KR101299512B1 - Composition used in diseases linked to arthritis comprising sphingosine 1-phosphate as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for treating arthritis containing sphingosine-1-phosphate as an active ingredient, comprising sphingosine 1-phosphate as an active ingredient together with a pharmaceutically acceptable carrier or diluent. The containing composition is characterized by inhibiting the inflammation-inducing factor associated with arthritis, and the composition according to the present invention can be a target of new arthritis therapeutics because it exhibits the effect of inhibiting several inflammatory factors in cartilage, and various arthritis therapeutics Can lead to the development of

Description

Composition used in diseases linked to arthritis comprising sphingosine 1-phosphate as an active ingredient

The present invention relates to a composition for treating arthritis containing sphingosine-1-phosphate as an active ingredient, and more specifically, sphingosine-1-phosphate decomposes extracellular matrix in bone joints. The present invention relates to a composition for treating arthritis, characterized by reducing the expression of NF-kB and COX-2, which are inflammatory factors expressing matrix proteinases.

Osteoarthritis, also called degenerative arthritis (OA), is present in approximately 10% of people 55 years of age or older, and 25% of patients 60 years of age or older have severe pain and joint mobility problems. In particular, it is a representative musculoskeletal disorder whose prevalence is rising rapidly according to the aging of the population.

The main treatments for OA include weight loss, lower extremity muscle strengthening exercises, and non-drug therapy such as physical therapy, taking or externally acetaminophen or nonsteroidal anti-inflammatory drugs (NSAIDs), and steroids. Drug therapy, such as intra-articular injection of drugs, and surgery, such as arthroplasty, are being used.

However, among the most commonly applied pharmacotherapy, NSAIDs are frequently associated with gastrointestinal disorders, and steroids are difficult to use for a long time because they increase the risk of cartilage destruction or infection due to systemic side effects and repeated injections. It only alleviates the pain of OA, but it is insufficient as an active disease treatment.

The purpose of the treatment of osteoarthritis is to reduce pain, maintain motility and minimize disability. Despite much research on the mechanism of pain and cartilage metabolism, the development of a therapeutic agent for osteoarthritis remains an urgent task.

It effectively inhibits the expression and activity of matrix metalloproteinases (MMPs), which directly degrade cartilage by reducing the expression of COX-2 and NF-kB, the factors that induce chondrocyte inflammation. There is a need for the development of a formulation that can effectively reduce the release of glycosaminoglycan, which can lead to the development of various arthritis therapeutics.

Spingosine-1-phosphate, a lipid metabolite in vivo, has the effect of angiogenesis, fibrosis inhibitors, demyelinating diseases, treatment of advanced dementia or degenerative brain diseases, immunosuppressive effects, and apoptosis in cancer cells. Although there have been studies on the treatment of hyperproliferative diseases (such as cancer or psoriasis) by inhibiting the cell proliferation promoting activity of sphingosine kinases, to date, sphingosine-1-phosphate preparations have been shown to inhibit chondrocyte inflammation. There was no study report.

Therefore, the problem to be solved by the present invention is a composition that can effectively inhibit the expression and activity of matrix protease by reducing the expression of COX-2, NF-kB, factors that induce chondrocyte inflammation, sphingosine 1 It is to provide an inflammation-inducing factor inhibitory composition containing phosphate as an active ingredient, a composition for inhibiting chondrocyte inflammation and a composition for treating arthritis diseases.

In order to achieve the above object,

Cyclooxygenase-2 (COX-2), inducible nitric oxide synthesis (INNOS) and nuclear factor (NF-kB) containing sphingosine 1-phosphate as an active ingredient together with a pharmaceutically acceptable carrier or diluent kB), a composition for inhibiting any proinflammatory factor selected from the group consisting of, chondrocyte inflammation inhibiting compositions and compositions for treating arthritis diseases are provided.

According to one embodiment of the present invention, the arthritis disease may be any one selected from the group consisting of rheumatoid arthritis, degenerative arthritis, ankylosing spondylitis and osteoporosis.

In addition, the present invention is a COX-2 (cyclooxygenase-2), iNOS (inducible nitric oxide synthesis) containing a sphingosine 1-phosphate receptor agonist as an active ingredient together with a pharmaceutically acceptable carrier or diluent ) And a composition for inhibiting any one proinflammatory factor selected from the group consisting of NF-kB (nuclear factor kB), chondrocyte inflammation inhibiting composition and arthritis disease.

According to one embodiment of the present invention, the arthritis disease may be any one selected from the group consisting of rheumatoid arthritis, degenerative arthritis, ankylosing spondylitis and osteoporosis.

The composition containing sphingosine-1-phosphate according to the present invention effectively inhibits the expression and activity of matrix protease which directly degrades cartilage by reducing the expression of factors that induce chondrocyte inflammation, Effectively reduces the glass of glycosaminoglycan, which is one of the components of. In addition, in the present invention, sphingosine 1-phosphate receptor agonist plays an important role in inflammation of cartilage, and since the activity of this receptor shows the effect of inhibiting various inflammatory factors in cartilage, it can be a target of new arthritis therapeutics. And may lead to the development of various arthritis therapies.

Figures 1a to 1d is a result and graph showing the reduction of gene and protein expression of inflammation-inducing factors of chondrocytes by S1P treatment.
2a to 2d are results and graphs showing the chondrocyte extracellular matrix protease-related genes and activity decrease by S1P treatment.
3A to 3E are results and graphs showing the expression inhibitory effect of S1P on chondrocytes mediated by S1P1 receptors.
4A to 4B are graphs showing the free inhibitory effect of glycosaminoglycans on the cartilage of S1P mediated by the S1P1 receptor.

Hereinafter, the present invention will be described in more detail.

A composition containing sphingosine 1-phosphate as an active ingredient together with a pharmaceutically acceptable carrier or diluent according to the present invention inhibits any one proinflammatory factor selected from the group consisting of COX-2, iNOS and NF-kB. And, it inhibits chondrocyte inflammation, it is characterized in that it can treat a variety of arthritis.

In addition, the composition containing the sphingosine 1-phosphate receptor as an active ingredient together with a pharmaceutically acceptable carrier or diluent according to the present invention is any one of the inflammation-induced selected from the group consisting of COX-2, iNOS and NF-kB It is characterized by inhibiting factors, inhibiting chondrocyte inflammation, and thereby treating various arthritis.

In relation to the above, the present invention compared the degree of inflammation for the presence or absence of sphingosine-1-phosphate treatment during inflammation in chondrocytes described later, the degree of inflammation-related genes and proteins expressed (COX-2, NF-kB, MMPs Expression level) was confirmed by RT-PCR, Immunoblotting. In addition, the inhibition of substrate protease activity (the degree of MMP-2 activity) was confirmed by Gelatine zymography, and the degree of release of glycosaminoglycans from cartilage tissue was confirmed by the GAG release test.

The term "treatment" refers to stopping or delaying the progression of the disease when used in a subject exhibiting symptoms of onset, and the "composition" according to the present invention is pharmaceutically acceptable as required with the sphingosine 1-phosphate active ingredient. Carriers, diluents, excipients, or combinations thereof.

The term "carrier" refers to a substance that facilitates the addition of a compound into a cell or tissue.

The term "diluent" is defined as a substance that not only stabilizes the biologically active form of a compound of interest, but also is diluted in water to dissolve the compound.

The term "pharmaceutically acceptable" means a property that does not impair the biological activity and physical properties of the compound.

Other terms and abbreviations used herein may be interpreted as meanings commonly understood by those skilled in the art to which the present invention belongs unless otherwise defined.

The compounds of the present invention may be formulated for use as pharmaceutical or veterinary compositions also containing a pharmaceutically or veterinarily acceptable carrier or diluent. The composition according to the present invention can be generally prepared according to a conventional method, and can be administered in a pharmaceutically or veterinarily appropriate form.

In addition, according to a preferred embodiment of the invention, it can be administered orally, such as in the form of tablets, capsules, sugar-coated, film-coated tablets, liquid solutions or suspensions, or injected subcutaneously or intramuscularly or intravenously or It may also be administered parenterally via the method of infusion.

Hereinafter, the present invention will be described in more detail with reference to preferred embodiments. It will be apparent, however, to those skilled in the art that these embodiments are for further explanation of the present invention and that the scope of the present invention is not limited thereby.

<Examples>

(1) Sphingosine-1-phosphate (Sphingosine-1-phosphate, S1P, Cayman Chemical Company, Ann Arbor, MI, USA; # 62570) is dissolved at 2 mM concentration in 0.3 N NaOH and treated according to each concentration indicated. The cells were diluted with cell culture medium, and Recombinant human IL-1β (Santa Cruz Biotechnology, CA, USA) was dissolved in DW at a concentration of 10 μg / ml and treated at a concentration of 10 ng / ml. SEW2871 (Cayman Chemical Company, Ann Arbor, MI; USA; # 10006440) was dissolved in ethanol at a concentration of 10 mM and diluted with cell culture medium according to the indicated concentrations, W146 (Cayman Chemical Company, Ann Arbor, MI) , USA; # 10009109) were dissolved in ethanol at a concentration of 5 mM and diluted with cell culture media for each indicated concentration.

(2) Chondrocyte Separation and Monolayer Chondrocyte Culture

Cartilage specimens to separate articular chondrocytes were obtained by using knee joints removed from arthritis patients. After the cartilage tissue was washed several times with sterile PBS, the cartilage tissue sample was cut into small sections and washed three times with sterile PBS solution, and then 0.25% trypsin (Sigma-Aldrich, St.) to remove extracellular cartilage matrix. Louis, MO, USA; # T4174) for 30 minutes and 10% (v / v) fetal bovine serum (FBS) (Invitrogen-Gibco) with antibiotics (100 μg / ml penicillin-treptomycin (Sigma-Aldrich, St. Louis, MO, USA; # P0781) in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen-Gibco, Grand Island, NY, USA) medium with 0.1% collagenase (Sigma-Aldrich, St. Louis, MO, USA; # C6885) was treated for 6 hours at 37 ° C.

Single chondrocytes were obtained through a 70 μm cell strainer (Falcon, Franklin Lakes, NJ, USA), and then cultured with DMEM medium containing 10% FBS and antibiotics in a tissue culture flask. The medium was changed once every two days, and after 7 days of incubation, the flask was divided once, and once again, the cells were grown to high density and tested with these first passaged chondrocytes. The medium was ground and treated with 1% FBS DMEM before S1P, SEW2871, W146, IL-1β treatment.

(2) qRT-PCR (Quantitative Real-time PCR)

Isolation of total RNA from the cells was extracted using the Easy-spin ™ total RNA extraction kit (iNtRON Biotechnology, Seoul, Korea) according to the manufacturer's protocol. Then, the synthesis of cDNA was performed according to the protocol of TaKaRa Prime Script ™ 1st strand cDNA synthesis kit (Takara Bio Inc., Tokyo, Japan).

In order to perform quantitative PCR, SYBR green and 1 μl gene primer were added to a total of 20 μl reaction solution. The primers used are shown below.

primer

COX-2:

forward, 5'AGTCCCTGAGCATCTACGGTTTG3 ',

reverse, 5'CATCGCATACTCTGTTGTGTTCCC3 ';

iNOS:

forward, 5'CCAGCCGTGCCACCATCC3 ',

reverse, 5'CCATCCACCACTCGCTCCAG3 ';

MMP1:

forward, 5'TCCACTGCTGCTGCTGCTG3 ',

reverse, 5'TTTCAACTTGCCTCCCATCATTCTTC3 ';

MMP3:

forward, 5'TGAACAATGGACAAAGGATACAACAGG3 ',

reverse, 5'ATCATCTTGAGACAGGCGGAACC3 ';

MMP13:

forward, 5'AGTGGTGGTGATGAAGATGATTTGTC3 ',

reverse, 5'TCTAAGGTGTTATCGTCAAGTTTGCC3 ';

β-actin:

forward 5'TGAGAGGGAAATCGTGCGTGAC3 ',

reverse 5'GCTCGTTGCCAATAGTGATGACC3 ';

All reactions of iTaq SYBR green supermix (Bio-Rad Laboratories, Hercules, Calif., USA) were performed in a CFX96 real-time PCR detection system (Bio-Rad Laboratories).

(3) Western blotting

Cells were lysed with lysis buffer (25 mM HEPES; pH 7.4, 100 mM NaCl, 1 mM EDTA, 5 mM MgCl 2, 0.1 mM DTT and protease inhibitor mixture). Thereafter, the protein was fractionated by electrophoresis on a 10-15% SDS gel, followed by immunoblotting. Equal amounts of protein lysate were fractionated on 10-15% SDS-polyacrylamide gel and then electrophoresed to nitrocellulose membrane.

Immunoreactivity was examined through continuous incubation of horseradish peroxidase (HRP) -bound secondary antibodies and ECL reagents.

Antibodies used for immunoblotting were p-65, COX-2 (Santa Cruz Biotechnology) and β-actin (Sigma-Aldrich, St. Louis, MO, USA).

(4) Gelatin zymography

Gelatin zymography is an experiment to measure the secretion and activation state of MMP protein secreted into the medium, and after removing the cell debris after centrifugation by collecting the medium obtained by treating the drug according to each condition, -20 Stored at ° C.

Each sample is mixed 1: 1 with SDS sample buffer and allowed to react at room temperature for 30 minutes. Each sample was isolated by electrophoresis on SDS-PAGE gel containing 10% acrylamide and 1 mg / ml gelatin. 2.5% (w / v) Triton X-100 solution dissolved in distilled water was washed twice at room temperature for 30 minutes and then developed at 37 ° C. with developing buffe containing 50 mM Tris-HCl (pH 7.5), 0.2 M NaCl and 5 mM CaCl _2. Incubated for 36 hours.

This developing buffer reduces protein structure and regains protein resolution. After 36 hours, the gel was stained with 0.2% Coomassie Blue R-250 solution in 50% ethanol, 10% acetic acid for 1 hour at room temperature, and then destaining solution consisting of 20% methanol, 10% acetic acid and 70% distilled water. When decolorized for more than a time, the gelatin decomposed portion by the activated MMP is not stained, but appears transparent, and the remaining MMP protein portion remains darkly stained. Gels were photographed and analyzed using the Fusion FX7 acquisition system (Vilbert Lourmat, Eberhardzell, Germany).

(5) Measurement of GAG released as media from tissue

Chondrocytes were cut with 2 × 2 × 1 mm3 or 3 mm discs (50-100 mg) and placed on 24 well plates with 10% (v / v) fetal bovine serum (FBS) (Invitrogen-Gibco) and antibiotics (100 μg / ml). Insert Dulbecco's modified Eagle's medium (DMEM) (Invitrogen-Gibco, Grand Island, NY, USA) medium with penicillin-treptomycin (Sigma-Aldrich, St. Louis, MO, USA; # P0781) and incubate 4-6 disc I was.

The drug for each experiment was treated for 72 hours after replacement with DMEM medium containing 1% FBS. Cultured media were collected to determine the amount of glycosaminoglycans that were cleaved and released from cartilage tissue. Dilute the solution of chondroitine sulfate (Sigma-Aldrich, St. Louis, Mo., USA) by concentration and hold as standard. 10 μl of standard solution or 10 μl of medium sample and 180 μl (B) dimethylene blue (DMB, Sigma-Aldrich, St. Louis, MO, USA) solution was reacted for 30 minutes at room temperature to measure the absorbance at 540 nm to determine the amount of glycosaminoglycans. At this time, the supernatant was measured by protein assay and the concentration of glycosaminoglycan was calculated in μg / mg unit. At this time, the DMB solution was composed of 48 mg / ㎖ DMB, 40 mM glycine, 40 mM NaCl, 10 mM HCl solution was adjusted to pH 3.0. Chondroitine sulfate standard solution was dissolved in PBS at a concentration of 5 ㎍ / ㎖ and used serially diluted.

(6) statistical evaluation

All data in the experiments were expressed as means ± SD (standard deviations) and compared using the Student's t-test and ANOVA Duncan test of SAS statistical package. The results were then considered significant for values of * P <0.05 or ** P <0.01 and for values of #P <0.05 and ## P <0.01.

&Lt; Evaluation example &

(1) S1P treatment reduces chondrocyte gene and protein expression

Interleukin-1β (IL-1β) 10 ng / ml was applied to cells cultured with chondrocytes isolated from cartilage tissues to induce osteoarthritis, and then S1P treatment reduced the expression of major inflammatory factors. It was confirmed by RT-PCR and Western blotting, the results are shown in Figure 1a to 1d.

As shown in FIGS. 1A-1D, the expression of cyclooxygenase-2 (COX-2) increases the concentration-dependent concentration of S1P treated (0.1 μM, 1 μM, 10 μM). It can be seen that the amount of protein expression is significantly reduced. In particular, the S1P 10 μM concentration reduced the expression of COX-2 by 8-fold. In addition, the expression of inducible nitric oxide synthesis (iNOS), one of the factors inducing nitric oxide death and inflammation of chondrocytes, was also reduced by S1P treatment.

(2) Reduced genes and activities related to extrachondral matrix proteinases by S1P treatment

10 ng / ml concentration in chondrocytes isolated from cartilage tissue and cultured in monolayer to determine how S1P directly affects the expression and activity of stromal protease secreted by inflammation-inducing factors when osteoarthritis is directly induced Treatment of IL-1β induce osteoarthritis, and then real time RT-PCR and gelatin zymography were performed to determine whether S1P has a protective effect on the expression and activity of the increased substrate proteinase. 2a to 2d.

As shown in Figures 2a to 2d, the expression level of substrate proteinase 1 is increased by 150 times by IL-1β treatment, but the expression level of MMP 1 is significantly reduced depending on the concentration of S1P. It can be seen that the S1P 10 μM concentration is reduced by about five times. In addition, as a result of performing gelatin zymogrphy to confirm whether the expression itself and the activity itself are reduced, the activation of substrate protease 2, which was also increased by IL-1β treatment, increased the concentration of S1P. It can be seen that the decrease. Therefore, it can be seen that S1P decreases the expression level of COX-2 and prevents the expression and activity of substrate protease, which is a subordinate mechanism thereof.

(3) Inhibitory Effect of S1P Mediated S1P1 Receptor-induced Inflammatory Factors on Chondrocytes

To determine which receptors the anti-inflammatory action of S1P is on the chondrocytes, the S1P1 receptor antagonist W146 was treated in different concentrations (0, 10, 50, 100 μM) to block the S1P1 receptors and to inflame IL-1β. After inducing S1P 10 μM treatment RT-PCR was performed to show the gene expression results of COX-2 in Figure 3a.

In addition, the amount of expression of COX-2, P-65 was also performed by Western blot and the results are shown in Figure 3d below. Treatment of the S1P1 receptor selective agonist SEW2871 by concentration (0, 1, 10, 50 μM) yields the same effect as S1P and whether the effect does not occur when treated with S1P1 receptor antagonist. Real-time RT-PCR and Western blot The COX-2 expression and the gene and protein expression results of P-65 are shown in FIGS. 3B, 3C, and 3E, respectively.

As shown in Figures 3a to 3e, it can be seen that the amount of COX-2 gene expression increased by IL-1β treatment was reduced by S1P treatment and this decrease did not appear when the S1P1 receptor was inhibited by antagonist treatment. In addition, it can be seen that the protein expression levels of COX-2 and P-65 were also suppressed by the S1P treatment when the S1P1 receptor was blocked when the amount of expression returned to the reduced control level was suppressed. When the S1P1 selective agonists were treated by concentration, it was confirmed that the gene expression level of COX-2 was reduced to the control level, and that the effect was not shown by the S1P1 antagonist treatment. This showed similar results in protein expression levels of COX-2 and P-65. In other words, it can be seen that the inhibitory action of S1P's chondrocytes' expression of inflammation-inducing factors occurs via the S1P1 receptor.

(4) Free inhibitory effect of glycosaminoglycans on S1P cartilage tissue mediated by S1P1 receptor

To directly determine whether S1P has anti-inflammatory activity in cartilage tissues, the amount of glycosaminoglycans in the substrate protein released by the substrate protease that is expressed and activated by the inflammatory agent when arthritis is induced Measured. Cut cartilage tissue 2 × 2 × 1 서 and incubate 4-6 discs in 24 well plates to induce inflammation by treatment with IL-1β. S1P concentrations (0, 0.1, 1, 10 μM) was treated, and cultured after 72 hours, the culture medium was collected, and the result of measuring the amount of glycosaminoglycan released into the medium using dimethylene blue is shown in FIG. 4A.

In addition, 50 μM of the S1P1 selective agonist SEW2871 alone or 100 μM of the S1P1 antagonist W146 was pretreated for 1 hour beforehand to measure the amount of glycosaminoglycogen in the same manner.

As shown in FIG. 4a, the amount of glycosaminoglycan released from the medium was increased due to substrate degradation of cartilage tissue by IL-1β treatment, but the concentration increased when concentrations of S1P were treated to control levels. It can be seen that matrix degradation of cartilage tissue was inhibited. In addition, when the S1P1 receptor was selectively activated, the same effect as that of S1P was observed, and when the S1P1 receptor antagonist was used, the effect disappeared. This can be seen through.

In the above examples and evaluation examples, S1P has anti-inflammatory action on chondrocytes and cartilage tissue, and this inhibitory action regulates the expression of COX-2, p-65, which is an inflammation-inducing factor, through the S1P1 receptor. Inhibition of the expression and activity of the matrix proteinase, which is a lower mechanism, can be seen as a result to reduce the degradation of the matrix protein of cartilage tissue to prevent the breakdown of cartilage. In particular, S1P regulates anti-inflammatory action in chondrocytes, and in particular, S1P1 receptor plays an important role in this regulation process.

Claims (8)

delete delete delete delete It contains a sphingosine 1-phosphate (S1P) receptor agonist as an active ingredient together with a pharmaceutically acceptable carrier or diluent, cyclooxygenase-2 (COX-2), inducible nitric oxide synthesis (iNOS), and Inhibits expression of any one or more selected from the group consisting of nuclear factor kB (NF-kB),
The S1P receptor agonist is a composition for treating and preventing arthritis diseases, characterized in that 1 ~ 50μM SEW2871 (Cayman Chemical Co., Ltd. brand name 10006440).
6. The method of claim 5,
In preparation for the non-use of the composition,
A composition for treating and preventing arthritis diseases, characterized in that the expression level of COX-2 (cyclooxygenase-2) is reduced by 1.5 to 2.5 times.
The method of claim 5, wherein
The arthritis disease is a composition for treating and preventing arthritis diseases, characterized in that any one selected from the group consisting of rheumatoid arthritis, degenerative arthritis, ankylosing spondylitis and osteoporosis. delete

Images