
Figure 18 shows the nucleotide sequence of each primer used in real time RT-PCR.
FIG. 19 is a graph showing whether each DNA plasmid of pcDNA 3.1a chIFN-α and β actually expresses functional type I IFNs, binds to IFNAR, and induces subfactors by a signaling pathway.
20 is a photograph showing the result of confirming that Mx, an antiviral protein, is strongly induced by IFN overexpression, in particular chIFN-β, and all types of viruses are inhibited.
21 is a photograph showing that the expression rate of viral protein decreases in inverse proportion to the increase in the expression rate of Mx protein by chIFN-β.
Figure 22 shows the nucleotide sequence of each primer used in real time RT-PCR.
23 is a graph showing the expression of each viral gene is inhibited by overexpression of IFN.
Figure 24 is a photograph, histogram and graph showing the result of confirming the inhibition pattern by IFN by measuring the ratio of GFP positive cells of the total cells through flow cytometry.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1: using bacterial strains IFN -α / β production and purification, complex antibody production

Example  1-1: of chicken IFN -α / β gene Cloning

Sequence information of interferon α and β of chicken (interferon α / β, IFN-α / β) based on sequence information listed on gene bank through NCBI (http://www.ncbi.nlm.nih.gov/) It was confirmed (chIFN-α: X92476 / chIFN-β: NM 001024836). To express each of the identified IFN α / β from the bacterial strain to produce a recombinant protein primers were designed for the expression vector pET 32a vector. The primers designed through this are:

chIFN-α:

sense 5'- ccgccggaattcgctgtgcctgcaagccc -3 '(SEQ ID NO: 3)

antisense 5'- ccgccgaagcttagtgcgcgtgttgcctgtg -3 '(SEQ ID NO: 4)

chIFN-β:

sense 5'- ccgccgggatccactgcaaaccatcagtctcc -3 '(SEQ ID NO: 5)

antisense 5'- ccgccgaagcttctgggtgttgagacgtttgg -3 '(SEQ ID NO: 6)

Each gene fragment was obtained by PCR using genomic DNA and a PCR kit (pre-Mix PCR kit, Ependorf, Germany) from chickens donated from the National Institute of Animal Science, which used each designed primer, template. Each of the obtained fragments was subjected to agarose gel electrophoresis, and each band corresponding to the expected size (chIFN-α: 588 bp, chIFN-β: 618bp) was extracted using an extraction kit (Corebio gel extraction kit). (FIG. 1). Each of the extracted fragments was cloned into a pGEM T-EASY vector (Promega, USA), and clones into which the fragments were inserted were selected. At this time, the selection of the clone is inserted into the plasmid obtained from each clone was cut with restriction enzyme (EcoRI), and subjected to agarose gel electrophoresis to confirm the size of the band (Fig. 2), the band of the appropriate size After extraction, it was performed by checking its nucleotide sequence (FIG. 3).

For each pGEM clone whose insert was identified by sequencing, the insert was isolated by cleavage with a primer-based restriction enzyme (pET chIFN-α: EcoRI, Hind III / pET chIFN-β: Bam HI, Hind III). The isolated insert was extracted and subcloned into the pET 32a vector (Novagen, USA) using a T4 ligation kit (TAKARA, Japen). At this time, the plasmid was separated from the individual clones in order to separate the clone into which the correct size insert was inserted into the vector, treated with restriction enzymes, and applied to agarose gel electrophoresis (FIG. 4). It was once again confirmed that the correct insert was introduced by determining the sequence of the insert for clones into which the correct size of insert was introduced (FIG. 5).

Example  1-2: BL21 ( DE3 ) Bakteray  Expression Induction and Purification in Strains

Each of the obtained pET-chIFNα and pET-chIFNβ DNA plasmids was isolated from the cloning strain DH5α and introduced into the BL21 (DE3) strain, a recombinant protein expression strain, to obtain a transformant. Afterwards, clones with the best expression rate were selected by small-scale induction conditions for each clone, and the expressions were induced using IPTG by applying the above conditions in large-scale cultivation (chIFN-). α: OD600 = 0.6 / IPTG = 0.5 mM / 30 ° C / 4h) (chIFN-β: OD600 = 1.0 / IPTG = 2mM / 37 ° C / 2h).

Metal affinity chromatography with Ni-NTA resin was performed using a 6X His tag fused to the recombinant protein via the pET-32a vector. For this purpose, IPTG expression was induced at an appropriate OD value after 2 L culture, and cells were obtained by centrifugation at 450,000 g for 15 minutes, and then cells were pulverized by ultrasound (35% pulse 1 minute), and centrifuged at 12,000 rpm for 30 minutes. The liquid component and the solid component were separated, the liquid component was immediately purified, the solid component was dialyzed (Urea 6M-3M-2M-1M-0M), and then refolded to obtain a recombinant protein. The obtained recombinant protein was bound to Ni-NTA resin, washed with 40-100 mM imidazole wash buffer, and eluted with 1 M imidazole elution buffer (FIG. 6).

Example  1-3: Biological Activity Assay

The treatment of type I IFN in chickens is known to activate the ISRE gene by JAK-STAT signaling pathway, leading to the expression of the antiviral protein Mx (Schumacher B et al., 1994). The biological activity of the recombinant IFN was confirmed by the expression level of Mx protein in chicken embryonic fibroblast (CEF) cell line DF-1.

Specifically, the DF-1 cell line was inoculated at 1.5 x 10 ⁶ cells / well and incubated for 24 hours, and then the recombinant IFN produced at various concentrations (100 ng / ml, 500 ng / ml, 1 ug / ml, 10 μg / ml), and cultured at 5% CO ₂ and 37 ° C. for 24 hours, and then compared the expression inducing ability of Mx protein. In other words, RNA was isolated from IFN-treated cells using TRIZOL reagent (Promega, USA), DNase (Promega, USA) was treated at 37 ° C. for 1 hour, and then DNase inhibitor (Promega, USA) was treated with DNase. CDNA was synthesized at 37 ° C. for 1 hour using random hexamer (Promega, USA) and M-MLV reverse transcriptase (SUPERBIO, Korea). Using the synthesized cDNA as a template, the expression of Mx protein was verified by PCR using Top taq DNA polymerase (CoreBio, Korea), 20 pmol sense primer and 20 pmol antisense primer (FIG. 7A).

sense: 5'-ACTGACTGACAGAAAGCCTGAGCA-3 '(SEQ ID NO: 7)

antisense: 5'-CAATTGCAGGCAACATCAGGTCGT-3 '(SEQ ID NO: 8)

The cells expressing the Mx protein were lysed with RIPA buffer (150 mM NaCl, 1% NP40, 0.5% deoxycholic acid, 50 mM Tris-HCl pH8.0, 0.2 mM PMSF, protease inhibitor cocktail), and were treated at 13,200 rpm and 4 ° C. After centrifugation under conditions for 10 minutes to obtain a supernatant, it was subjected to SDS-PAGE, and subjected to antibody 1 (anti-chMx 1: 5,000, anti-β actin 1: 10,000) and antibody 2 (anti-rabbit IgG HRP conjugated 1: 5,000, anti-mouse IgG HRP conjugated 1: 5000) and the Western blot was induced by fluorescence reaction with ECL solution to measure the expression level of Mx protein, and then compared with each other (Fig. 7B) .

Example  1-4: Purified from Bacteria type  I IFN of Antiviral  Efficacy test

For type I IFN purified from bacteria, their antiviral potency was assayed using IFN-α for which biological activity was verified. That is, the recombinant IFN-α (rchIFN-α) purified on CEF DF-1 cells was treated for 24 hours, NDV-GFP recombinant virus expressing GFP upon infection was introduced for 24 hours, and then flow cytometry By analyzing the GFP signal, the antiviral efficacy by rchIFN-α inhibited nearly 60% of GFP from 4.24-> 1.61 (Fig. 8).

Example  1-5: Polyclonal antibody  production

In the case of rchIFN-α, biological activity and antiviral potency were assayed, but in the case of recombinant IFN-β (rchIFN-β), biological activity was not confirmed. However, in the case of B-cell epitopes for antibody production, only amino acid sequences can be maintained regardless of biological activity, thereby producing polyclonal antibodies through rabbit immunization for each purified recombinant protein (FIG. 9).

Using the sera obtained through immunization of rabbits, each chIFN-α and β expressed in animal cell line HEK-293T cells by transducing the mammalian expression vector pcDNA vector to show whether it is active against chicken type I IFN. Detection was via Western blot for total cell lysate.

When the antiserum was directly used for western blot, the background value was high, so it was difficult to identify specific signals for anti-IFNβ antiserum. For this reason, antiserum was purified by affinity chromatography for IgG to increase the specificity of the antibody by improving the content of the antibody in the serum to confirm the specific signal in the Western blot (Fig. 10).

Example  2: Animal cell line  Of used chicken IFN -α, β overexpression and Antiviral  Efficacy Verification

Example  2-1: of chicken IFN -α, β gene Cloning

Example  2-1-1: primer  design

Based on the sequence information listed on the GenBank (chIFN-α: X92476 / chIFN-β: NM 001024836), in order to produce recombinant protein by expressing chicken type I IFN genes from bacterial strains for cloning into mammalian expression vectors A primer set was designed for the expression vector pET 32a vector.

chIFN-α:

sense 5'- aagcttggcggcaccatggctgtgcctgcaagcc-3 '(SEQ ID NO: 9)

antisense 5'- gaattcatcgggagtgcgcgtgtt-3 '(SEQ ID NO: 10)

chIFN-β:

sense 5'-aagcttgccgccaccatgactgcaaaccatcagtcc-3 '(SEQ ID NO: 11)

antisense 5'-ctcgagctgggtgttgagacgtttg-3 '(SEQ ID NO: 12)

After designing each primer, PCR was performed using each constructed pET-chIFNα, β DNA as a template, and its product was subjected to agarose gel electrophoresis to predict the size (chIFN-α: 602 bp). , chIFN-β: 630bp) was extracted using the Corebio gel extraction kit (Fig. 11). The extracted DNA was TA cloned into a pGEM T-EASY vector (Promega, USA), and the cloned PCR product was inserted through selection. At this time, in order to separate the clones into which the correct cookie insert was inserted into the vector, the plasmids obtained from the individual clones were cut with EcoRI and the size of the cut sections was confirmed by agarose electrophoresis (FIG. 12). The sequence of the insert was determined to again confirm the correct size of the insert (FIGS. 13A and 13B).

Inserts were isolated by digesting each of the pGEM clones identified with inserts (pcDNA chIFN-α: Hind III, EcoRI / pcDNA chIFN-β: Hind III, Xho I). The isolated insert was subcloned into a pcDNA 3.1a vector (Invitrogen, USA) using a T4 ligation kit (TAKARA, Japen) and a clone into which the insert was introduced was selected through selection. At this time, each clone was digested with restriction enzymes in order to confirm that an insert of the correct size was introduced into the vector, and this was subjected to agarose electrophoresis (FIG. 14). The sequence of the insert was determined to again confirm the correct size of insert (FIG. 15).

Example  2-2: Cloned DNA Constructive  Expression test

Example  2-2-1: HeLa  To the cell pcDNA  3.1a chIFN introducing plasmid vectors of -α and β, respectively Immunofluorescence Assay  Check through

2 μg of DNA was introduced into HeLa cells 1.5 × 10 ⁵ cells using Viva magic reagent (Vivagen, Korea) for 48 hours. Thereafter, it was fixed at room temperature for 30 minutes using 2% formalin and blocked using 10% goat serum. The primary antibody was treated by diluting 1: 2,000 anti-His Ab in 3% goat serum, and detected by confocal microscopy using goat's IgG FITC-conjugated anti-mouse antibody (Molecular probe, US). His tagged signals of chIFN-α and β were confirmed by the prepared pcDNA 3.1a vector, thereby verifying that they were expressed in the cytoplasm of HeLa cells (FIG. 16).

Example  2-2-2: HEK On -293T cells pcDNA  3.1a chIFN After introducing the plasmid vectors of -α and β, Western Blot  Check through analysis

6 μg of DNA was introduced into CaK ₂ and HEPES buffered saline (HBS) in 5.0 × 10 ⁵ cells of HEK-293T cells. After 48 hours, the cells were obtained, and 30 ° C at 4 ° C using RIPA buffer (150 mM NaCl, 1% NP40, 0.5% deoxycholic acid, 50 mM Tris-HCl pH8.0, 0.2 mM PMSF, protease inhibitor cocktail) Dissolved for 1 min, centrifuged for 10 min under conditions of 13,200 rpm and 4 ° C. to obtain supernatant, which was subjected to SDS-PAGE, followed by primary antibody (anti-His 1: 5,000, anti-β actin 1 : 10,000) and a second antibody (anti-mouse IgG HRP conjugated 1: 5,000) and subjected to Western blot fluorescence reaction with ECL solution to signal the chIFN-α, β His tagged by pcDNA 3.1a vector It was confirmed that it was properly expressed by confirming (Fig. 17).

Example  2-3: Biological Activity Assay

The constructed DNA plasmids of pcDNA 3.1a chIFN-α and β each expressed functional type I IFNs to bind to IFNAR and to induce subfactors by signaling pathways.

10-day-old fertilized eggs were received from the National Institute of Animal Science, and primary trachea epithelial cells (TECs) were separated from each other using a Percoll gradient method, and cultured under conditions of 37 ° C. and 5% CO ₂ for 4 days. Then, 2 μg of DNA was introduced using a Viva magic reagent, RNA was separated from the cells introduced at each time using a ribospin kit (ISS, Korea), and the rendom hexamer and M-MLV reverse transcription were used. CDNA was synthesized from RNA. At this time, the base sequence of the primer used is as follows (Table 1).

Base sequence of each primer used in real time RT-PCR Gene name Genebank Access Number Sequence (F: Forward, R: Reverse) SEQ ID NO: chIFNα X92476 F: TCCAAGACAACGATTACAGCGCCT
R: TGTTGCCTGTGAGGTTGTGGATGT 13
14 chIFNβ NM_001024836 F: ACCTTCTCCTGCAACCATCTTCGT
R: ATGGCTGCTTGCTTCTTGTCCTTG 15
16 chMx AY695797 F: ACTGACTGACAGAAAGCCTGAGCA
R: CAATTGCAGGCAACATCAGGTCGT 17
18 chRNaseL NM_001031267 F: GCACTGTGTTTATTGAGGCAGCCA
R: TCCCATACCAAGCAGCTTCCATGA 19
20 chOAS AB037592 F: CACGGCCTCTTCTACGACA
R: TGGGCCATACGGTGTAGACT 21
22 chPKR AB125660 F: TGGTGTGAAGTATGGTACAGGCGT
R: TGCTTTGGCTCAATCATGTCCCAC 23
24 chGAPDH NM_204305 F: CCCAGCAACATCAAATGGGCAGAT
R: TGATAACACGCTTAGCACCACCCT 25
26

By performing real-time RT-PCR using the synthesized cDNA as a template, mRNA levels of genes induced by chIFN-α, β and interferon (Mx, OAS, RNaseL, PKR) were measured. At this time, gene sequence information was confirmed from NCBI to amplify mRNA of each gene, and primers were designed based on this (FIG. 18), and chGAPDH gene was used as a housekeeping gene. Through this, the mRNA of each chIFN-α and β temporarily overexpressed was confirmed, and in particular, the degree of chIFN-α induced by chIFN-β was confirmed. In addition, while chIFN-α showed the highest mRNA expression 48 hours after introduction, chIFN-β was able to confirm that mRNA expression showed the highest point 24 hours after the introduction (Fig. 19). In the case of genes induced by interferon, the expression of Mx, OAS, RNaseL and PKR could be confirmed as each IFN was expressed, especially in the expression of all antiviral genes with chIFN-β stronger than chIFN-α. It could be confirmed that induced (Fig. 19).

Example  2-4: Antiviral Efficacy Assay

Example  2-4-1: pcDNA  3.1a chIFN -α, β of each DNA  In chick cells using plasmids type  I IFNs To Overexpress  Determine if it actually induces resistance to various types of avian influenza virus

The 10-day-old fertilized eggs were received from the National Livestock Science Institute, TEC was isolated, incubated under conditions of 37 ° C. and 5% CO ₂ for 4 days, and then 2 μg of DNA was introduced using Viva magic reagent. At 48 hours after introduction, NDVs belonging to the avian influenza viruses H9N2 and H1N1 and Paramyxoviridae were infected with 0.01moi and 0.1moi for 24 hours, respectively. Afterwards, Western blotting was performed using cell lysates, and viral protein signals were confirmed using antiserum of infected chicken. As a result, Mx, an antiviral protein, was strongly induced by overexpression of IFN, in particular by chIFN-β. It was confirmed that all types of viruses were inhibited (FIG. 20).

In addition, the quantitative analysis of the density of each band analyzed by Western blot using a computer program (quantity one software, Bio-Rad Laboratories, USA) showed that the expression rate of Mx protein was increased by 30 to 80% by chIFN-β. In this case, it was confirmed that the expression rate of the viral protein was inversely reduced by 30 to 80% inversely (FIG. 21).

RNA was isolated from the infected cells in the same experiment as above, cDNA synthesis was performed through reverse transcription, and real-time RT-PCR was used to check mRNA levels of viral genes. At this time, the sequence information of each virus gene was confirmed by NCBI and based on this, each primer was designed (Table 2, Fig. 22).

Base sequence of each primer used in real time RT-PCR Gene name Genebank Access Number Sequence (F: Forward, R: Reverse) SEQ ID NO: H9N2 PB2 AY862718 F: TTTGACTCAAGGAACCTGCTGGGA
R: ACCATGACACATCTCCAAGAGCGA 27
28 H9N2 HA AY862606 F: ACCAAATACAGGACATCTGGGCGT
R: TGAACCCAATGCTCTCTTCACCTT 29
30 H1N1 PB2 CY009611 F: AGAGACGAACAGTCGATTGCCGAA
R: ATCGCTGATTCGCCCTATTGACGA 31
32 H1N1 HA CY009604 F: ACTCACTGCTTCCAGCGAGATCAT
R: TTGTGGTTGGGCCATGAACTTTCC 33
34 NDV F GU289455.1 F: TGGAGGCATACAACAGGACACTGA
R: AGCACCTACGAAGCGTTTCTGTCT 35
36

As a result, it was confirmed that both the expression of PB2, an early gene of the virus, and the expression of HA, a late gene of the virus, were inhibited. At this time, both viral genes of H1N1 and H9N2 and F gene of NDV were inhibited by 30% to 80% by IFN overexpression, in particular chIFN-β, which resulted in antiviral proteins already overexpressed immediately after virus infection. Could be expected to be inhibited (FIG. 23).

Example  2-4-2: pcDNA  3.1a chIFN -α, β of each DNA  In chick cells using plasmids type  I IFNs To Overexpress  If that The degree of inhibition  For quantitative analysis NDV - GFP  Using recombinant viruses IFN type  Analyze star inhibition pattern

The 10-day-old fertilized eggs were received from the National Livestock Science Institute, TEC was isolated, incubated under conditions of 37 ° C. and 5% CO ₂ for 4 days, and then 2 μg of DNA was introduced using Viva magic reagent. At 48 hours after the introduction, the NDV-GFP recombinant virus expressing GFP at infection was introduced with TCID50 0.1 for 24 hours, followed by trypsin treatment, and flow cytometry analysis of GFP positive cells. The inhibition pattern by IFN was confirmed by measuring the ratio. As a result, it was confirmed that the inhibition rate of 50% for chIFN-α and 70% for chIFN-β (FIG. 24).

Attach an electronic file to a sequence list

Claims (8)

A pharmaceutical composition for preventing avian influenza, comprising a polynucleotide encoding an interferon β or a vector containing the polynucleotide as an active ingredient and a pharmaceutically acceptable carrier.
delete According to claim 1, wherein the polynucleotide encoding the interferon β is a composition represented by the nucleotide sequence of SEQ ID NO: 2.
A polynucleotide encoding an interferon β or a vector comprising the polynucleotide as an active ingredient, and a DNA vaccine for preventing bird flu, comprising a pharmaceutically acceptable carrier.
delete The DNA vaccine of claim 4, wherein the polynucleotide encoding the interferon β is represented by the nucleotide sequence of SEQ ID NO: 2. 6.
Administering a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 2, a vector comprising the polynucleotide, a composition comprising the polynucleotide or vector, or a DNA vaccine comprising the polynucleotide or vector to an individual except a human Including, how to prevent bird flu.
8. The method of claim 7, wherein said subject is poultry.

Images