KR101268776B1 - Host Strains for the Expression of Heterologous genes and the Method - Google Patents

Abstract

The present invention relates to a host microorganism expressing a heterologous gene, a method for producing the same, and a method for expressing a gene of a heterologous microorganism using the same, and more specifically, (a) a sigma factor of a heterologous microorganism; And (b) a sigma factor of the host microorganism having reduced affinity with the core RNA polymerase of the host microorganism. The present invention relates to a host microorganism, a method for preparing the same, and a method for gene expression of a heterologous microorganism using the same.
Sigma factor of the heterologous microorganism when the heterologous microorganism gene expression according to the present invention does not occur due to changes in the culture conditions of the host microorganism such as temperature can be present in a high content in the host microorganism, whereby the expression amount of the heterologous microorganism gene It has the advantage of being high.

Description

Host microorganisms expressing heterologous genes and methods for preparing the same {Host Strains for the Expression of Heterologous genes and the Method}

The present invention relates to a host microorganism expressing a heterologous gene, a method for preparing the same, and a gene expression method of a heterologous microorganism using the same.

Heterologous expression in E. coli so far refers to the expression of genes of other organisms using a promoter (tac, T7 phi 10, lacZ promoter) operated in E. coli. In this expression system, the expression of the heterologous gene depends on the promoter present in the expression vector. The use of a powerful promoter (tac, T7 phi10) can induce overexpression of heterologous genes, making it useful for protein production and purification. But for gene screening based on activity, which is increasingly necessary with the development of metagenomics, existing expression systems are not efficient. Because for a gene to be active, that gene must be expressed, and the likelihood of a heterologous gene being expressed in E. coli depends on two cases. (1) when the gene is accidentally cloned in the same direction as the promoter in the vector, or (2) when the heterologous gene is cloned, the promoter of the gene is also cloned and the promoter is cloned in E. coli RNA polymerase (RNA). if it is recognized by a polymerase.

In case of (1), the problem becomes more serious in the study of cloning DNA of macromolecules, such as the metagenome library. To remedy this problem, L et al. Attempted to express foreign genes by inserting a potent T7 promoter on both sides of the vector cloning site. This approach doubled the probability of expression of external genes but did not fundamentally solve the polarity problem. In other words, as the gene to be expressed is farther away from the T7 promoter, the expression probability rapidly decreases. In a more elaborate attempt, Leggewie et al. Attempted to express genes by feeding E. coli promoters into the metagenome using Tn. In this case, the position of the gene to be expressed will be independent of the distance from the cloning site, but also the expression of the gene will depend on the probability that Tn will be inserted upstream of the gene, so hit rate is It must be lowered.

In case of (2), cloning a large sized DNA is likely to clone not only the coding sequence of the gene, but also the promoter. However, in E. coli, the probability of a heterologous gene promoter being recognized by E. coli RNA polymerase is not very high. As a result of analyzing the structure of promoters from 32 microbial genomic sequences, even in the case of Proteobacteria including E. coli, more than 50% of the genes in the genome are determined by the major sigma factor. About 95% of the genes in high G + C gram positive bacteria belong to streptomyces, which are predicted to be unrecognized, especially reports of substance diversity, and which are the main targets for the discovery of useful substances. It has been reported that the efficiency of heterologous gene transcription is so low that it is not expected to be expressed in E. coli. Martinez et al., Streptomyces lividans , Pseudomonas as alternative hosts to overcome heterologous gene expression problems. putida was used. However, when using an alternative host, not only the process of transferring the metagenome library prepared in E. coli to the alternative host is required, but even when using the alternative host, there is a barrier for expression of the heterologous gene of the host itself. As a screening host, S. lividans and P. putida were not concluded to be better.

The present invention provides a host microorganism comprising a sigma factor of a heterologous microorganism and a host microorganism that has reduced affinity with a core RNA polymerase of the host microorganism, a preparation method thereof and a gene expression method of a heterologous microorganism using the same. To provide.

The present invention (a) sigma factor of heterologous microorganisms; And (b) a host microorganism expressing a heterologous gene comprising a sigma factor of the host microorganism having reduced affinity with the core RNA polymerase of the host microorganism.

The heterologous microorganism may be selected from the group consisting of Actinobacteria, Pseudomonas, and enterobacteria.

The sigma factor of the heterologous microorganism is one or more selected from the group consisting of rpoD, sigA, hrdB, hrdA, hrdC, hrdD, sigE, sigB, sigF, sigR, sigG, sigH, sigQ, sigB / J, sigK, sigK and sigI have.

The host microorganisms include Escherichia coli, Bacillus subtilis, Pseudomonas putida, Streptomyces coelicolor, Streptomyces lividans, and Streptomyces lividans. It may be selected from the group consisting of Myces Orius (Streptomyces aureus).

Sigma factor of the host microorganism is 3xFLAG (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-Asp-Tyr-Lys-Asp-Asp at the 5 'end). -Asp-Asp-Lys) sequence may be fused.

The host microorganism may be removed at least one selected from the group consisting of Lon protease, ClpP protease, and Omptin protease.

The host microorganism may comprise (a) one or more sigma factors of actinomycetes selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF and sigH; And (b) rpoD, which is a sigma factor of E. coli that reduces the affinity with the core RNA polymerase of E. coli by fusing 3xFLAG sequences at the 5 'end, (c) Lon protease, ClpP protease, And it may be E. coli removed one or more selected from the group consisting of Omptin protease.

The present invention comprises the steps of (a) preparing a recombinant vector containing a sigma factor of heterologous microorganisms; (B) preparing a recombinant vector containing a sigma factor of the host microorganism that has reduced affinity of the host microorganism with the core RNA polymerase; And (c) transforming the host microorganism with the vector of step (a) and the vector of step (b).

The method for preparing a host microorganism includes: (a) preparing a recombinant vector containing at least one actinomycete sigma factor selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF, and sigH; (B) 3xFLAG (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-) at the 5 'end, which reduced E. coli affinity with the core RNA polymerase. Preparing a recombinant vector containing rpoD, a sigma factor of E. coli fused with the Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) sequence; And (c) transforming Escherichia coli from which at least one selected from the group consisting of Lon protease, ClpP protease, and Omptin protease is transformed with the vector of step (a) and the vector of step (b). Step; may be included.

The present invention comprises the steps of (a) preparing a recombinant vector containing a sigma factor of heterologous microorganisms; (B) preparing a recombinant vector containing the sigma factor of the host microorganism, wherein the host microorganism has reduced affinity with the core RNA polymerase; And (c) transforming the host microorganism with the vector of step (a) and the vector of step (b); (D) inducing expression of said heterologous sigma factor; And (ㅁ) transferring the gene of the heterologous microorganism by the RNA polymerase formed by combining the sigma factor of the heterologous microorganism and the core RNA polymerase of the host microorganism.

By using the method for expressing a heterologous gene of the present invention, the gene to be expressed can be expressed regardless of a relative position with a cloning site, and there is an advantage that several genes can be expressed at the same time.

1 shows a physical map of pKO3-rpoDF.
Figure 2 is an electrophoresis of chromosomes of E. coli W3110-18 (lane1) and wild type (lane2) using rpoD-F10 and Bsa-rpoD-R primers, lane3 (W3110-18), lane4 (W3110-19) ), lane5 (wild type W3110) was performed by Worston blotting to determine whether rpoD-FLAG protein was produced.
Figure 3 is a photograph of the Worston blotting to confirm whether the expression in the actinomycete sigma factor (sigma factor) E. coli.
Figure 4 confirms the expression of the actII-orf4 promoter by hrdB in wild-type W3110, open symbol cell growth (cell growth), closed symbol represents LacZ activity, the source is not added arabinos (arabinose) conditions , The triangle shows the condition of adding arabinose to induce the expression of hrdB, and the arrow shows the time of adding arabinose.
Figure 5 confirms the expression of the actII-orf4 promoter by hrdB in W3110-18 (symbol is the same as Figure 4).
Figure 6 shows the gene expression of actinomycetes by actinomycetes sigma factor.
Figure 7 shows the purified E. coli RNA polymerase (RNA polymerase). Lane 1 represents a crude extract of W3110-18 'and lane 2 represents a sample after purification.
FIG. 8 shows a sigma factor of actinomycetes by performing a Worston blot using purified RNA polymerase using an anti-FLAG antibody (black arrow indicates E. coli rpoD and red arrow indicates Actinomycetes factors).

The present invention provides a host microorganism comprising a sigma factor of a heterologous microorganism and a host microorganism that has reduced affinity with a core RNA polymerase of the host microorganism, a preparation method thereof and a gene expression method of a heterologous microorganism using the same. To provide.

Hereinafter, the present invention will be described in detail.

Conventionally, efforts have been made to express heterologous microorganisms in host microorganisms such as Escherichia coli, but since the promoters of the heterologous genes in the host microorganism are difficult to be recognized by RNA polymerase of the host microorganism, the gene expression of heterologous microorganisms cannot be achieved. It was. Accordingly, the present inventors have found that the above problems can be solved by weakening the affinity between the core RNA polymerase of the host microorganism and the sigma factor of the host microorganism while continuing various studies.

The present invention (a) the sigma factor of heterologous microorganisms; And (b) a sigma factor of the host microorganism, the affinity of the host microorganism with the core RNA polymerase is reduced.

Sigma factor is the most important factor in the recognition of promoter among the components of RNA polymerase and plays an important role in the selective gene expression of microorganism according to the external situation. Under normal conditions, even though the sigma factor of the heterologous microorganism and the host microorganism exist at the same time, the heterologous microorganism has a higher affinity with the host microorganism's core RNA polymerase. Expression did not occur. In order to enhance the affinity between the core RNA polymerase of the host microorganism and the sigma factor of the heterologous microorganism, the main sigma factor of Escherichia coli is identified by Lon protease at 42 ° C using Escherichia coli ts rpoD (rpoD285). Expression of heterologous microbial genes could be achieved by lowering the concentration of major sigma factor, RpoD (σ ⁷⁰ )) and increasing the sigma factor of actinomycetes, which are relatively heterologous microorganisms (Patent 10-0878017). As a result, actinomycetes (minor sigma factor; hrdC, hrdD, SigE, etc.) were also degraded to confirm that the concentration of sigma factor of actinomycetes, which is a heterologous microorganism, was reduced.

Accordingly, the present invention is to provide a host microorganism capable of maintaining the concentration of the sigma factor as high as possible without the degradation of the sigma factor of the heterologous microorganism while enhancing the affinity between the core RNA polymerase of the host microorganism and the sigma factor of the heterologous microorganism.

The type of heterologous microorganism is not particularly limited, and may include a microorganism selected from the group consisting of Actinobacteria, Pseudomonas, and enterobacteria, and may preferably be actinomycetes.

The actinobacteria are high G + C Gram-positive bacteria, including actinomycetes, and the type of the strain may be referred to Bergey's Manual of Systemic Bacteriology (2nd ed.).

In the present invention, in order to prove that the above technical concept can be implemented in all heterologous microorganisms, by selecting E. coli as a host microorganism, and selecting the actinomycetes from high G + C Gram-positive bacteria known to be very low gene expression in E. coli, The possibility of expression of all heterologous microbial genes in the host microorganism was confirmed.

The actinomycetes are predominantly streptomyces, and may include Nocardia, Micromonospora, and the like. It produces 55% of more than 12,000 known antimicrobial agents, as well as immunosuppressants (FK-506, rapamycin, ascomycin), anticancer agents (bleomycin, dactinomycin, doxorubicin, staurosporin), antifungal agents (amphotericin, nystatin) and herbicides ( It produces a variety of substances, including phosphinothricin, insect repellents (avermectin, milbemycin) and anti-diabetic drugs (acarbose).

Sigma factors of the heterologous microorganism may include both a major sigma factor and a minor sigma factor.

Microorganisms possess various kinds of sigma factors necessary to respond to various external situations, and recognize the external situation and increase the production of appropriate primary sigma factors and / or secondary sigma, resulting in a collection of genes suitable for the external situation. Expression can be enabled.

Sigma factor of the heterologous microorganism is not particularly limited, the main sigma consisting of rpoD, sigA and hrdB and hrdA, hrdC, hrdD, sigE, sigB, sigF, sigR, sigG, sigH, sigQ, sigB / J, sigK, sigK It may include one selected from the group consisting of sigI, sigI, preferably may be selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF, and sigH.

The host microorganism is not particularly limited as long as it is suitable for the gene expression of the heterologous microorganism, but preferably Escherichia coli, Bacillus subtilis, Pseudomonas putida, Streptomyces coelicolor ( Streptomyces coelicolor, Streptomyces lividans, and Streptomyces aureus, and may be most preferably E. coli.

The sigma factor of the host microorganism is not particularly limited, but may be selected from the group consisting of rpoD, sigA, and hrdA as an example of the present invention.

In the present invention, the method for preparing the sigma factor of the host microorganism having reduced affinity with the core RNA polymerase of the host microorganism is not particularly limited, but preferably, the sigma factor of the host microorganism may be mutated. A mutated sigma factor of may refer to a modified sigma factor that is not found in nature (wild type).

The method for preparing the modified sigma factor is not particularly limited, but may be randomly introduced by, for example, traditional means such as UV irradiation and chemical mutagenesis, or molecular biological methods such as cassette mutagenesis, genetic design method. Can be introduced intentionally.

In one example of the invention, 3xFLAG (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-Asp-Tyr-) at the 5 'end of the sigma factor of the host microorganism. Fusion of the Lys-Asp-Asp-Asp-Asp-Lys) sequence can reduce the affinity of the host microorganism with the core RNA polymerase.

As described above, when the affinity between the host microorganism's sigma factor and the host microorganism's core RNA polymerase is weakened, the binding rate of the heterologous microorganism's sigma factor and the host microorganism's core RNA polymerase increases, resulting in high reprogramming of the RNA polymerase. Can be.

As described above, the microorganism converts the types of promoters that the RNA polymerase can recognize through the substitution of sigma factors, thereby controlling the expression of genes necessary for a given environment, and using reprogramming of the RNA polymerase. E. coli RNA polymerase can then recognize promoters of heterologous microorganisms that were not originally recognized.

In addition, the present invention can remove one or more selected from the group consisting of Lon protease, ClpP protease, and Omptin protease from the host microorganism. By removing the protease as described above, it is possible to prevent the degradation of the sigma factor of the heterologous microorganism expressed in the host microorganism.

That is, the sigma factor of the heterologous microorganism in the host microorganism may be expressed in a high content even in the host microorganism because decomposition does not occur due to changes in the culture conditions of the host microorganism, such as temperature, and more than the sigma factor of the host microorganism remaining in the host microorganism. By being present at a high rate (see FIG. 8), the binding rate with the core RNA polymerase of the host microorganism may be increased, and the recognition rate of the promoter of the heterologous gene may be further increased.

In one embodiment of the present invention, a host microorganism of the present invention comprises: (a) one or more sigma factors of actinomycetes selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF, and sigH; And (b) rpoD, a sigma factor of Escherichia coli, which reduced the affinity with E. coli core RNA polymerase by fusing 3xFLAG sequences at the 5 'end; (c) Lon protease, ClpP protease, And it may include E. coli from which one or more selected from the group consisting of Omptin protease is removed.

5 to 8 show (a) sigma factors of heterologous microorganisms; And (b) a sigma factor of the host microorganism that has reduced affinity with the core RNA polymerase of the host microorganism, wherein the host microorganism's RNA polymerase is reprogrammed into a heterologous sigma factor. ).

In other words, the binding force between the core RNA polymerase of the host microorganism and the sigma factor of the host microorganism is weakened, so that the core RNA polymerase of the host microorganism is combined with the sigma factor of the heterologous microorganism, The formed RNA polymerase may recognize a promoter of a heterologous microbial gene and expression of the heterologous gene may be achieved.

8 is purified directly from the host microorganism Escherichia coli RNA polymerase to confirm that the sigma factors hrdA, hrdB, hrdC, hrdD of the actinomycetes heterogeneous microorganisms in the polymerase, which is a heterologous RNA polymerase of the host microorganism Proof of reprogramming with the sigma parameter of.

The sigma factor may vary depending on the type of sigma factor, the culture environment, and the type of promoter that can be recognized according to the growth stage.

5 is given a condition capable of inducing the expression of heterologous genes, hrdB, a sigma factor of actinomycetes, which is a heterologous microorganism, and a core RNA polymerase of the host microorganism are combined to recognize a promoter II - orf4 promoter of heterologous microorganisms. 6 shows that the transcription of promoters of all heterologous microbial genes tested by hrdB, which is a sigma factor of actinomycetes, and a polymerase coupled to a core RNA polymerase of the host microorganism, is promoted, and hrdC is a sigma factor of actinomycetes. ActII - orf4 , which promotes the transcription of the dnrO promoter, were reprogrammed into the heterologous sigma factor, resulting in heterologous microorganisms that the host microorganisms could not originally recognize. This indicates that the promoter of can be recognized.

The present invention comprises the steps of (a) preparing a recombinant vector containing a sigma factor of heterologous microorganisms; (B) preparing a recombinant vector containing a sigma factor of the host microorganism that has reduced affinity of the host microorganism with the core RNA polymerase; And (c) transforming the host microorganism with the vector of step (a) and the vector of step (b).

The heterologous microorganism is not particularly limited, and may include a microorganism selected from the group consisting of Actinobacteria, Pseudomonas, and enterobacteria, and may preferably be actinomycetes.

Sigma factor of the heterologous microorganism is not particularly limited, the main sigma consisting of rpoD, sigA and hrdB and hrdA, hrdC, hrdD, sigE, sigB, sigF, sigR, sigG, sigH, sigQ, sigB / J, sigK, sigK It may include one selected from the group consisting of sigI, sigI, preferably may be selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF, and sigH.

The recombinant vector is a vector capable of expressing a polypeptide of interest in a suitable host cell, and may refer to a gene construct including essential regulatory elements operably linked to express a gene insert.

The vector of the present invention is not particularly limited, and may include a plasmid vector, a cosmid vector, a bacteriophage vector, a viral vector, and the like.

Recombinant vectors containing the sigma factors of the heterologous microorganisms can be provided based on various structures (variation of cleavage maps, introduced genes, etc.) using genetic engineering techniques known to those skilled in the art. It should not be chosen according to the purpose of use. In one example, the literature [J. Sambrook, et al., "Molecular Cloning: A Laboratory Manual"; F.M. Ausubel, et al., "Current Protocols in Molecular Biology"; A.L. Demain, et al., "Manual of Industrial Microbiology and Biotechnology"; M.J. Gait, et al., "Oligonucleotide Synthesis"; Mullis, et al., "PCR: The Polymerase Chain Reaction"; Cold Spring Harbor Laboratory, 1.53], etc., can select the appropriate sample and process according to the specific embodiment.

The host microorganism is not particularly limited as long as it is suitable for gene expression of a heterologous microorganism, and preferably, Escherichia coli, Bacillus subtilis, Pseudomonas putida, Streptomyces coelicolor ( Streptomyces coelicolor, Streptomyces lividans, and Streptomyces aureus, and may be most preferably E. coli.

The sigma factor of the host microorganism is not particularly limited, but may be selected from the group consisting of rpoD, sigA, and hrdA as an example of the present invention.

In the present invention, a method for preparing a sigma factor of the host microorganism, which has a weakened affinity with the core RNA polymerase of the host microorganism, is not particularly limited. Preferably, the sigma factor of the host microorganism may be mutated. Factor may refer to a modified sigma factor that is not found in nature (wild type).

In one example of the invention, 3xFLAG (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-Asp-Tyr-) at the 5 'end of the sigma factor of the host microorganism. Fusion of the Lys-Asp-Asp-Asp-Asp-Lys) sequence can reduce the affinity of the host microorganism with the core RNA polymerase.

The recombinant vector containing the sigma factor of the host microorganism is not particularly limited, and may include a plasmid vector, a cosmid vector, a bacteriophage vector, a viral vector, and the like.

The transformation method of the host microorganism by the recombinant vector may be by a method known in the art, for example, Davis et al. Basic Methods in Molecular Biology, Sambrook et al. Calcium phosphate method or calcium chloride / rubidium chloride method, electroporation, electroinjection, PEG, described in Basic Methods in Molecular Biology, Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, etc. It can be used according to the purpose, such as a method by chemical treatment, such as a method such as using a gene gun.

As an example of the method for producing a host microorganism of the present invention, (a) preparing a recombinant vector containing the sigma factor of actinomycetes, which is at least one selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF, and sigH step; (B) 3xFLAG (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-) at the 5 'end, which reduced E. coli affinity with the core RNA polymerase. Preparing a recombinant vector containing rpoD, a sigma factor of E. coli fused with Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) sequence; And (c) E. coli, wherein the vector of step (a) and (b) is removed by one or more selected from the group consisting of Lon protease, ClpP protease, and Omptin protease. It may provide a method for producing a host microorganism expressing a heterologous gene comprising a step of converting.

The present invention provides a recombinant vector containing a sigma factor of a heterologous microorganism; (b) preparing a recombinant vector containing a sigma factor of the host microorganism, which reduces affinity of the host microorganism with the core RNA polymerase. Making; And (c) transforming the host microorganism with the vector of step (a) and the vector of step (b); (D) inducing expression of said heterologous sigma factor; And (ㅁ) transferring the gene of the heterologous microorganism by the RNA polymerase formed by combining the sigma factor of the heterologous microorganism and the core RNA polymerase of the host microorganism.

Inducing the expression of the heterologous sigma factor, the type of heterologous microorganism gene to be expressed and the type of sigma of the heterologous microorganism expressed by the culture conditions may vary.

Therefore, the expression of heterologous sigma factors should be induced according to the gene to be expressed and given the culture conditions to induce it. Microorganisms have a wide variety of sigma factors necessary to respond to a variety of external conditions, and because they recognize the external situation and increase the production of appropriate primary and / or secondary sigma, It may vary according to changes in genes and culture conditions to be expressed.

As an example of the present invention, when E. coli is used as a host microorganism and cultured at 37 ° C., when hrdC is used as a sigma factor of actinomycetes, the heterologous microorganisms, actII - orf4 and dnrO promoters may be promoted. transfer of redD, ccaR promoter do not promote.

Gene transfer of heterologous microorganisms by RNA polymerase formed by combining the sigma factor of the heterologous microorganisms with the core RNA polymerase of the host microorganism, the gene of the heterologous microorganism by RNA polymerase recognizes the promoter of the heterologous microorganism Can be transferred.

E. coli used in the following examples are not only strains well known in the art, but the host need not be limited to the practice of the present invention, and the vector or plasmid used is not only widely known or commercially available in the art but also There is no need to be limited to a particular vector or plasmid. In addition, the process of PCR amplification, introduction into a vector, transformation, etc. of a specific gene using these are well known techniques in the art. Therefore, the deposit of the transgenic host prepared according to the embodiment of the present invention was omitted.

Hereinafter, the present invention will be described in more detail by way of examples. However, the following examples illustrate the invention and are not intended to limit the scope of the invention.

< Example  >

Example  1. 3 xFLAG tag end fusion The rpoD  Gene Substitution with E. Coli

To reduce the affinity for the core RNA polymerase of RpoD, the major sigma factor, the 3xFLAG tag (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys). Asp-His-Asp-Ile-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was fused to the C-terminus of RpoD. The gene encoding the 3xFLAG tag was synthesized by annealing and ligation of FLAG1-f, FLAG1-r, FLAG2-f, FLAG2-r, FLAG3-f, and FLAG3-r oligonucleotides with each other. (FLAG (122bp)). E. coli rpoD gene segments, rpoD10 (496bp) is the E. coli chromosome as a template, rpoD-F10, the rpoD-R10, using as primers was amplified by PCR. rpoD gene downstream fragment, S3 (551bp) was E. coli chromosome as a template, SGF3-F, Bsa-rpoD-R as a primer was amplified by PCR.The fragments of these FLAG, rpoD10, S3 DNA were digested with Bsa I, purified, and then plasmid pKO3-BsaI (pKO3). in the the addition of Bsa I site cloned into the Bsa I position was modified plasmid) was prepared pKO3-rpoDF (1) wild-type for pKO3-rpoDF (wild type) W3110 and OmpT, ClpXP, Ron protease (Lon transformation of E. coli W3110 from which protease has been removed by electroporation W3110 strain, W3110-19 ( rpoD - FLAG ), W3110-18 ( Δ ompT , Δ lon , Δc), which were double cross-over, that is, the wild type rpoD gene on the chromosome was substituted with rpoD- 3xFLAG. l pP, rpoD - FLAG ) were screened, and the chromosomes of W3110-18 and W3110-19 were PCR amplified using rpoD-F10 and Bsa-rpoD-R primers, and the PCR fragments and lengths amplified in wild type W3110 were measured. Compared.

As shown in Figure 2, it was confirmed on the DNA that the FLAG is correctly substituted (1, 2 of Figure 2), and also using an anti-FLAG antibody (anti-FLAG antibody), RpoD-FLAG is expressed in E. coli It was confirmed at the protein level (3, 4, 5 of Figure 2).

Example  2. Actinomycetes sigma factor In vivo supply of

To feed the actinomycetes sigma factors HrdA, HrdB, HrdC, HrdD, SigB, SigE, SigF and sigH into E. coli, the gene encoding the above sigma factor was cloned into the expression vector pBAD33 to clone the araBAD promoter. Expression. The 3xFLAG tag was also fused to the C-terminus to detect expression in Escherichia coli of Actinomycetes sigmas. The coding region of each gene was PCR amplified using S. coelicolor chromosome as a template. The primers used were hrdA gene, hrdA-f, hrdA-r, hrdB gene, hrdB-f, hrdB-r, hrdC gene, hrdC-f, hrdC-r, hrdD gene, hrdD-f, hrdD-r, and sigB gene. SigB-f, sigB-r, sigE gene sigE-f, sigE-r, sigF gene sigF-f, sigF-r, sigH gene sigH-f, sigH-r was used. For hrdA, hrdB PCR products, for EcoRI-BsaI, hrdC, and hrdD PCR products, DNA fragments digested and purified with EcoRI-BbsI and FLAG fragments digested with BsaI-HindIII were cloned into the EcoRI-HindIII site of pBAD33. PBAD33-hrdA, pBAD33-hrdB, pBAD33-hrdC, and pBAD33-hrdD were prepared. The sigE PCR product was digested with EcoRI-BbsI, and the purified DNA fragment and FLAG fragment digested with BsaI-HindIII were cloned into the EcoRI-HindIII site of pBAD33 to prepare pBAD33-sigE. For sigB and sigF PCR products, NdeI-BsaI and sigH PCR product cloned NdeI-BbsI, and fragmented FLAG fragment with BsaI-HindIII to the NdeI-HindIII position of pBAD33-sigE. PBAD33-sigB, pBAD33-sigF, and pBAD33-sigH were prepared.

SEQ ID NO: designation order SEQ ID NO: 1 FLAG1-f GCGCGGATCCGGTCTCCGATTACAAAGACCATGACGGTGA SEQ ID NO: 2 FLAG1-r GGTCTTTGTAATCGGAGACCGGATCCGCGC SEQ ID NO: 3 FLAG2-f TTATAAAGATCATGATATCGATTACAAGGATGACGATGAC SEQ ID NO: 4 FLAG2-r ATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCAT SEQ ID NO: 5 FLAG3-f aagtaatgttaacgcggccgcgaattc SEQ ID NO: 6 FLAG3-r gaattcgcggccgcgttaacattacttgtcatcgtc SEQ ID NO: 7 rpoD-F10 gcgcggtctcacctggaccatcaacaagctcaac SEQ ID NO: 8 rpoD-R10 gcgcggtctctaatcatcgtccaggaagctacg SEQ ID NO: 9 SGF3-F gcgcggtctcaatcggtaggccggatcaggcgttacg SEQ ID NO: 10 Bsa-rpoD-R cgcggtctcaggtcctttcatccgccgggactg SEQ ID NO: 11 hrdA-f ATTA GAATTC AAGAAGGAGATATA CATATG CGAGGCGGACAGCGGCGAGC SEQ ID NO: 12 hrdA-r GCGC GGTCTC TAATCGTCCAGGTAGCCCCTCAGC SEQ ID NO: 13 hrdAm-f gcg catATG CGTGGTGGTCAACGTCGTGCCAGCCGGCTCCGCCCCCCGAC SEQ ID NO: 14 hrdA-r2 ggctgcgcgggca tcgcga gg SEQ ID NO: 15 hrdB-f GCGC GAATTC AAGAAGGAGATATACATATGTCGGCCAGCACATCCCG SEQ ID NO: 16 hrdB-r TAATAAGCTT GGTCTC GAATCGTCGAGGTAGTCGCGCAGCACCTG SEQ ID NO: 17 hrdC-f ATTA GAATTC AAGAAGGAGATATACATATGGCGCCCACGGCACGCACAC SEQ ID NO: 18 hrdC-r GCGC GAAGAC GTAATCGCTCGCCCAGTCCAGCAG SEQ ID NO: 19 hrdD-f GCGC GAATTC AAGAAGGAGATATACATATGGCAACCCGTGCCGTCGC SEQ ID NO: 20 hrdD-r GCGC GAAGAC GTAATCGGCCGCCGCCTCGAAGCCGGTGT SEQ ID NO: 21 sigB-f cgcgcatatgacgacgacgaccgcg SEQ ID NO: 22 sigB-r gcgcggtctctaatcggtggtgctgagcatgcc SEQ ID NO: 23 sigE-f gcgcgaattcaagaaggagatatacatatgggcgaggtgctcgagttc SEQ ID NO: 24 sigE-r gcatgaagactcaatcggccgcgcaacgctcccg SEQ ID NO: 25 sigF-f gcgcatatgccggccagtactgcgc SEQ ID NO: 26 sigF-r gcgcggtctctaatctgcgtcgatccggttcgc SEQ ID NO: 27 sigH-f gatcatatgcgtgacggggacgggccggtg SEQ ID NO: 28 sigH-r aagctgctcgtcgaggaggattacgtcttcgcgc SEQ ID NO: 29 lacZF10 gggatctagaggagggtttttaatgaccatgattacggattc SEQ ID NO: 30 lacZR10 ccccgggaaatacgggcagacatggc SEQ ID NO: 31 actIIF gccgaagcttgccgtatcaggaatgccagattctattg SEQ ID NO: 32 actIIR2 ctctagactgcgcccccgtcgagat SEQ ID NO: 33 redDF gagcggatcctctgccctctgaccgcggtgaacatcc SEQ ID NO: 34 redDR2 ctctagaccaccgaacgatcggattc SEQ ID NO: 35 dnrOF tattaagcttccactaggagaaccagcgcggc SEQ ID NO: 36 dnrOR2 ctctagagcttccagggtggcacga SEQ ID NO: 37 ccaRF cgcgaagcttacgggttcatcaaccggatgtcc SEQ ID NO: 38 ccaRR2 ctctagaggcggtcccccttgtgaag SEQ ID NO: 39 rpoCF1 ccaggatccgcacgacattctgcgtc SEQ ID NO: 40 rpoCR1 cgcaagcttattaatgatggtgatgatggtgctcgttatcagaaccgcccag SEQ ID NO: 41 rpoCF2 gggaagcttattaatcgttaatccgcaaataacg SEQ ID NO: 42 rpoCR2 ccctggatccgcgctaagttataacggtgctggc

As shown in FIG. 3, all sigma genes except for the hrdA gene were confirmed to be expressed in E. coli W3110-18 (FIG. 3). In order to increase the expression of the hrdA gene, synonymous codons using 2nd, 4th, 6th, and 7th codons of the hraA gene (rare codon) rarely used in Escherichia coli (primer hrdAm-f, hrdA-r2) were used. (highly used synonymous codon) and the plasmid containing this mutant hrdA (pBAD33-hrdA5) expressed HrdA to a similar extent as other actinomycetes sigma factor (FIG. 3).

Example  3. Actinomycetes sigma factor Escherichia coli using RNA 중합체 Reprogramming: lacZ reporter gene

CcaR of genes dnrO, S. clavuligerus of orf4, redD, S. peucetius - actinomycetes sigma factor to the actII, S. coelicolor to reprogram (reprogramming) to verify that you are able to recognize the Streptomyces promoter of E. coli RNA polymerase The promoter portion was fused with the lacZ gene and the lacZ titer was measured. The promoter was removed, the lacZ gene containing RBS was PCR amplified from E. coli chromosome using lacZF10 and lacZR10 primter, digested with SmaI and cloned into EcoRV of pUC21K to prepare pUC21K-lacZ plasmid. actII - promoter of orf4 is actIIF, actIIR2, redD promoter redDF, redDR2, dnrO promoter ccaRF, using ccaRR2 primer PCR amplification from the chromosome of each of the microorganisms and, HindIII - cleaved with XbaI, pUC21K-lacZ in HindIII - XbaI Cloned into position pUC21K-actIIL, pUC21K-redDL, pUC21K-dnrOL. pUC21K-ccaRL was prepared. The lacZ titer was measured as follows. Escherichia coli contains kanamycin (final 30 μg / ml), chloramphenicol (chloramphenicol; final 15 μg / ml) and medium (minimal medium; citric acid 2g / L, K ₂ HPO ₄ 10g / L, NaNH ₄ HPO _4). 3.5 g / L, MgSO ₄ 0.1 g / L, 0.2% casamino acid, 0.4% Glycerol) were pre-cultured overnight, and then cultured in 50 ml (500 ml flask) of the same medium. Expression of actinomycete sigma factor was induced by adding arabinose (final 0.2%) at mid log (OD ₆₀₀ 0.2-0,3). At a given time, cell cultures were taken, some measured OD ₆₀₀ to determine cell concentration, and the remaining cell cultures were used for lacZ titer measurements. Permeabilization solution (100 mM Na ₂ HPO _{4 ,} 20 mM KCl, 2 mM MgSO ₄ , 0.8 mg / mL hexadecyltrimethylammonium bromide), 0.4 mg / mL sodium deoxycholate, 5.4 μL / mL beta-mercaptoethanol) Μl was added and allowed to stand at room temperature for 5 minutes, followed by substrate solution (60 mM Na ₂ HPO ₄ , 40 mM NaH ₂ PO ₄ , 1 mg / mL o-nitrophenyl-β-D-Galactoside, 2.7 μL / 600 μl of mL β-mercaptoethanol) was added and reacted at 30 ° C. for 30 minutes to 1 hour. The reaction was stopped by adding 700 μl of Stop solution (1 M Na ₂ CO ₃ ), centrifuged at 13,000 rpm for 5 min to remove debris, and the absorbance was measured at 420 nm.

As shown in Figure 4, wild-type W3110 transformed pBAD33-hrdB and pCU21K-actIIL, and 0.2% arabinose was added to induce the expression of hrdB, even if the induction of hrdB is not much In contrast to W3110-18, lacZ titer increased more than threefold after the addition of arabinose (Figure 5). In the case of HrdB, compared to E. coli without sigma factor, it promoted the transcription of promoters of all the tested genes, and HrdC promoted the transcription of actII - orf4 and dnrO promoters. (Figure 6)

Example  4. Actinomycetes sigma factor Escherichia coli using RNA 중합체 Reprogramming: RNA 중합체  Purification by purification

Whether or not the minor sigma factor of the actinomycetes can reprogram E. coli RNA polymerase, the RNA polymerase was purified from Escherichia coli and the presence of actinomycetes sigma factor was examined in the RNA polymerase. . In order to easily purify E. coli RNA polymerase, a 6XHis tag fused gene at the C-terminus of the β 'subunit (RpoC) of the RNA polymerase was replaced with the rpoC gene on the colon chromosome. To this end, PCR amplification of beta 'frag1 fused to 6XHis at the C-terminus of RpoC using rpoCF1 and rpoCR1 primers, and beta' frag2 containing the downstream region of RpoC using rpoCF2 and rpoCR2 primers, using an E. coli chromosome. . The PCR product was BamHI - cut VspI, and cloned into the BamH I to prepare a location of pKO3 pKO3-rpoC. pKO3-rpoC was transformed into W3110-18 using electroporation, and then screened for W3110 strain, W3110-18 ', which was double cross-over, ie the wild-type rpoC gene on the chromosome was substituted with rpoD- 6XHis. (screening). The W3110-18 'was transformed with pBAD33-hrdA, pBAD33-hrdB, pBAD33-hrdC, and pBAD33-hrdD, and RNA polymerase was purified as follows. W3110-20 cells containing each plasmid were preincubated overnight in LB medium to which kanamycin (kanamycin, 30 μg / l) was added, followed by main culture in 25 ml of the same medium (500 ml flask). In the mid log, 0.2% arabinose was added to induce the expression of actinomycetes sigma factor, followed by further incubation for 4 hours, and the cells were recovered by centrifugation. 1 ml Binding Buffer (10 mM tris-HCl, pH 7.9), 5% glycerol, 0.1 mM EDTA, 6 mM beta-mercaptoethanol, 1 mM imidazol, 0.1 M NaCl) was added and the cells were suspended, followed by 6 μl of lysozyme (50 mg / ml), 5 μl of deoxycholate (5%), 1 μl of RNase A (10 mg / ml), 1.2 μl of PMSF. (10 mg / ml) was added and cells were disrupted using sonication. Debris was removed by centrifugation at 12000 rpm 20min 4 ° C, mixed with 50 μl of Talon metal affinity Resin (Clontech) and RNA polymerase bound to the resin at 1 hr ice. Centrifugation at 3000 rpm 1min RT to precipitate the resin, followed by 1 ml Washing buffer I (10 mM tris-HCl (pH 7.9), 5% gycerol, 0.1 mM EDTA, 6 mM beta-mercaptoethanol, 1 mM imidazol, 0.5 M NaCl), 1 ml Washing buffer II; 10 mM tris-HCl (pH 7.9), 5% gycerol, 0.1 mM EDTA, 6 mM beta-mercaptoethanol, 1 mM imidazol, 40 mM Glycin), 1 ml washing buffer III (Washing buffer III; resin was washed with 10 mM tris-HCl (pH 7.9), 5% gycerol, 0.1 mM EDTA, 6 mM beta-mercaptoethanol, 10 mM imidazol, 0.1 M NaCl). This resin was eluted with 60 μl of elution buffer (10 mmM tris-HCl, pH 7.9), 5% gycerol, 0.1 mM EDTA, 6 mM beta-mercaptoethanol, 100 mM imidazol, 0.1 M NaCl).

As shown in Figure 7, purified RNA polymerase was confirmed through SDS PAGE. As a result of Western blot using anti-FLAG antibody (anti-FLAG antiboty) to investigate the presence of actinomycetes sigma factors in purified RNA polymerase (Fig. 8), actinomycetes sigma It was confirmed that the amount of the factor was greater than that of E. coli rpoD.

Claims (10)

(A) sigma factors of one or more actinomycetes selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF and sigH; And
(B) 3xFLAG at the 5 'end (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-Asp-Tyr-Lys-Asp-Asp-Asp-Asp -Lys) Escherichia coli sigma factor that fuses the sequence to reduce the affinity with E. coli core RNA polymerase;
E. coli host microorganism expressing a heterologous gene comprising a. delete delete delete delete The method of claim 1,
The E. coli host microorganism is E. coli host microorganism characterized in that one or more selected from the group consisting of Lon protease, ClpP protease, and Omptin protease. The method of claim 1,
(A) sigma factors of one or more actinomycetes selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF and sigH; And
(B) rpoD, a sigma factor of E. coli, which reduced the affinity of the core RNA polymerase of E. coli by fusing 3xFLAG sequences at the 5 'end;
(C) Escherichia coli host microorganism, characterized in that one or more selected from the group consisting of Lon protease, ClpP protease, and Omptin protease. delete (A) preparing a recombinant vector containing at least one actinomycete sigma factor selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF, and sigH;
(B) 3xFLAG (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-) at the 5 'end, which reduced E. coli affinity with the core RNA polymerase. Preparing a recombinant vector containing Sigma factor of Escherichia coli fused with Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) sequence; And
(C) transforming E. coli from which at least one selected from the group consisting of Lon protease, ClpP protease, and Omptin protease is removed with the vector of step (a) and the vector of step (b) step;
Method for producing a E. coli host microorganism expressing a heterologous gene comprising a. (A) preparing a recombinant vector containing at least one actinomycete sigma factor selected from the group consisting of hrdA, hrdB, hrdC, hrdD, sigB, sigE, sigF, and sigH;
(B) 3xFLAG (Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-) at the 5 'end, which reduced E. coli affinity with the core RNA polymerase. Preparing a recombinant vector containing Sigma factor of Escherichia coli fused with Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) sequence; And
(C) transforming E. coli with the vector of step (a) and the vector of step (b);
(D) inducing expression of said actinomycete sigma factor; And
(ㅁ) transcription of the actinomycete gene by the RNA polymerase formed by combining the sigma factor of the actinomycetes and the core RNA polymerase of E. coli;
Gene expression method of actinomycetes comprising a.

Images