KR101263103B1 - Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same - Google Patents

Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same Download PDF

Info

Publication number
KR101263103B1
KR101263103B1 KR1020110005159A KR20110005159A KR101263103B1 KR 101263103 B1 KR101263103 B1 KR 101263103B1 KR 1020110005159 A KR1020110005159 A KR 1020110005159A KR 20110005159 A KR20110005159 A KR 20110005159A KR 101263103 B1 KR101263103 B1 KR 101263103B1
Authority
KR
South Korea
Prior art keywords
cd1d
protein
expression
cell
cells
Prior art date
Application number
KR1020110005159A
Other languages
Korean (ko)
Other versions
KR20120083814A (en
Inventor
전태훈
한지혜
이석준
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Priority to KR1020110005159A priority Critical patent/KR101263103B1/en
Publication of KR20120083814A publication Critical patent/KR20120083814A/en
Application granted granted Critical
Publication of KR101263103B1 publication Critical patent/KR101263103B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/162—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/50—Cell markers; Cell surface determinants
    • C12N2501/599—Cell markers; Cell surface determinants with CD designations not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16133—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 CD1d 발현을 감소조절하는 싸이토메갈로바이러스(Cytomegalovirus)의 US2(unique short 2) 유전자를 포함하는 자연살해 T 세포(NKT cell) 활성 억제용 조성물 및 이를 이용한 NKT 세포 활성 억제 방법에 관한 것이다. 상기한 본 발명에 의하면, 생체 내 면역계에 중요한 작용을 하는 NKT 림프구 활성을 제어할 수 있고 이를 이용하여 자가면역질환을 치료 또는 예방할 수 있다.The present invention relates to a composition for inhibiting natural killer T cell (NKT cell) activity comprising a unique short 2 (US2) gene of Cytomegalovirus that reduces and regulates CD1d expression, and a method for inhibiting NKT cell activity using the same. . According to the present invention described above, it is possible to control the activity of NKT lymphocytes that play an important role in the immune system in vivo, and can use this to treat or prevent autoimmune diseases.

Description

ＣＤ１ｄ 발현을 감소조절하는 ＵＳ２ 단백질 유전자를 포함하는 자연 살해 Ｔ 세포활성 억제용 조성물 및 이를 이용한 자연 살해 Ｔ 세포 활성 억제 방법{Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same} Composition for inhibiting natural killing T cell activity, including a CS2 protein gene that reduces and regulates CD1 expression and a method for inhibiting natural killing T cell activity using the composition using the same}

본 발명은 CD1d 발현을 감소조절하는 US2 단백질 유전자를 포함하는 자연 살해 T 세포 활성 억제용 조성물 및 이를 이용한 자연 살해 T 세포 활성 억제 방법에 관한 것이다. 더욱 상세하게 본 발명은 유비퀴틴-프로테오좀에 의한 단백질 분해과정을 통해 매개되는 싸이토메갈로바이러스(Cytomegalovirus) US2 단백질에 의한 인간 CD1d 분자의 발현 감소 기작을 이용하는 US2 단백질 유전자를 포함하는 자연 살해 T 세포 활성 억제용 조성물 및 이를 이용한 자연 살해 T 세포 활성 억제 방법에 관한 것이다.
The present invention relates to a composition for inhibiting natural killer T cell activity, comprising a US2 protein gene that reduces and regulates CD1d expression, and a method for inhibiting natural killer T cell activity using the same. More specifically, the present invention provides a natural killer T cell comprising a US2 protein gene that utilizes a mechanism for reducing expression of human CD1d molecules by Cytomegalovirus US2 protein mediated through proteolysis by ubiquitin-proteosomes. It relates to a composition for inhibiting activity and a method for inhibiting natural killer T cell activity using the same.

싸이토메갈로바이러스(Cytomegalovirus; CMV)는 US2 (Unique short 2) 유전자를 인코드(encode)하는데, 이는 소포체(Endoplasmic reticulum) 표면에 존재하는 당단백질로, CMV에 감염된 숙주세포에서의 면역반응을 회피하는 기전에 관여한다(de Jong et al., 1998; Pleogh, 1998; Seriger et al., 2006). Cytomegalovirus (CMV) encodes the US2 (Unique short 2) gene, a glycoprotein on the surface of the endoplasmic reticulum that avoids immune responses in CMV-infected host cells. (De Jong et al., 1998; Pleogh, 1998; Seriger et al., 2006).

주요조직 적합성 항원(Major histocompatability complex, MHC)은 1형과 2형으로 나뉘며 제 1형 MHC는 핵을 가지는 모든 세포에서 발현되며 소포체에서 세포내부에서 유래된 항원과 결합하여 세포 표면으로 발현됨으로써 세포내부의 항원을 특정 세포독성 T 림프구(cytotoxic T lymphocyte)에 제시하여 세포성 면역 반응을 매개하는 역할을 한다(Van Kaer, 2002). 제 2형 MHC는 전문 항원 제시세포(professional antigen presenting cell)에서 발현되며, 세포질에서 소포 형태로 이동하는데, 이때 세포내이입(endocytosis)을 통해 세포 내부로 들어온 외부항원과 결합하여, 이를 보조 T 림프구 (helper T lymphocyte)에 전달하여 면역반응을 일으킨다(Wolf and Ploegh, 1995). Major histocompatability complex (MHC) is divided into type 1 and type 2, and type 1 MHC is expressed in all cells with a nucleus and in the endoplasmic reticulum is expressed on the cell surface by binding to antigen derived from the cell. Antigens are presented to specific cytotoxic T lymphocytes to mediate cellular immune responses (Van Kaer, 2002). Type 2 MHC is expressed in professional antigen presenting cells and migrates from the cytoplasm to the vesicle form, where it binds to external antigens that enter the cell through endocytosis, which are secondary T lymphocytes. (helper T lymphocytes) to produce an immune response (Wolf and Ploegh, 1995).

항원제시를 통한 면역 반응 활성 과정에서 CMV의 US2는 직접적인 단백질간의 결합을 통해 인간의 제 1형과 제 2형 MHC를 소포체 내부로부터 세포질로 이동시키고, 이로 인해 두 주요조직 적합성 항원을 유비퀴틴-프로테오좀 단백질 분해 시스템을 통하여 분해시키는 역할을 한다(Tomazin et al., 1999; Boss et al., 1997; Ahn et al., 1996; Gewurz et al., 2001). 결과적으로 세포 내부의 주요조직 적합성 항원의 세포 표면으로의 발현이 감소되고 이로 인해 이들의 항원 제시 기능이 억제되어 특정 T세포와 이들의 상호작용을 통해 매개되는 면역반응이 억제시켜, 바이러스 감염시 숙주 세포에서의 면역반응을 회피할 수 있도록 돕는 역할을 한다(Ploegh, 1998; Seliger et al., 2006). In the process of activating the immune response through antigen presentation, US2 of CMV transfers human type 1 and type 2 MHC from the inside of the endoplasmic reticulum to the cytoplasm through direct protein-binding, thereby ubiquitin-proteo More proteolytic systems (Tomazin et al., 1999; Boss et al., 1997; Ahn et al., 1996; Gewurz et al., 2001). As a result, the expression of major histocompatibility antigens inside the cell to the cell surface is reduced, thereby inhibiting their antigen presenting function, thereby suppressing immune responses mediated through their interaction with specific T cells, resulting in host infection during virus infection. Helps to evade immune responses in cells (Ploegh, 1998; Seliger et al., 2006).

인간 CD1은 제 1형 MHC와 구조적으로 유사한 분자로서, 43-49kDa의 heavy chain과 12kDa의 β2-microglobulin (β2m) light chain으로 구성되며 항원인식물질로 알려져 있다(Martin et al., 1986). CD1 유전자는 인간 염색체 1q22-23에 위치하고, 5개 유전자(CD1A, CD1B, CD1C, CD1D, CD1E)가 존재한다(Moseley et al., 1989). CD1은 두 그룹으로 분리되는데, 그룹 1은 CD1a, CD1b, CD1c로 구성되고 전문 항원 제시세포에서 발현 된다. 또한 그룹 2는 CD1d로 구성되고, 주로 수지상 세포(dendritic cells), 위장의 상피세포(gastrointestinal epithelial cells)에서 발현한다(Canchis et al., 1993). CD1d는 매우 hydrophobic한 항원인식부위를 가지고 있어서 기존의 펩티드(peptide) 항원을 인식하는 것이 아니라 당지질(glycolipid)을 인식한다. 또한 이런 당지질 항원을 기존의 conventional T 림프구에 전달해주는 것이 아니라 자연 살해 T 세포(NKT cell)에 제시하는 분자로 알려졌다(Spada et al., 1998). Human CD1 is a structurally similar molecule to type 1 MHC, and is composed of a 43-49kDa heavy chain and a 12kDa β2-microglobulin (β2m) light chain and is known as an antigen recognition agent (Martin et al., 1986). The CD1 gene is located on human chromosome 1q22-23 and there are five genes (CD1A, CD1B, CD1C, CD1D, CD1E) (Moseley et al., 1989). CD1 is divided into two groups, group 1 consisting of CD1a, CD1b and CD1c and expressed in specialized antigen presenting cells. Group 2 also consists of CD1d and is expressed mainly in dendritic cells and gastrointestinal epithelial cells (Canchis et al., 1993). CD1d has a very hydrophobic antigen-recognition site that recognizes glycolipids rather than conventional peptide antigens. In addition, the glycolipid antigen is known to be a molecule that presents to natural killer T cells (NKT cells) rather than to the conventional conventional T lymphocytes (Spada et al., 1998).

자연 살해 T 세포(NKT cell)는 NK receptor와 T cell receptor를 공동으로 발현하는 특별한 T 림프구이다(Bendelac et al., 2007). 자연 살해 T 세포(NKT cell)는 주로 흉선과 간에 존재하며, 주요 subset은 CD1d에 의해 제공되는 당지질(alpha-galactosylceramide; KRN 7000)의 자극 시에 활성화되며, 활성화된 NKT 림프구는 IL-4와 IFN-γ와 같은 사이토카인(cytokine)을 매우 다량 분비하여 여러 질병에서 빠른 반응을 일으킨다(Carnaud et al., 1999; Kitamura et al., 2000). 따라서, 자연 살해 T 세포(NKT cell)는 박테리아나 기생충의 감염(Chackerian et al., 2002; Gonzalez-Aseguinolaza et al., 2000), 암의 발생(Kawano et al., 1998), 자가면역 질환의 숙주 보호(Hong et al., 2001)의 경우에서 효과가 있는 것으로 알려져 있다. 결국 자연 살해 T 세포(NKT cell)의 활성 기전 연구는 의학적으로 매우 중요하게 여겨지고 있다.Natural killer T cells (NKT cells) are special T lymphocytes that co-express NK receptors and T cell receptors (Bendelac et al., 2007). Natural killer T cells (NKT cells) are mainly present in the thymus and liver, the major subsets are activated upon stimulation of alpha-galactosylceramide (KRN 7000) provided by CD1d, and activated NKT lymphocytes are IL-4 and IFN. Very high secretion of cytokines such as -γ causes rapid response in many diseases (Carnaud et al., 1999; Kitamura et al., 2000). Thus, natural killer T cells (NKT cells) are known to be infected by bacteria or parasites (Chackerian et al., 2002; Gonzalez-Aseguinolaza et al., 2000), the development of cancer (Kawano et al., 1998), and autoimmune diseases. It is known to be effective in the case of host protection (Hong et al., 2001). As a result, the study of the mechanism of action of natural killer T cells (NKT cells) is considered very important medically.

CMV US2 단백질에 의한 면역 회피작용은 주요조직 적합성 항원의 발현 감소를 통한 것으로 알려져 있으나, 자연 살해 T 세포(NKT cell)에 항원을 제시하는 CD1d 분자의 발현에 어떠한 영향을 미치는 지에 대해서는 아직 연구되어지지 않았다.
Although immune evasion by CMV US2 protein is known to reduce the expression of major histocompatibility antigens, the effect of CMV US2 protein on the expression of CD1d molecules presenting antigens to NKT cells has not been studied. Did.

Ahn K, Angulo A, Ghazal P, Peterson PA, Yang Y, FrK. 1996. Human cytomegalovirus inhibits antigen presentation by a sequential multistep process. Proc Natl Acad Sci USA. 93:10990-10995.Ahn K, Angulo A, Ghazal P, Peterson PA, Yang Y, FrK. 1996. Human cytomegalovirus inhibits antigen presentation by a sequential multistep process. Proc Natl Acad Sci USA. 93: 10990-10995. Bendelac A, Savage PB, Teyton L. 2007. The biology of NKT cells. Annu Rev Immunol. 25:297-336. Bendelac A, Savage PB, Teyton L. 2007. The biology of NKT cells. Annu Rev Immunol. 25: 297-336. Boss JM. Regulation of transcription of MHC class II genes. 1997. Curr Opin Immunol. 9:107-113.Boss JM. Regulation of transcription of MHC class II genes. 1997. Curr Opin Immunol. 9: 107-113. Canchis PW, Bhan AK, Landau SB, Yang L, Balk SP, Blumberg RS. 1993. Tissue distribution of the non-polymorphic major histocompatibility complex class I-like molecule, CD1d. Immunology. 80:561-565.Canchis PW, Bhan AK, Landau SB, Yang L, Balk SP, Blumberg RS. 1993. Tissue distribution of the non-polymorphic major histocompatibility complex class I-like molecule, CD1d. Immunology. 80: 561-565. Carnaud C, Lee D, Donnars O, Park SH, Beavis A, Koezuka Y, Bendelac A. 1999. Cross-talk between cells of the innate immune system: NKT cells rapidly activate NK cells. J Immunol. 163:4647-4650.Carnaud C, Lee D, Donnars O, Park SH, Beavis A, Koezuka Y, Bendelac A. 1999. Cross-talk between cells of the innate immune system: NKT cells rapidly activate NK cells. J Immunol. 163: 4647-4650. Chackerian A, Alt J, Perera V, Behar SM. 2002. Activation of NKT cells protects mice from tuberculosis. Infect Immun. 70:6302-6309.Chackerian A, Alt J, Perera V, Behar SM. 2002.Activation of NKT cells protects mice from tuberculosis. Infect Immun. 70: 6302-6309. Chen YH, Wang B, Chun T, Zhao L, Cardell S, Behar SM, Brenner MB, Wang CR. Expression of CD1d2 on thymocytes is not sufficient for the development of NKT cells in CD1d1-deficient mice. 1999. J Immunol. 162:4560-4566.Chen YH, Wang B, Chun T, Zhao L, Cardell S, Behar SM, Brenner MB, Wang CR. Expression of CD1d2 on thymocytes is not sufficient for the development of NKT cells in CD1d1-deficient mice. 1999. J Immunol. 162: 4560-4566. de Jong MD, Galasso GJ, Gazzard B, Griffiths PD, Jabs DA, Kern ER, Spector SA. 1998. Summary of the II International Symposium on Cytomegalovirus. Antiviral Res. 39:141-162.de Jong MD, Galasso GJ, Gazzard B, Griffiths PD, Jabs DA, Kern ER, Spector SA. 1998. Summary of the II International Symposium on Cytomegalovirus. Antiviral Res. 39: 141-162. Gewurz BE, Gaudet R, Tortorella D, Wang EW, Ploegh HL, Wiley DC. 2001. Antigen presentation subverted: Structure of the human cytomegalovirus protein US2 bound to the class I molecule HLA-A2. Proc Natl Acad Sci USA. 98:6794-6799.Gewurz BE, Gaudet R, Tortorella D, Wang EW, Ploegh HL, Wiley DC. 2001. Antigen presentation subverted: Structure of the human cytomegalovirus protein US2 bound to the class I molecule HLA-A2. Proc Natl Acad Sci USA. 98: 6794-6799. Gonzalez-Aseguinolaza G, de Oliveira C, Tomaska M, Hong S, Bruna-Romero O, Nakayama T, Taniguchi M, Bendelac A, Van Kaer L, Koezuka Y, Tsuji M. alpha-galactosylceramide-activated Valpha 14 natural killer T cells mediate protection against murine malaria. 2000. Proc Natl Acad Sci USA.97:8461-8496.Gonzalez-Aseguinolaza G, de Oliveira C, Tomaska M, Hong S, Bruna-Romero O, Nakayama T, Taniguchi M, Bendelac A, Van Kaer L, Koezuka Y, Tsuji M. alpha-galactosylceramide-activated Valpha 14 natural killer T cells mediate protection against murine malaria. 2000. Proc Natl Acad Sci USA. 97: 8461-8496. Hong S, Wilson MT, Serizawa I, Wu L, Singh N, Naidenko OV, Miura T, Haba T, Scherer DC, Wei J, Kronenberg M, Koezuka Y, Van Kaer L. 2001. The natural killer T-cell ligand alpha-galactosylceramide prevents autoimmune diabetes in non-obese diabetic mice. Nat Med. 7:1052-1056.Hong S, Wilson MT, Serizawa I, Wu L, Singh N, Naidenko OV, Miura T, Haba T, Scherer DC, Wei J, Kronenberg M, Koezuka Y, Van Kaer L. 2001.The natural killer T-cell ligand alpha -galactosylceramide prevents autoimmune diabetes in non-obese diabetic mice. Nat Med. 7: 1052-1056. Ito H, Fukada Y, Murata K, Kimura A. 1983. Transformation of intact yeast cells treated with Alkali Cations. J Bacteriol. 153:163-168.Ito H, Fukada Y, Murata K, Kimura A. 1983. Transformation of intact yeast cells treated with Alkali Cations. J Bacteriol. 153: 163-168. Kawano T, Cui J, Koezuka Y, Toura I, Kaneko Y, Sato H, Kondo E, Harada M, Koseki H, Nakayama T, Tanaka Y, Taniguchi M. 1998. Natural killer-like nonspecific tumor cell lysis mediated by specific ligand-activated Valpha14 NKT cells. Proc Natl Acad Sci USA. 95:5690-5693.Kawano T, Cui J, Koezuka Y, Toura I, Kaneko Y, Sato H, Kondo E, Harada M, Koseki H, Nakayama T, Tanaka Y, Taniguchi M. 1998. Natural killer-like nonspecific tumor cell lysis mediated by specific ligand -activated Valpha14 NKT cells. Proc Natl Acad Sci USA. 95: 5690-5693. Kitamura H, Ohta A, Sekimoto M, Sato M, Iwakabe K, Nakui M, Yahata T, Meng H, Koda T, Nishimura S, Kawano T, Taniguchi M, Nishimura T. 2000. alpha-galactosylceramide induces early B-cell activation through IL-4 production by NKT cells. Cell Immunol. 199:37-42.Kitamura H, Ohta A, Sekimoto M, Sato M, Iwakabe K, Nakui M, Yahata T, Meng H, Koda T, Nishimura S, Kawano T, Taniguchi M, Nishimura T. 2000.alpha-galactosylceramide induces early B-cell activation through IL-4 production by NKT cells. Cell Immunol. 199: 37-42. Martin LH, Calabi F, Milstein C. 1986. Isolation of CD1 genes: A family of major histocompatibility complex-related differentiation antigens. Proc. Natl. Acad. Sci. USA. 83:9154-9158.Martin LH, Calabi F, Milstein C. 1986. Isolation of CD1 genes: A family of major histocompatibility complex-related differentiation antigens. Proc. Natl. Acad. Sci. USA. 83: 9154-9158. Moseley WS, Watson ML, Kingsmore SF, Seldin MF. 1989. CD1 defines conserved linkage group border between human chromosomes 1 and mouse chromosomes 1 and 3. Immunogenetics 30:378-382.Moseley WS, Watson ML, Kingsmore SF, Seldin MF. 1989. CD1 defines conserved linkage group border between human chromosomes 1 and mouse chromosomes 1 and 3. Immunogenetics 30: 378-382. Ploegh HL. 1998. Viral strategies of immune evasion. Science. 280:249-253.Ploegh HL. 1998. Viral strategies of immune evasion. Science. 280: 249-253. Seliger B, Ritz U, Ferrone S. 2006. Molecular mechanisms of HLA class I antigen abnormalities following viral infection and transformation. Int J Cancer. 118:129-138.Seliger B, Ritz U, Ferrone S. 2006. Molecular mechanisms of HLA class I antigen abnormalities following viral infection and transformation. Int J Cancer. 118: 129-138. Spada FM, Koezuka Y, Porcelli, SA. 1998. CD1drestricted recognition of synthetic glycolipid antigens by human natural killer T cells. J Exp Med. 188:1529-1534.Spada FM, Koezuka Y, Porcelli, SA. 1998. CD1drestricted recognition of synthetic glycolipid antigens by human natural killer T cells. J Exp Med. 188: 1529-1534. Tomazin R, Boname J, Hegde NR, Lewinsohn DM, Altschuler Y, Jones TR, Cresswell P, Nelson JA, Riddell SR, Johnson DC. 1999. Cytomegalovirus US2 destroys two components of the MHC class II pathways, preventing recognition by CD4+ T cells. Nat Med. 5:1039-1043.Tomazin R, Boname J, Hegde NR, Lewinsohn DM, Altschuler Y, Jones TR, Cresswell P, Nelson JA, Riddell SR, Johnson DC. 1999. Cytomegalovirus US2 destroys two components of the MHC class II pathways, preventing recognition by CD4 + T cells. Nat Med. 5: 1039-1043. Van Kaer L. 2002. Major histocompatibility complex class I-restricted antigen processing and presentation. Tissue Antigens. 60:1-9.Van Kaer L. 2002. Major histocompatibility complex class I-restricted antigen processing and presentation. Tissue Antigens. 60: 1-9. Wolf PR, Ploegh HL. 1995. How MHC molecules acquire peptide cargo: biosynthesis and trafficking through the endocytic pathway. Annu Rev Cell Dev Biol. 11:267-306.Wolf PR, Ploegh HL. 1995. How MHC molecules acquire peptide cargo: biosynthesis and trafficking through the endocytic pathway. Annu Rev Cell Dev Biol. 11: 267-306.

본 발명은 상기 종래 기술의 문제점을 해결하기 위해 안출된 것으로, 본 발명의 목적은 CD1d 발현을 감소조절하는 US2 단백질 유전자를 포함하는 자연 살해 T 세포(NKT cell) 활성 억제용 조성물을 제공하는 것이다.The present invention has been made to solve the problems of the prior art, an object of the present invention is to provide a composition for inhibiting natural killer T cell (NKT cell) activity comprising a US2 protein gene that reduces and regulates CD1d expression.

본 발명의 다른 목적은 상기 조성물을 유효성분으로 함유하는 자가면역질환 치료 또는 예방용 조성물을 제공하는 것이다.Another object of the present invention to provide a composition for treating or preventing autoimmune diseases containing the composition as an active ingredient.

본 발명의 또 다른 목적은, 유비퀴틴-프로테오좀에 의한 단백질 분해과정을 통해 매개되는 싸이토메갈로바이러스(Cytomegalovirus) US2 단백질에 의한 인간 CD1d 분자의 발현을 감소조절하는 것을 포함하는 자연 살해 T 세포(NKT cell) 활성 억제 방법을 제공하는 것이다.Still another object of the present invention is to provide a method for natural killer T cells comprising reducing and regulating the expression of human CD1d molecules by cytomegalovirus US2 protein mediated through proteolysis by ubiquitin-proteosomes. NKT cell) to provide a method for inhibiting activity.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 더욱 명확하게 된다.
Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 CD1d 발현을 감소조절하는 싸이토메갈로바이러스(Cytomegalovirus)의 US2(unique short 2) 유전자를 포함하는 자연살해 T 세포(NKT cell) 활성 억제용 조성물을 제공한다.According to an aspect of the present invention, the present invention provides a composition for inhibiting natural killer T cell (NKT cell) activity comprising a US2 (unique short 2) gene of Cytomegalovirus that reduces and regulates CD1d expression. .

본 발명에서, 일반적으로 CD1d는 당지질을 항원으로 인지하여 NKT 세포를 활성화한다고 알려져 있다. 본 발명의 실시예에서 CMV US2 단백질이 과발현된 CD1d.C1R 세포주에서 세포 전체와 세포표면에서의 CD1d의 발현량이 감소하고, 이로 인하여 NKT 세포의 활성이 억제됨을 확인하였다.In the present invention, CD1d is generally known to activate NKT cells by recognizing glycolipids as antigens. In the embodiment of the present invention, in the CD1d.C1R cell line overexpressed with CMV US2 protein, the expression level of CD1d in the whole cell and cell surface was reduced, thereby inhibiting the activity of NKT cells.

본 발명에서는, NKT 세포로 항원을 전달하는 CD1d의 발현을 조절함으로써 생체 내 면역계에 중요한 작용을 하는 NKT 세포 활성 제어를 할 수 있으며, 이를 이용할 경우 자연 살해 T 세포(NKT cell) 활성 억제용 조성물을 제공할 수 있다.In the present invention, it is possible to control the activity of NKT cells that play an important role in the immune system by regulating the expression of CD1d that delivers antigens to NKT cells. Can provide.

본 발명에서, 상기 싸이토메갈로바이러스(Cytomegalovirus)의 US2(unique short 2) 유전자는 발현 벡터로 포함되는 것이 바람직하다. 상기 발현 벡터는 상기 US2 유전자의 발현을 유도할 수 있는 한 특별한 제한이 없으며, 본 발명의 실시예에서는 bsd EGFP IRES3 CL 발현 vector를 이용하였다(도 1 참조). 상기 US2 유전자 발현 벡터는 숙주세포에 도입될 수 있다. 본 발명의 실시예에서는 CD1d 분자의 발현 감소를 확인하기 위해 CD1d.C1R 세포주에 도입되었다.
In the present invention, the US2 (unique short 2) gene of the cytomegalovirus (Cytomegalovirus) is preferably included as an expression vector. The expression vector is not particularly limited as long as it can induce the expression of the US2 gene, and the embodiment of the present invention used a bsd EGFP IRES3 CL expression vector (see FIG. 1). The US2 gene expression vector may be introduced into a host cell. In an embodiment of the present invention it was introduced into the CD1d.C1R cell line to confirm the decreased expression of the CD1d molecule.

본 발명의 다른 양태에 따르면, 본 발명은 상기 자연 살해 T 세포(NKT cell) 활성 억제용 조성물을 유효성분으로 함유하는 자가면역질환 치료 또는 예방용 조성물을 제공한다.According to another aspect of the present invention, the present invention provides a composition for treating or preventing autoimmune diseases containing the composition for inhibiting natural killer T cell (NKT cell) activity as an active ingredient.

본 발명의 자가면역질환 치료 또는 예방용 조성물에서, NKT 림프구는 보통의 T 림프구와는 인식하는 항원의 종류와 기능 등에서 차이가 나며 면역조절세포로서의 기능을 수행한다. NKT 림프구는 Th1 type의 사이토카인 IFN-γ와 Th2 type의 사이토카인 IL-4를 분비하는데, 여러 가지 면역반응이 Th1 또는 Th2 사이토카인들에 의해 조절되는 상황에 비추어보면 특정 면역과정의 조절에 매우 중요한 역할을 한다는 것을 의미한다. 전신성 홍반성 루프스 (Systemic Lupus Erythematosus, SLE)와 같은 자가면역질환에서 CD1d-autoreactive한 NKT 세포는 IFN-γ를 분비하는 세포들이 병세를 악화시킨다는 것이 알려져 있다 (Zeng D, et al., 1998). 또한 NKT 세포들이 정상적인 종양 면역감시 (tumor immunosurveillance) 과정을 억제하여 암의 발생을 촉진한다는 보고가 있다 (Cui J, et al., 1997; Kodama T, et al., 1999; Terabe M, et al., 2005).In the composition for treating or preventing autoimmune diseases of the present invention, NKT lymphocytes differ from ordinary T lymphocytes in the type and function of antigens recognized and perform functions as immunomodulatory cells. NKT lymphocytes secrete Th1 type cytokine IFN-γ and Th2 type cytokine IL-4, which are highly regulated in the control of specific immune processes in light of the situation where various immune responses are regulated by Th1 or Th2 cytokines. It means playing an important role. In autoimmune diseases such as Systemic Lupus Erythematosus (SLE), CD1d-autoreactive NKT cells are known to exacerbate the condition of cells secreting IFN-γ (Zeng D, et al., 1998). It has also been reported that NKT cells promote the development of cancer by inhibiting the normal tumor immunosurveillance process (Cui J, et al., 1997; Kodama T, et al., 1999; Terabe M, et al. , 2005).

따라서, CMV US2 단백질을 과발현하면 항원제시세포 (antigen presenting cell, APC)에서 발현하는 CD1d 발현양도 감소되고 NKT 세포가 불활성화 될 것이다. 그러면, 자가면역질환 및 감염성 질환을 치료 및/또는 예방할 수 있다.Therefore, overexpression of CMV US2 protein will also reduce the amount of CD1d expression expressed in antigen presenting cells (APC) and inactivate NKT cells. It is then possible to treat and / or prevent autoimmune diseases and infectious diseases.

본 발명의 약학적 조성물은 본 발명의 US2 유전자와 약학적으로 허용 가능한 담체와 함께 함유하는 것을 포함하며, 상기 US2 유전자는 적절한 벡터, 예컨대 동물세포 발현용 벡터, 렌티바이러스 벡터, 레트로바이러스 벡터, 아데노바이러스 벡터 등에 삽입된 형태로 포함하는 것이 바람직하다.The pharmaceutical composition of the present invention includes the US2 gene of the present invention together with a pharmaceutically acceptable carrier, wherein the US2 gene is a suitable vector such as animal cell expression vector, lentiviral vector, retroviral vector, adeno It is preferably included in the form inserted into a viral vector or the like.

본 발명의 US2 유전자를 유효성분으로 함유하는 자가면역질환 치료용 조성물은 임상투여 시에 경구 또는 비경구로 투여가 가능하며 일반적인 의약품제제의 형태로 사용될 수 있다.The composition for treating autoimmune diseases containing the US2 gene of the present invention as an active ingredient can be administered orally or parenterally during clinical administration and can be used in the form of general pharmaceutical preparations.

즉, 본 발명의 약학적 조성물은 실제 임상투여시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있으며, 제제화할 경우 주사제 등 당업계에서 약제학적으로 잘 알려진 방법을 사용하여 제제화할 수 있다.That is, the pharmaceutical composition of the present invention may be administered in various oral and parenteral dosage forms during actual clinical administration, and when formulated, may be formulated using a method well known in the art such as injection.

본 발명의 약학적 조성물의 유효용량은 0.1 ∼ 5 mg/kg 이고, 바람직하게는 1 ∼ 2 mg/kg 이며, 하루 1 ~ 3회 투여될 수 있다.The effective dose of the pharmaceutical composition of the present invention is 0.1 to 5 mg / kg, preferably 1 to 2 mg / kg, may be administered 1 to 3 times a day.

본 발명의 약학적 조성물에서, 상기 조성물은 본 발명의 유효성분인 상기 US2 유전자를 포함하는 바이러스 클론 또는 그 발현 단백질 외에 생물제제에 통상 사용되는 안정화제 및 담체, 보조 활성성분 등을 더 포함할 수 있으며, 면역활성 억제를 위해 주사제 형태로 인체에 투여될 수 있다. 이 때 환자에게 투여될 바이러스 클론 입자의 적정 수는 환자의 중한 상태에 따라 다르나 바람직하게는 체중 kg당 100 ~2000 MOI 정도이고, 발현 단백질의 경우는 성인 기준 일당 100 μg ~ 1000 mg 정도이다.
In the pharmaceutical composition of the present invention, the composition may further include stabilizers and carriers commonly used in biologics, auxiliary active ingredients, etc., in addition to the viral clone or the expressed protein thereof comprising the US2 gene which is the active ingredient of the present invention. It may be administered to the human body in the form of an injection for suppressing immunological activity. The appropriate number of virus clone particles to be administered to the patient at this time depends on the patient's severe condition, but preferably about 100 to 2000 MOI per kg body weight, and about 100 μg to 1000 mg per day for the expressed protein.

본 발명의 다른 양태에 따르면, 본 발명은 인간외 동물에서, 싸이토메갈로바이러스(Cytomegalovirus) US2 단백질의 과발현에 의한 CD1d 분자의 발현을 감소조절하는 것을 포함하는 자연살해 T 세포(NKT cell) 활성 억제 방법을 제공한다.According to another aspect of the present invention, the present invention inhibits natural killer T cell (NKT cell) activity, including reducing and controlling the expression of CD1d molecule by overexpression of Cytomegalovirus US2 protein in non-human animals. Provide a method.

본 발명에 있어서, 상기 US2 단백질에 의한 CD1d 분자의 발현 감소는 유비퀴틴-프로테오좀 단백질 분해기전에 의한 것임을 특징으로 한다.In the present invention, the decrease in expression of the CD1d molecule by the US2 protein is characterized by the ubiquitin-proteosome proteolytic mechanism.

본 발명에 있어서, 상기 NKT 세포 활성 억제 방법은 상기 US2 단백질 유전자를 삽입할 수 있는 벡터를 사용하여 클로닝 한 후, CD1d를 세포표면에 발현하는 세포 예컨대, 면역세포 예컨대 수지상 세포, 위장의 상피세포, 또는 B 세포 등에서 트랜스펙션시켜 CD1d의 세포표면 발현을 억제함으로써 CD1d에 의한 NKT 세포에 대한 항원 제공을 억제하여 NKT 세포의 활성을 억제시키는 방법을 포함한다.
In the present invention, the method for inhibiting NKT cell activity is a cell expressing CD1d on the cell surface after cloning using a vector capable of inserting the US2 protein gene, such as immune cells such as dendritic cells, gastrointestinal epithelial cells, Or a method of inhibiting NKT cell activity by inhibiting antigen presentation to NKT cells by CD1d by transfecting in B cells or the like to inhibit cell surface expression of CD1d.

본 발명의 또 다른 양태에 따르면, 본 발명은 싸이토메갈로바이러스(Cytomegalovirus) US2 단백질을 코딩하는 유전자를 증폭시키기 위한 다음의 서열번호 1 및 서열번호 2의 염기서열을 갖는 PCR 프라이머세트를 제공한다. 상기 프라이머세트를 이용하면 US2 유전자를 효율적으로 증폭시킬 수 있다.According to another aspect of the present invention, the present invention provides a PCR primer set having the following nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 for amplifying a gene encoding a Cytomegalovirus US2 protein. Using the primer set, the US2 gene can be efficiently amplified.

정방향 5'- ATG AAC AAT CTC TGG AAA GCC TGG - 3'(서열번호 1)Forward 5'- ATG AAC AAT CTC TGG AAA GCC TGG-3 '(SEQ ID NO: 1)

역방향 5'- TCA GCA CAC GAA AAA CCG CAT CCA - 3'(서열번호 2)
Reverse 5'- TCA GCA CAC GAA AAA CCG CAT CCA-3 '(SEQ ID NO: 2)

상술한 바와 같이, 본 발명은 CMV US2 당단백질에 의해 인간 CD1d 분자의 발현이 유비퀴틴-프로테오좀 단백질 분해 기전을 통해 감소된다는 것을 증명하였다. 따라서 본 발명은 NKT 세포에 항원을 전달하는 CD1d의 세포표면 발현량을 조절함으로써 생체 내 면역계에 중요한 작용을 하는 NKT 세포 활성제어에 응용될 수 있고, 나아가 자가면역질환 치료 및/또는 예방 분야에 매우 유용한 발명이라 할 것이다.
As described above, the present invention demonstrated that the expression of human CD1d molecules is reduced through the ubiquitin-proteosome proteolytic mechanism by the CMV US2 glycoprotein. Therefore, the present invention can be applied to the control of NKT cell activity that plays an important role in the immune system by regulating the cell surface expression level of CD1d that delivers antigen to NKT cells, and furthermore, it is very useful in the field of treatment and / or prevention of autoimmune diseases. It will be a useful invention.

도 1은 본 발명에 의한 US2 단백질을 과발현하는 세포 구축을 위한 US2/BsdEGFP-IRES3-CL 모식도를 나타낸다.
도 2a ~ 도 2c는 인간 CD1d 분자가 도입된 B세포에서 US2 단백질 과발현을 확인한 결과를 나타낸다. 도 2a에서 NC., negative control을, 인간 CD1d 분자가 도입된 B세포주를 나타내고, 도 2b에서 점선은 negative control을, 굵은 실선은 EGFP가 발현되는 transfectant를 나타낸다.
도 3은 본 발명에 의한 US2 단백질에 의한 인간 CD1d 분자의 발현 감소를 확인한 결과를 나타낸다. 점선은 Isotype control을, 가는실선은 MOCK에서 항 human-CD1d수용체를, 굵은 실선은 US2 transfectant의 항 human CD1d 항체를 나타낸다.
도 4a는 이스트 투 하이브리드 시스템(yeast two hybrid system)을 위한 인간 CD1d 분자의 각 부위 별 절단 모형을 나타낸다.
도 4b는 이스트 투 하이브리드 시스템(yeast two hybrid system)을 위한 싸이토메갈로바이러스 US2 단백질의 각 부위 별 절단 모형을 나타낸다.
도 5a ~ 도 5c는 이스트 투 하이브리드 시스템(yeast two hybrid system)을 통한 인간 CD1d 분자의 α3 부위와 US2 단백질의 소포체(Endoplasmic reticulum) 내부 부위의 단백질 간 결합을 확인한 결과를 나타낸다.
도 6은 본 발명에 의한 US2 단백질 발현에 의한 미성숙 CD1d 분자의 유비퀴틴화(Ubiquitination) 정도의 증가를 나타낸다.1 shows a US2 / BsdEGFP-IRES3-CL schematic for cell construction overexpressing the US2 protein according to the present invention.
2A to 2C show the results of confirming US2 protein overexpression in B cells into which human CD1d molecules are introduced. In FIG. 2A, NC., Negative control, B cell line into which the human CD1d molecule is introduced, and in FIG. 2B, the dotted line represents the negative control, and the thick solid line represents the transfectant expressing EGFP.
Figure 3 shows the results confirming the decrease in the expression of the human CD1d molecule by the US2 protein according to the present invention. The dashed line represents Isotype control, the solid solid line represents the anti-human CD1d receptor at MOCK, and the solid solid line represents the anti-human CD1d antibody of the US2 transfectant.
4A shows cleavage models for each region of human CD1d molecules for the yeast two hybrid system.
4B shows cleavage models for each site of cytomegalovirus US2 protein for a yeast two hybrid system.
5a to 5c show the results of confirming the binding between the α3 region of the human CD1d molecule and the internal region of the endoplasmic reticulum of the US2 protein through the yeast two hybrid system.
6 shows an increase in the degree of ubiquitination of immature CD1d molecules by US2 protein expression according to the present invention.

이하, 첨부된 도면을 참조하여 실시예를 통하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

< 실시예 1 > US2 단백질을 과발현하는 세포 구축 Example 1 Cell Construction Overexpressing US2 Protein

CMV의 US2 cDNA(NCBI accession no. BK000394.5)가 도입되어 있는 pcDNA3.1 vector (Ahn et al., 1996)의 US2 유전자를 KpnI, XhoI 제한효소로 절단 후 pBluescript KS+에 subcloning한 후, 이를 BamHI 제한효소로 절단하여 US2 유전자 부위를 bsd EGFP IRES3 CL 발현 vector에 삽입하였다(도 1 참조). 이 때 사용된 벡터는 클로닝 부위 뒷부분에 brasticidin 항생제 저항성 유전자와 EGFP 유전자가 fusion되어 있으며 이 fusion된 유전자는 IRES 시스템을 이용하여 타겟 유전자를 동시에 발현한다. The US2 gene of pcDNA3.1 vector (Ahn et al., 1996) into which US2 cDNA (NCBI accession no. BK000394.5) of CMV was introduced was digested with KpnI and XhoI restriction enzymes, subcloned into pBluescript KS +, and then BamHI. The US2 gene region was inserted into the bsd EGFP IRES3 CL expression vector by digestion with restriction enzymes (see FIG. 1). At this time, the vector used is a fusion of the brasticidin antibiotic resistance gene and the EGFP gene at the back of the cloning region.

그 후 US2 cDNA가 삽입된 bsd EGFP IRES3 CL 벡터를 사용하여 Tetracycline off system의 293GPG세포와 인간 CD1d가 과발현 된 C1R 세포주(CD1d.C1R 세포; human B 세포주; Chen et al., 1999)를 이용하여 형질 전환을 시행하였다. 우선 293GPG 세포를 6 well 조직 배양 플레이트에 well 당 5 x 105 세포가 되도록 접종하고 10% 송아지 혈청을 함유한 DMEM 배지에서 배양하였다. 세포가 24시간 후 well 표면의 70-80% 정도를 덮을 정도로 자라면, 혈청이 없는 DMEM 배지에서 1ug 의 US2 단백질 유전자 발현 벡터 DNA를 6 ug의 Lipofectamine plus (Invitrogen)를 사용하여, 도입된 발현 벡터를 레트로바이러스로 packaging하는 세포주인 293GPG 세포에 도입시켜 24시간 배양하였다. 293GPG 세포로부터 생성된 US2 단백질 유전자를 함유하는 바이러스가 포함된 배양 상층액을 이용하여 숙주세포를 4-5 시간 배양 후 혈청이 10% 함유된 배지로 바꿔서 4시간 배양하였으며 이 과정을 3회 반복하였다. 이 때 사용된 숙주세포는 CD1d.C1R 세포주이며, US2 형질 도입된 세포를 얻기 위해 blasticidin 항생제 0.7 mg/ml를 처리하여 US2 유전자가 발현되는 세포를 얻었다. Subsequently, 293GPG cells of the Tetracycline off system and C1R cell lines overexpressing human CD1d (CD1d.C1R cells; human B cell line; Chen et al., 1999) were used using a bsd EGFP IRES3 CL vector with US2 cDNA. Conversion was performed. First, 293GPG cells were seeded in 6 well tissue culture plates at 5 x 10 5 cells per well and cultured in DMEM medium containing 10% calf serum. When cells grew to cover 70-80% of the well surface after 24 hours, 1 ug of US2 protein gene expression vector DNA was introduced using 6 ug of Lipofectamine plus (Invitrogen) in DMEM medium without serum. Was introduced into 293GPG cells, a cell line packaged with retrovirus, and cultured for 24 hours. Host cells were cultured for 4-5 hours using a culture supernatant containing the virus containing the US2 protein gene generated from 293GPG cells, and then cultured for 4 hours with a medium containing 10% serum. . The host cell used at this time was a CD1d.C1R cell line, and treated with blasticidin antibiotic 0.7 mg / ml to obtain US2 transduced cells, thereby obtaining cells expressing the US2 gene.

CMV US2 단백질이 과발현 된 CD1d.C1R 세포주는 10% 송아지 혈청과 1% 페니실린/스트렙토마이신을 포함하고 있는 RPMI1640 배지에서 세포 배양하였다. 그 후, 이 세포주에서 RT-PCR, 유세포 분석기(flow cytometry)와 공초점 레이저 주사 현미경(confocal microscopy)을 이용하여 US2 유전자의 발현을 확인하였다. CD1d.C1R cell line over-expressed with CMV US2 protein was cultured in RPMI1640 medium containing 10% calf serum and 1% penicillin / streptomycin. Thereafter, the expression of the US2 gene was confirmed in the cell line using RT-PCR, flow cytometry, and confocal microscopy.

우선 RT-PCR을 수행하기 위해, US2 단백질이 과발현 된 CD1d.C1R 세포주를 트리졸(Trizol, Invitrogen) 1 ml 당 200 ul의 chloroform (sigma)을 넣고 전체 RNA를 분리하였고, 이때 추출한 5 ug의 mRNA를 주형으로 Superscript III (Invitrogen) 역전사 효소를 이용하여 역전사 연쇄중합반응에 의해 cDNA를 합성한 후, US2 단백질(가)과 GAPDH(나) 프라이머를 이용하여 연쇄중합반응을 실시하였다. First, to perform RT-PCR, 200 ul of chloroform (sigma) per 1 ml of Trizol (Invitrogen) was added to the CD1d.C1R cell line overexpressing US2 protein, and the total RNA was isolated. As a template, cDNA was synthesized by reverse transcriptase chain polymerization using Superscript III (Invitrogen) reverse transcriptase, followed by chain polymerization using US2 protein (A) and GAPDH (B) primers.

이 때 사용한 중합 효소는 Tag polymerase (Gene craft)이며 사용한 프라이머는 아래와 같다.The polymerase used was Tag polymerase (Gene craft) and the primers used are as follows.

(가) US2 단백질 프라이머(A) US2 protein primer

정방향 5'- ATG AAC AAT CTC TGG AAA GCC TGG - 3'(서열번호 1)Forward 5'- ATG AAC AAT CTC TGG AAA GCC TGG-3 '(SEQ ID NO: 1)

역방향 5'- TCA GCA CAC GAA AAA CCG CAT CCA - 3'(서열번호 2)Reverse 5'- TCA GCA CAC GAA AAA CCG CAT CCA-3 '(SEQ ID NO: 2)

(나) GAPDH 프라이머(B) GAPDH primer

정방향 5'- ATG ACC ACA GTC CAT GCC ATC - 3'(서열번호 3)Forward 5'- ATG ACC ACA GTC CAT GCC ATC-3 '(SEQ ID NO: 3)

역방향 5'- CCT GCT TCA CCA CCT TCT TG - 3'(서열번호 4)
Reverse 5'- CCT GCT TCA CCA CCT TCT TG-3 '(SEQ ID NO: 4)

이때 PCR condition은 denaturation 95도에서 30초, anealing 65도에서 30초, extension 72도에서 30초의 온도, 시간 조건으로 35 싸이클로 진행하였다.At this time, the PCR condition was performed in 35 cycles with temperature and time conditions of 30 seconds at 95 degrees denaturation, 30 seconds at 65 degrees anealing, and 30 seconds at 72 degrees extension.

또한, 이 때 사용되어진 음성대조군(N.C., negative control)은 US2 유전자가 삽입되지 않은 IRES EGFP와 blasticidine 항생제 저항성유전자를 발현시키는 벡터를 발현시킨 CD1d.C1R 세포주의 mRNA가 사용되었다. RT-PCR 결과 600 bp의 싸아토메갈로바이러스 US2 단백질 유전자의 mRNA transcript 산물이 US2를 도입한 세포에서만 발견됐다(도 2a 참조). 내적 대조군(Internal control)인 GAPDH 산물(271 bp)은 음성대조구(N.C.)와 US2를 도입한 세포 모두에서 발견되었다(도 2a 참조).
In addition, the negative control group (NC) used at this time was the mRNA of the CD1d.C1R cell line expressing a vector expressing IRES EGFP and blasticidine antibiotic resistance gene without US2 gene insertion. RT-PCR revealed that the mRNA transcript product of the 600 bp cytomegalovirus US2 protein gene was found only in cells incorporating US2 (see FIG. 2A). The GAPDH product (271 bp), an internal control, was found in both negative control (NC) and US2 introduced cells (see FIG. 2A).

또한 US2와 함께 발현되는 EGFP 단백질의 발현을 확인하기 위하여 공초점 레이저 주사 현미경(confocal microscopy)과 유세포 분석기(flow cytometry)를 이용해 형광강도를 측정하였다(도 2b, 도 2c 참조). 그 결과 US2와 함께 발현되는 EGFP 단백질의 발현을 확인하였다.
In addition, fluorescence intensity was measured using confocal laser microscopy and flow cytometry to confirm the expression of EGFP protein expressed with US2 (see FIGS. 2B and 2C). As a result, the expression of EGFP protein expressed with US2 was confirmed.

< 실시예 2 > US2단백질에 의한 인간 CD1d분자의 발현 감소 Example 2 Reduction of Expression of Human CD1d Molecules by US2 Protein

유세포 분석기(flow cytometry)를 이용하여 CMV US2 단백질에 의한 인간 CD1d 분자의 발현 감소를 측정하기 위하여 US2 단백질이 과발현 된 CD1d.C1R 세포주에 PE-conjugated 항 CD1d 수용체 항체(BDpharmingen)를 처리하고, 유세포 분석기를 이용해 형광강도를 측정하였다. 이 때 사용되어진 isotype control은 ratIgG1κ로 BDpharmingen에서 구입하였다. 그 결과 US2 단백질이 과발현 된 CD1d.C1R 세포 전체와 세포표면에서의 CD1d 단백질의 발현 감소를 확인하였다(도 3 참조).
Flow cytometry was used to treat PE-conjugated anti-CD1d receptor antibody (BDpharmingen) on CD1d.C1R cell line overexpressed with US2 protein to measure the decrease in expression of human CD1d molecules by CMV US2 protein, and flow cytometry. Fluorescence intensity was measured using. The isotype control used at this time was purchased from BDpharmingen as ratIgG1κ. As a result, it was confirmed that the expression of CD1d protein in the whole cell surface and CD1d.C1R cells overexpressed US2 protein (see Fig. 3).

< 실시예 3 > 이스트 투 하이브리드 시스템(yeast two hybrid system)을 통한 인간 CD1d 분자의 α3 부위와 US2 단백질의 소포체(Endoplasmic reticulum) 내부 부위의 단백질 간 결합 확인<Example 3> Confirmation of the binding between the α3 region of the human CD1d molecule and the protein inside the endoplasmic reticulum of the US2 protein through the yeast two hybrid system

이스트 투 하이브리드 시스템(yeast two hybrid system)을 통해 CD1d, US2 두 분자 간 직접적인 단백질 결합을 확인하기 위해 인간 CD1d 단백질을 전사 인자의 DNA 결합 부위(DNA binding domain)와 융합시키고, US2 단백질을 전사 인자의 활성 부위(activation domain)에 융합시켜 이 두 단백질 간의 결합 여부와 정도를 측정하였다. 먼저, 인간 CD1d를 bait로 사용하기 위해 전체 CD1d cDNA와 CD1d를 α1, α2 (아미노산 1-202) 부위와 α3 (아미노산 203-295) 그리고 소포체 막 투과부위와 세포질 부위(아미노산 296-335) 세 부분으로 절단한 DNA 시퀀스를 pGilda 벡터(CLONTECH, #6183-1)에 삽입하였다 (도 4a 참조).
To confirm direct protein binding between two CD1d and US2 molecules through the yeast two hybrid system, the human CD1d protein is fused with the DNA binding domain of the transcription factor, and the US2 protein is transferred to the transcription factor. Fusion to the activation domain (activation domain) was measured for binding and degree of binding between the two proteins. First, in order to use human CD1d as bait, three parts of total CD1d cDNA and CD1d were α1, α2 (amino acids 1-202), α3 (amino acids 203-295), vesicle membrane permeation sites and cytoplasmic sites (amino acids 296-335). The cut DNA sequence was inserted into pGilda vector (CLONTECH, # 6183-1) (see FIG. 4A).

또한 US2 단백질은 prey로 전체 단백질 시퀀스와 각각의 부위를 절단한 cDNA를 제한 효소 EcoRI과 XhoI 절단 부위를 이용하여 pJG4-5벡터에 삽입하여 B42 융합 단백질을 형성하는데 이용하였다. 이 때, US2 단백질의 각 부위는 signal peptide 부위 (아미노산 1-21), 소포체 내부부위 (22-160), 소포체 막 투과부위와 세포질 부위 (161-199)로 절단하였으며 이 절단된 cDNA fragment는 연쇄중합반응을 통하여 합성되었다(도 4b 참조).
In addition, US2 protein was prey inserted into the pJG4-5 vector using the restriction enzymes EcoR I and Xho I cleavage sites to form the B42 fusion protein. At this time, each region of the US2 protein was cleaved into a signal peptide region (amino acids 1-21), an endoplasmic reticulum (22-160), a vesicle membrane permeation site and a cytoplasmic site (161-199), and the cleaved cDNA fragment was chained. It was synthesized through a polymerization reaction (see FIG. 4B).

이 때 사용한 중합 효소는 Tag polymerase (Gene craft)이며 사용한 프라이머는 아래와 같다.The polymerase used was Tag polymerase (Gene craft) and the primers used are as follows.

(가) US2 signal peptide 부위(A) US2 signal peptide site

정방향 5'- CGGGAATTCATGAACAATCTCTGGAAA- 3'(서열번호 5)Forward 5'- CGGGAATTCATGAACAATCTCTGGAAA- 3 '(SEQ ID NO: 5)

역방향 5'- ATTCTCGAGTCACAGGCGGATCAAGGG - 3'(서열번호 6)
Reverse 5'- ATTCTCGAGTCACAGGCGGATCAAGGG-3 '(SEQ ID NO: 6)

(나) 소포체 내부부위 (ER luminal domain)(B) ER luminal domain

정방향 5'- CGGGAATTCCCCGATGGAATCACTAAA - 3'(서열번호 7)Forward 5'- CGGGAATTCCCCGATGGAATCACTAAA-3 '(SEQ ID NO: 7)

역방향 5'- ATTCTCGAGTCACGTGTATGACTTCCG - 3'(서열번호 8)
Reverse 5'- ATTCTCGAGTCACGTGTATGACTTCCG-3 '(SEQ ID NO: 8)

(다) 소포체 막 투과부위와 세포질 부위 (ER transmembrane domain & Cytoplasmic tail domain)(C) ER transmembrane domain and cytoplasmic tail domain

정방향 5'- CGGGAATTCCATGTGGCCTGGACAATA - 3'(서열번호 9)Forward 5'- CGGGAATTCCATGTGGCCTGGACAATA-3 '(SEQ ID NO: 9)

역방향 5'- ATTCTCGAGTCAGCACACGAAAAACCG - 3'(서열번호 10)
Reverse 5'- ATTCTCGAGTCAGCACACGAAAAACCG-3 '(SEQ ID NO: 10)

그 후 전체와 각 부위별 human CD1d cDNA가 삽입된 pGilda 벡터는 Bait으로서 효모 스트레인인 EGY48 [MATa, his3, trp1, ura3-52, leu2::pLeu2-LexAop6/pSH18-34 (LexAop-lacZ reporter)]에 modified lithium acetate 방법을 이용하여 도입하였다(Ito et al., 1983). US2 단백질의 전체 cDNA와 각 부위의 cDNA 서열을 포함하는 pJG4-5 벡터를 이미 인간 CD1d를 포함하고 있는 효모의 competent cell에 도입하였고, 이 형질 도입된 세포는 2%의 포도당을 함유하고 있는 합성 배지(Ura-, His-, Trp-)에서 tryptophan prototrophy를 통해 선별하였다.
Then, the pGilda vector into which the human CD1d cDNA was inserted in its entirety and at each site was the bait yeast strain EGY48 [MATa, his3, trp1, ura3-52, leu2 :: pLeu2-LexAop6 / pSH18-34 (LexAop-lacZ reporter)]. Was introduced using modified lithium acetate method (Ito et al., 1983). The pJG4-5 vector, which contains the entire cDNA of the US2 protein and the cDNA sequence of each site, was introduced into a yeast competent cell containing human CD1d, and the transduced cells contained 2% glucose. (Ura -, His -, Trp -) were selected from over the tryptophan prototrophy.

인간 CD1d 분자와 US2 당단백질의 단백질 간 결합 여부는 β-galactosidase의 발현정도를 정량화함으로써 측정하였다. β-galactosidase의 활성도는 각각의 cDNA를 포함하고 있는 효모세포를 mid-long phase에 도달할 때까지 2%의 포도당을 함유하고 있는 효모 합성 배지(Yeast synyhetic media, Ura-, His-, Trp-)에서 배양한 후, 2%의 galactose를 함유하는 효모 배지로 옮겨 배양하였다. 그 후 동일한 수의 세포를 Z buffer(60mM Na2HPO4, 40mM NaH2PO4, 10mM MgSO4, and 50mM β-mercaptoethanol, pH7.0)를 이용하여 30℃에서 30분간 배양한 후, σ-nitrophenyl β-D-galactosidase를 첨가한 후, 노란색으로 변색되면 1M Na2CO3 0.4 ml을 첨가하여 반응을 멈춘 후, 420 nm와 550nm 흡광도를 측정함으로써 β-galactosidase의 활성을 측정하였다. 그 결과 CD1d와 US2 전체 단백질 간의 결합과 CD1d의 소포체 내부에 존재하는 아미노산 203-295번째에 해당되는 α3부위와 US2전체 단백질 간의 결합을 확인하였고 (도 5a 참조), CD1d 전체 단백질과 아미노산 22-160번째에 해당되는 US2의 소포체 내부 부위의 결합 (도 5b 참조), 그리고 CD1d의 α3 부위와 US2의 소포체 내부 부위간의 결합을 확인하였다 (도 5c 참조).
The binding between the human CD1d molecule and the protein of US2 glycoprotein was determined by quantifying the expression level of β-galactosidase. β-galactosidase activity of the yeast synthetic medium containing a 2% glucose to reach yeast cells containing each cDNA in the mid-long phase of (Yeast synyhetic media, Ura -, His -, Trp -) After culturing at, it was transferred to yeast medium containing 2% galactose and cultured. Thereafter, the same number of cells were incubated at 30 ° C. for 30 minutes using Z buffer (60 mM Na 2 HPO 4 , 40 mM NaH 2 PO 4 , 10 mM MgSO 4 , and 50 mM β-mercaptoethanol, pH7.0), followed by σ- After adding nitrophenyl β-D-galactosidase and discoloring to yellow, 0.4 ml of 1M Na 2 CO 3 was added to stop the reaction, and the activity of β-galactosidase was measured by measuring absorbance at 420 nm and 550 nm. As a result, the binding between the CD1d protein and the entire US2 protein and the α3 region corresponding to the amino acid 203-295th present in the endoplasmic reticulum of the CD1d and the US2 total protein were confirmed (see FIG. 5A). The binding of the endoplasmic reticulum of US2 corresponding to the first (see Fig. 5b), and the binding between the α3 site of CD1d and the endoplasmic reticulum of US2 (see Figure 5c).

< 실시예 4 > US2 단백질 발현에 의한 미성숙 CD1d 분자의 유비퀴틴화(Ubiquitination) 정도의 증가 Example 4 Increasing Ubiquitination of Immature CD1d Molecules by US2 Protein Expression

US2에 의한 CD1d 분자의 발현 감소가 유비퀴틴화 (Ubiquitination)에 의해 매개되는 프로테오좀 단백질 분해 기작에 의한 것인지 알아보기 위해 co-immunoprecipitaion을 통해 CD1d의 유비퀴틴화 정도를 측정하였다. The degree of ubiquitination of CD1d was measured by co-immunoprecipitaion to determine whether the decrease in the expression of CD1d molecules by US2 was due to proteosome proteolysis mechanism mediated by ubiquitination.

먼저 US2 단백질이 과발현 된 CD1d.C1R 세포를 proteinase inhibitor cocktail이 포함된 NP-40 lysis buffer (50mM Tris HCl pH8.0, 150mM NaCl, 1.0% NP-40)로 lysis시킨 후, 골지체에서 글라이코실화되어 성숙한 형태가 된 CD1분자에 특이적으로 결합하는 항 CD1d 항체인 51.1과 모든 형태의 CD1d와 특이적으로 결합할 수 있는 항 CD1d 항체인 NOR3.2 항체를 이용하여 면역 침전시킨 후, 10% SDS polyacrylamide gel에 전기 영동시켜 Hybond-P PVDF membrane (GE Healthcare, Buckinghamshire, UK)에 transfer하였다, 그 후, 항 유비퀴틴 항체를 membrane에 처리한 후 ECL system (GE Healthcare, Buckinghamshire, UK)을 이용하여 발색시켜 CD1d 단백질의 유비퀴틴화 정도를 측정하였다. First, US1 protein overexpressed CD1d.C1R cells were lysed with NP-40 lysis buffer (50mM Tris HCl pH8.0, 150mM NaCl, 1.0% NP-40) containing proteinase inhibitor cocktail, and then glycosylated in Golgi. 10% SDS polyacrylamide was immunoprecipitated using 51.1, an anti-CD1d antibody that specifically binds to mature CD1 molecules, and NOR3.2, an anti-CD1d antibody that can specifically bind to all forms of CD1d. The gel was electrophoresed and transferred to a Hybond-P PVDF membrane (GE Healthcare, Buckinghamshire, UK). Afterwards, the anti-ubiquitin antibody was treated on the membrane and developed using an ECL system (GE Healthcare, Buckinghamshire, UK). The degree of ubiquitination of the protein was measured.

그 결과, 성숙한 형태의 CD1d 분자의 경우, US2 당단백의 발현 여부와 관계없이 유비퀴틴화 정도가 동일한 것을 확인하였고, 모든 형태의 CD1d는 US2 당단백이 과발현 된 경우에 유비퀴틴화 정도가 증가한 것을 확인할 수 있었다. 이로 인해 글라이코실화되지 않은 CD1d 분자가 US2 단백질이 발현되는 경우 유비퀴틴화 정도가 증가하는 것을 확인하였다 (도 6 참조). 이 때 사용되어진 membrane은 항 CD1d 항체를 처리하여 위와 같은 방법으로 CD1d 분자의 밴드를 확인하여 면역침전 반응 여부를 확인 하였다. Internal control은 항 β-actin 항체에 의한 β-actin의 발현량으로, 항 CD1d 항체를 이용하여 면역침전하기 전의 모든 샘플에서 동일한 β-actin이 검출되어 동일한 양의 단백질을 가지고 면역침전 반응을 수행 한 것임을 확인하였다. As a result, in the case of mature CD1d molecules, the degree of ubiquitination was confirmed to be the same regardless of the expression of US2 glycoprotein, and all forms of CD1d were found to increase the degree of ubiquitination when US2 glycoprotein was overexpressed. As a result, it was confirmed that the degree of ubiquitination was increased when the non-glycosylated CD1d molecule expressed US2 protein (see FIG. 6). The membrane used at this time was treated with an anti-CD1d antibody to check the band of the CD1d molecule in the same manner as described above to determine the immunoprecipitation reaction. Internal control is the amount of β-actin expression by anti-β-actin antibody. The same β-actin is detected in all samples before immunoprecipitation using anti-CD1d antibody, and the immunoprecipitation reaction was performed with the same amount of protein. It was confirmed that.

이상으로 본 발명의 특정한 부분을 상세히 기술하였으나, 당업계의 통상의 지식을 가진 자에게 있어 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 균등물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is obvious that the same is by way of illustration and example only and is not to be construed as limiting the scope of the invention. It is therefore intended that the scope of the present invention be defined by the appended claims and their equivalents.

<110> KOREA UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same <130> P11-101224-01 <160> 10 <170> KopatentIn 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 1 atgaacaatc tctggaaagc ctgg 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 2 tcagcacacg aaaaaccgca tcca 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 3 atgaccacag tccatgccat c 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 4 cctgcttcac caccttcttg 20 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 5 cgggaattca tgaacaatct ctggaaa 27 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 6 attctcgagt cacaggcgga tcaaggg 27 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 7 cgggaattcc ccgatggaat cactaaa 27 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 8 attctcgagt cacgtgtatg acttccg 27 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 9 cgggaattcc atgtggcctg gacaata 27 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 10 attctcgagt cagcacacga aaaaccg 27 <110> KOREAN UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> Composition comprising US2 protein gene downregulating CD1d          expression for suppressing NKT cell activity and method of          suppressing NKT cell using the same <130> P11-101224-01 <160> 10 <170> Kopatentin 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 1 atgaacaatc tctggaaagc ctgg 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 2 tcagcacacg aaaaaccgca tcca 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 3 atgaccacag tccatgccat c 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 4 cctgcttcac caccttcttg 20 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 5 cgggaattca tgaacaatct ctggaaa 27 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 6 attctcgagt cacaggcgga tcaaggg 27 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 7 cgggaattcc ccgatggaat cactaaa 27 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 8 attctcgagt cacgtgtatg acttccg 27 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 9 cgggaattcc atgtggcctg gacaata 27 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 10 attctcgagt cagcacacga aaaaccg 27

Claims (7)

CD1d 발현을 감소조절하는 싸이토메갈로바이러스(Cytomegalovirus)의 US2(unique short 2) 유전자를 포함하는 자연살해 T 세포(NKT cell) 활성 억제용 조성물.A composition for inhibiting natural killer T cell (NKT cell) activity, comprising a unique short 2 (US2) gene of Cytomegalovirus that reduces and regulates CD1d expression. 제1항 기재의 자연살해 T 세포(NKT cell) 활성 억제용 조성물을 유효성분으로 함유하는 자가면역질환 치료 또는 예방용 조성물.A composition for treating or preventing autoimmune diseases comprising the composition for inhibiting natural killer T cell activity of claim 1 as an active ingredient. 인간외 동물에서, 싸이토메갈로바이러스(Cytomegalovirus) US2 단백질의 과발현에 의한 CD1d 분자의 발현을 감소조절하는 것을 포함하는 자연살해 T 세포(NKT cell) 활성 억제 방법.A method for inhibiting NKT cell activity, comprising reducing and controlling the expression of a CD1d molecule by overexpression of a Cytomegalovirus US2 protein in a non-human animal. 제3항에 있어서, 상기 US2 단백질에 의한 CD1d 분자의 발현 감소는 유비퀴틴-프로테오좀 단백질 분해기전에 의한 것임을 특징으로 하는 자연살해 T 세포(NKT cell) 활성 억제 방법.The method of claim 3, wherein the expression of the CD1d molecule by the US2 protein is caused by a ubiquitin-proteosome proteolytic mechanism. 5. 삭제delete 도 1의 개열지도로 표시되는 싸이토메갈로바이러스(Cytomegalovirus) US2 단백질을 코딩하는 유전자를 포함하여 CD1d 발현을 감소조절하는 자연살해 T 세포 활성 억제용 발현 벡터.An expression vector for inhibiting natural killer T cell activity that reduces and regulates CD1d expression, including a gene encoding Cytomegalovirus US2 protein, which is represented by a cleavage map of FIG. 1. CD1d가 과발현된 C1R 세포주가 제6항에 따른 벡터로 형질전환된 것을 특징으로 하는 숙주 세포.A C1R cell line overexpressed with CD1d has been transformed with a vector according to claim 6.
KR1020110005159A 2011-01-18 2011-01-18 Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same KR101263103B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110005159A KR101263103B1 (en) 2011-01-18 2011-01-18 Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110005159A KR101263103B1 (en) 2011-01-18 2011-01-18 Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same

Publications (2)

Publication Number Publication Date
KR20120083814A KR20120083814A (en) 2012-07-26
KR101263103B1 true KR101263103B1 (en) 2013-05-09

Family

ID=46714953

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110005159A KR101263103B1 (en) 2011-01-18 2011-01-18 Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same

Country Status (1)

Country Link
KR (1) KR101263103B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000046361A1 (en) * 1999-02-02 2000-08-10 Oregon Health Sciences University Inhibition of the mhc class ii antigen presentation pathway and presentation to cd4+ cells
US20040110700A1 (en) 2002-12-10 2004-06-10 Isis Pharmaceuticals Inc. Modulation of CD1D expression

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000046361A1 (en) * 1999-02-02 2000-08-10 Oregon Health Sciences University Inhibition of the mhc class ii antigen presentation pathway and presentation to cd4+ cells
US20040110700A1 (en) 2002-12-10 2004-06-10 Isis Pharmaceuticals Inc. Modulation of CD1D expression

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Claire Dunn 등. The journal of experimental medicine. 197(11), 2003.*
GenBank Accession Number BK000394, 2009.05.01.*

Also Published As

Publication number Publication date
KR20120083814A (en) 2012-07-26

Similar Documents

Publication Publication Date Title
AU2014259675B2 (en) CS1-specific chimeric antigen receptor engineered immune effector cells
Nichols et al. Molecular and cellular pathogenesis of X‐linked lymphoproliferative disease
DK1234031T3 (en) B7-H1, AN UNKNOWN IMMUNE REGULATORY MOLECULE
Hayakawa et al. Differential regulation of Th1 and Th2 functions of NKT cells by CD28 and CD40 costimulatory pathways
EP2766035B1 (en) Combination medicament comprising il-12 and an agent for blockade of t-cell inhibitory molecules for tumour therapy
US7622565B2 (en) Nucleic acids encoding B7-H4, a T cell immunoregulatory molecule
US11547741B2 (en) Methods of use of soluble CD24 for treating immune related adverse events in cancer therapies
Coppieters et al. A single early activation of invariant NK T cells confers long-term protection against collagen-induced arthritis in a ligand-specific manner
EP2591796A1 (en) Combination medicament comprising IL-12 and an anti-CTLA-4 ligand for tumor therapy
KR101263103B1 (en) Composition comprising US2 protein gene downregulating CD1d expression for suppressing NKT cell activity and method of suppressing NKT cell using the same
EP1551222B1 (en) Method for producing a mammal provided with resistance to an alpha-herpes virus mediated infection and mammal obtained by implementing said method and said mammal&#39;s progeny
EP3571296B1 (en) Engineered cells for inducing tolerance
AU2018209163B2 (en) Engineered cells for inducing tolerance
WO2000024896A2 (en) Biological material for preparing pharmaceutical compositions for treating mammals
Kumaresan et al. Molecular characterization of the rat NK cell receptor 2B4
US20050090440A1 (en) Tumour treating combinations, compositions and methods

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20160225

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20170328

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20180406

Year of fee payment: 6