KR101261589B1 - RNA Aptamer Targeting RIG-I Protein and Use thereof - Google Patents

Abstract

RNA aptamers specific for RIG-I proteins, and immunomodulators, gene expression modulators, and antiviral agents comprising the same as active ingredients are provided.

Description

RNA aptamer targeting RIG-I protein and its use {RNA Aptamer Targeting RIG-I Protein and Use}

The present invention relates to RNA aptamers targeted to RIG-I proteins and uses thereof. RNA aptamers of the present invention not only exhibit specific and potent binding potency to RIG-I protein, but also regulate the immune and / or antiviral response mediated by RIG-I protein, thereby expressing immune protein. It is useful for increasing and / or effectively inhibiting viral proliferation, and thus can be useful for the development of immunomodulators and / or antiviral therapies.

Retinoic-acid inducible gene-I (RIG-I) is a regulatory protein of the immune response, which is composed of caspase recruitment (CARD) domain and RNA helicase domain, and is located in the cytoplasm. The RNA helicase domain recognizes non-self RNA (non-self RNA) present in cells and induces expression of interferon-alpha / beta. Representative danger signals recognized by RIG-I include single helix RNA (ssRNA), or polyI: C, including double helix RNA (dsRNA), 5'-triphosphate (5'-ppp), which occur during the process of virus propagation. Etc.

RIG-I primarily recognizes infection of RNA viruses and induces expression of interferon-beta. Representative RNA viruses recognized by RIG-I include hepatitis C virus (HCV), acute respiratory syndrome (SARS) virus, influenza virus, West Nile virus, Ebola virus (Ebola Virus), Vesicular Stomatitis Virus, and Newcastle Disease Virus.

Intracellular infection signals recognized by RIG-I are directed to kinase such as inhibitor kappa B kinase (IKK) and tank binding kinase (TBK) via MAVS / IPS-1 / VISA / Cardif proteins located on the mitochondrial membrane. Delivered. Activated IKK and TBK induce phosphorylation or activation of transcriptional proteins, such as interferon regulatory factor 3 (IRF3), interferon regulatory factor 7 (IRF7), and nuclear factor kappa B (NFkB). The synthesis of cytokines such as

Interferon alpha / beta is a cytokine that is mainly synthesized from immune cells that recognize viral or bacterial infections and then released into the body, and is a biomaterial that plays an important role in antiviral immune responses. Interferon alpha / beta transmits secondary signals by binding to interferon receptor proteins. As a result, antiviral reactions such as virus removal and cell death occur by various interferon stimulated genes (ISGs).

Aptamers are single-stranded RNA or DNA molecules that have high binding affinity and specificity for the target protein. The specification of such aptamers is similar to existing antibody proteins, and as a result has been applied to various diagnostics and treatments due to antibody-antigen responses. Aptamers are relatively fast compared to other biomaterials, exhibit high stability and low immunogenicity in vivo, and are believed to be a molecular diagnostic technology that can replace existing antibody proteins due to these properties.

RNA aptamer screening involves the use of random sequences RNA library to select and target specific materials by repeating the selection and amplification process. Based on SELEX (Systematic evolution of ligands by exponential enrichment) technology (Tuerk, C., and Gold, L. (1990) .Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.Science 249, 505-510; Ellington, AD, and Szostak, JW (1990) .In vitro selection of RNA molecules that bind specific ligands.Nature 346, 818-822).

Aptamers specific for receptors often function as agonists or antagonists. As a result, the binding of the aptamer to the target protein mimics the binding of the receptor to the ligand, thereby inhibiting or enhancing the function originally possessed by the target protein.

The US Food and Drug Administration's approval of RNA aptamers binding to vascular endothelial growth factor-165 (VEGF-165) offers the possibility of research into drug development using aptamers.

Accordingly, the development of immunoregulatory and antiviral agents through the regulation of the expression of RIG-I protein using RNA aptamer is ongoing, but the results are still insignificant.

Accordingly, the present invention specifically relates to a protein encoded by the RIG-I gene, which is an immune-related protein of the host, but not a virus-derived substance (protein or nucleic acid) that is easily denatured (hereinafter, referred to as 'RIG-I protein'). It is aimed at selecting and providing a binding RNA aptamer.

Thus, one example of the present invention relates to RNA aptamers that specifically bind to RIG-I. By providing an RNA aptamer that specifically binds to RIG-I, it is possible to modulate signal transduction processes and / or immune responses and / or antiviral responses mediated by RIG-I.

Another example is an immune inducer that produces an immune response against non-self RNA, which contains an RNA aptamer that specifically binds to RIG-I, and an antiviral signal derived from RIG-I protein. The present invention relates to an antiviral agent having a proliferation inhibitory effect of a virus whose proliferation is inhibited.

Another example relates to an expression and / or action modulator of MDA5 and LGP2 having homology with RIG-I containing an RNA aptamer specifically binding to RIG-I as an active ingredient.

Another example relates to a method for the analysis of RIG-I proteins that quantitatively measures the amount of RIG-I protein or tracks its location in cells using RNA aptamers that specifically bind to RIG-I.

Another example is the regulation of new RIG-I binding agents and / or activity through conservative sequence and / or specific secondary structure analysis common to RNA aptamers that specifically bind to RIG-I. A method of searching for a substance.

Another example relates to a method for providing information on the selection of binding agents and / or activity modulators for proteins with high functional or base sequence homology with RIG-I proteins (eg, MDA5, LGP2, etc.). will be.

The inventors have discovered an RNA aptamer specific for RIG-I, an immune receptor protein that recognizes intracellular infected RNA viruses and induces an antiviral response, and the selected RIG-I RNA aptamers are mediated by RIG-I. By amplifying the delivery process and enhancing the synthesis of interferon-beta, we found that it inhibits the proliferation of non-self RNA in cells, such as intracellular infected RNA viruses, such that the RIG-I RNA aptamers The present invention has been completed by confirming that it can be usefully used as an immune inducing agent (modulator), antiviral agent, and / or virus infection prevention and treatment against sub RNA.

The present invention selects the target material of the RNA aptamer as RIG-I, which is an immune-related protein of the host, rather than a virus-derived material (protein or nucleic acid) that is easily denatured, thereby having an antiviral effect having more stable and superior effect. It features.

As used herein, 'RIG-I RNA aptamer' refers to an RNA fragment (oligonucleotide) that specifically binds to a RIG-I protein (SEQ ID NO: 108).

One example of the present invention provides the base sequence of the RIG-I RNA aptamer.

RNA aptamer according to the present invention, Homo sapiens ( Homo sapiens ) Targeted proteins (Accession No. O95786, 925 aa, SEQ ID NO: 99) translated from the RIG-I gene are selected from repetitive selection and amplification processes from an RNA library of random nucleotide sequences. Thus, the binding capacity and potency of the selected RIG-I RNA aptamers may vary depending on the binding site.

Analysis of a total of 45 (SEQ ID NOs: 54-98) of RIG-I RNA aptamers selected in one example of the present invention revealed that they contained U- containing uracil bases at very high rates (average 52%). It has been shown that it has a rich site (SEQ ID NOS: 1 to 45) and that there is a repetitive uracil sequence structure (Un; n = 2-11) that is common to all RIG-I RNA aptamers. This means that the selected RIG-I RNA aptamers, along with the RNA tertiary structure according to the base sequence, are also important for the binding of RIG-I.

Therefore, the RNA aptamer specifically binding to the RIG-I protein according to the present invention is characterized in that it has a U-rich region containing 2 to 10 repeating units in which 2 to 11 uracils (U) are linked.

When explaining in detail the RNA aptamer specifically binding to the RIG-I protein,

Consisting of a 5 'terminal region, a U-rich region, and a 3' terminal region,

The 5 ′ terminal portion is an oligonucleotide consisting of 12 to 18 bases of at least one base selected from the group consisting of A, G, C, and U,

The U-rich region consists of 35 to 50 four bases selected from the group consisting of A, G, C, and U, the number of U is 20 to 60% of the total number of bases, and U is continuously 2 Oligonucleotides containing 2 to 10 linked repeating units,

The 3 ′ terminal portion is an oligonucleotide consisting of 5 to 35 bases of at least one base selected from the group consisting of A, G, C, and U

It may be.

At this time, U and C present in the RNA aptamer may be a hydroxyl group of the second carbon position is substituted with a fluorine group. As such, when the hydroxyl groups at the second carbon positions of U and C are substituted with fluorine groups, resistance to RNA degradation due to RNase attack or self-activation is increased, and the stability of RNA is increased.

As noted above, the U-rich moiety comprises uracil (U) at a very high rate (20-60%, preferably 25-60%, more preferably 30-60%, even more preferably 40-60%, on average 52%). uracil), wherein a continuous uracil base sequence structure (Un; n = 2-11) is present at least twice, preferably 2-10 times, more preferably 2-7 times. In addition to the RNA tertiary structure of the RIG-I RNA aptamer according to the nucleotide sequence of the U-rich region, the nucleotide sequence itself plays an important role in binding of RIG-I.

More specifically, the U-rich region may be an oligonucleotide having a nucleotide sequence of SEQ ID NO: 1 to 45.

The 5 'terminal portion is a nucleotide sequence consisting of 12 to 18 consecutive bases in SEQ ID NO: 46 (GCGGAAGCGUGCUGGGCC), such as the base sequence of SEQ ID NO: 46, the base sequence of SEQ ID NO: 47 (GCGGAAGCGUGCUGGG), SEQ ID NO: 48 (GCGGAAGCGUGCUGG) , And an oligonucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 49 (AAGCGUGCUGGG).

The 3 ′ terminal portion may be an oligonucleotide having a nucleotide sequence consisting of 5 to 28 consecutive bases in SEQ ID NO: 50 (cauaacccaa) or SEQ ID NO: 53 (cauaacccag aggucgaugg aucccccc). The base sequence consisting of 5 to 28 consecutive bases in SEQ ID NO: 53 is SEQ ID NO: 53 (28 bases), SEQ ID NO: 51 consisting of 9 bases (cauaaccca) of 1-9 of SEQ ID NO: 53, or SEQ ID NO: 53 It may be an oligonucleotide having a nucleotide sequence of SEQ ID NO: 52 consisting of 18 bases (cauaacccag aggucgau) of 1-18. In a preferred embodiment, the 3 'terminal portion may be an oligonucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 50 to 53.

The RNA aptamer according to the present invention may be variously configured by a combination of the U-rich region / 3 'end region or the 5' terminal region / U-rich region / 3 'terminal region as described above. In a preferred embodiment, the RNA aptamer may further have a base sequence selected from the group consisting of SEQ ID NOs: 58 to 101, or a 5 'terminal portion as described above in the 5' region of the sequence.

The RIG-I aptamer according to the present invention specifically binds to the RIG-I protein and plays a role of activating the action of the RIG-I protein, thereby exerting various immune induction and antiviral effects.

In addition, the RIG-I aptamer according to the present invention has a high amino acid sequence homology with the RIG-I protein, and has a high affinity between MDA5 (human MDA5: NM_022168) and LGP2 (human LGP2: NM_024119), which are known to have a similar structure. Expected (see The Journal of Immunology, vol 175, p2851-2858). In particular, it was confirmed that the RIG-I aptamer according to the present invention exhibits efficacy even in an experiment overexpressing MDA5 (see FIG. 3C), and it was confirmed that the RIG-I aptamer may exhibit an action activation effect on MDA5 as well as RIG-I.

Therefore, the RIG-I aptamer according to the present invention may serve as one or more action activators selected from the group consisting of RIG-I protein, MDA5 protein and LGP2 protein.

RNA sequencing information specifically binding to the RIG-I protein obtained in the present invention can be used in the future to discover RIG-I modulators with stronger binding and regulatory power, and also has high homology with RIG-I. It can also be used to find binding materials targeting genes or proteins with similar structures, such as MDA5 and / or LGP2 proteins.

The binding of each RIG-I RNA aptamer clone and purified RIG-I protein selected in the present invention was confirmed in vitro through RNA electrophoretic mobility assay (RNA-EMSA) (see FIG. 1B). .

Among the RIG-I RNA aptamers of the present invention, those having the nucleotide sequences of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 61, and SEQ ID NO: 63 It was found to be effective in activating the promoter of the interferon-beta gene (NM_002176) (see Example 2 and FIG. 2A).

Among the RIG-I RNA aptamers of the present invention, SEQ ID NO: 61 is more robust to the removal of triphosphate (ppp) attached to the 5 'end by treatment with basic alkaline phosphatase (AP). It was confirmed that the promoter can be activated (see Example 2 and FIG. 2B). Through this, it can be seen that the RIG-I RNA aptamer sequence No. 61 acts as a ligand of RIG-I through the characteristic base sequence, not the structure made by 5'-ppp-ssRNA.

In addition, AP-treated RIG-I RNA aptamer SEQ ID NO 61 induces the binding between the transcript of the signal transducer and activator of transcription 1 (STAT1) and the interferon-stimulated response element (ISRE) responsible for signal transduction by interferon. It was confirmed that the transcriptional reaction can be activated (see Example 2 and FIG. 2C).

In addition, AP-treated RIG-I RNA aptamer SEQ ID NO 61 induces the activity of IRF3 (Interferon regulatory factor 3), a transcriptional protein that regulates gene expression of interferon-beta. As a result, the expression of the interferon-beta gene is strongly induced by AP-treated RIG-I RNA aptamer SEQ ID NO: 61.

In addition, RIG-I RNA aptamer SEQ ID No. 61 treated with AP is also used as a regulator of inflammatory response (RANTES) Regulated upon Activation, Normal T cell Expressed and presumably Secreted; NM_002985) was also strongly induced (see Example 2 and FIG. 2D).

In addition, the efficacy of interferon-beta synthesis by RIG-I RNA aptamer SEQ ID 61 treated with AP is dependent on the RIG-I protein present in the cell (see FIG. 3A). Efficacy of interferon-beta synthesis by RIG-I RNA aptamer SEQID 61 treated with AP is independent of intracellular MDA5 (melanoma-differentiation-associated gene 5, Helicard) proteins, but it does not affect RIG-I and / or MDA5 proteins. Overexpression also increases the efficacy of interferon-beta synthesis. Interferon-beta synthesis efficiency by AP-treated RIG-I RNA aptamer SEQ ID NO: 61 requires all of the RIG-I total protein (1-925 aa, SEQ ID NO: 108). The effect of RIG-I RNA aptamer sequence number 61 treated with AP on interferon-beta synthesis was compared with that of long-term polyI: C and short-length polyI: C. -I increase the activity of the protein.

In view of these results, the RIG-I RNA aptamer according to the present invention is useful as an immunomodulator (inducer) through increased interferon-beta synthesis efficacy. Therefore, another example of the present invention provides an immunomodulator containing the RIG-I RNA aptamer as an active ingredient. The immunomodulator may be one having an effect of increasing the synthesis of immune proteins, such as RIG-I gene, MDA5 gene, interferon (especially, interferon-beta) gene, Rantis (RANTES) gene.

The RIG-I RNA Apta by the immunomodulatory (induced) effect of increasing the synthesis of immune proteins such as RIG-I gene, MDA5 gene, interferon-beta, RANTES (RANTES) of the RIG-I RNA aptamer as described above Mer may have a therapeutic and / or prophylactic effect of various immune diseases associated with said immune protein.

Accordingly, another aspect of the present invention provides a composition for treating or preventing immune diseases containing the RIG-I RNA aptamer as an active ingredient. The immune disease may be selected from the group consisting of a viral disease (viral-induced disease) and interferon deficiency disease, the viral disease is hepatitis C virus, which is any RNA virus recognized by RIG-I (hepatitis C virus, HCV), Acute Respiratory Syndrome (SARS) virus, Influenza virus, West Nile Virus, Ebola Virus, Vesicular Stomatitis Virus, Newcastle Disease Virus (Newcastle Disease Virus) may be a disease caused by one or more RNA viruses selected from the group consisting of.

In addition, treatment of RIG-I RNA aptamer SEQ ID No. 61 with cells infected with GFP-tagged Newcastle disease virus (NDV-GFP) reduced both the protein and RNA of the virus (see Example <4-1>). . In addition, infection of NDV-GFP in cells previously treated with RIG-I RNA aptamer SEQ ID NO 61 resulted in decreased virus proliferation compared to untreated control cells. (See Example <4-2>). This suggests that the RIG-I RNA aptamer according to the present invention can be used as a virus growth inhibitor.

In view of these results, the RIG-I RNA aptamer according to the present invention is useful as an antiviral agent through virus growth inhibition. Therefore, another example of the present invention provides an antiviral agent containing the RIG-I RNA aptamer as an active ingredient. The virus may be any RNA virus recognized by RIG-I, such as hepatitis C virus (HCV), acute respiratory syndrome (SARS) virus, influenza virus, West Nile virus (West) Nile Virus, Ebola Virus, Vesicular Stomatitis Virus, and Newcastle Disease Virus.

In another example, the RIG-I RNA aptamer according to the present invention may serve to regulate expression of genes induced by RIG-I (see Examples 2 to 5). Accordingly, another example of the present invention provides a gene expression regulator comprising the RIG-I RNA aptamer. The gene may be any gene whose expression is induced by RIG-I, and may be an antiviral gene and / or an immune related gene such as the RIG-I gene, MDA5 gene, interferon (especially interferon-beta) gene, lantis gene It may be one or more selected from the group consisting of.

Doses of immunomodulators, compositions for treating or preventing immunological disorders, antiviral agents, gene expression modulators, etc. according to the present invention are appropriate to those skilled in the art depending on the condition and weight of the patient, the extent of the disease, the form of the preparation, the route of administration, and duration. Can be chosen. For example, for a more desirable effect, the dosage is appropriately selected in the range of 0.000001 mg / kg to 500 mg / kg, such as 0.001 mg / kg to 200 mg / kg per day, based on the active ingredient RNA aptamer It may be, but is not limited thereto. The administration may be carried out once a day or divided into several doses. The compositions of the present invention may be administered to a mammal, including a human, in various ways. All modes of administration may be expected, for example, by oral, intravenous, intramuscular, subcutaneous injection, and the like. The pharmaceutical dosage form of the composition of the present invention may be used in the form of a pharmaceutically acceptable salt of the active ingredient, and may be used alone or in combination with other pharmaceutically active compounds as well as in a suitable combination.

In another example, the present invention

Applying the RNA aptamer according to any one of claims 1 to 5 to a sample; And

Identifying the location or level of RNA aptamer bound to the protein to determine the location or amount of the protein encoded by RIG-I in the sample

It relates to, RIG-I protein analysis method.

The binding of the RNA aptamer to the protein can be detected by any conventional means, for example labeling the RNA aptamer with conventional labeling materials such as, for example, conventional fluorescences (eg, Cy5, etc.), radioisotopes, etc. React with the sample and track the intracellular location of the target protein through conventional detection means (e.g., fluorescence microscopy, Radioimmunodetection (RAID), etc.), and use an ELISA (Enzyme-linked Immunosorbent Assay) using a specific antibody. Likewise, it can be measured by conventional means to quantify the amount of protein in vitro.

As described above, the RNA aptamer of the present invention specifically binds to the RIG-I protein, increases the expression of interferon-beta, and inhibits the proliferation of RNA viruses. All viral infections applied to techniques that specifically detect RIG-I proteins in vitro or in vitro, used to modulate all antiviral responses mediated by RIG-I proteins, or mediated by RIG-I proteins It can be usefully used for the treatment of related diseases.

1A is a schematic diagram of a process for selecting RIG-I specific RNA aptamers through SELEX,
1B shows the in vitro binding of each of the radiolabeled RIG-I RNA aptamers SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63 Confirmed by RNA-EMSA,
FIG. 2A shows pPRDIII-I by each sequence of RIG-I RNA aptamer SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 61, and SEQ ID NO: 63 -Luc activity is confirmed,
FIG. 2B confirms pPRDIII-I-Luc activity by library RNA, RIG-I RNA aptamer SEQID 54, SEQ ID NO 56, SEQ ID NO 58, and SEQ ID NO 61 treated with an alkaline phosphatase. ,
Figure 2C confirms the effects of pPRDIII-I-Luc and pISRE-Luc the effect of AP-treated RIG-I RNA aptamer SEQ ID NO: 61,
2D shows the effects of RIG-I RNA aptamer SEQID 61 treated with AP at the mRNA levels of interferon-beta and lantis,
2E compares the effect of AP treated RIG-I RNA aptamer SEQ ID NO: 61 with interferon-beta (100 U / ml), non- or RNase III-treated polyI: C (1.5 ug / ml), AP-treated libraries Compared to pPRDIII-I-Luc activity,
FIG. 3A compares the effect of RIG-I RNA aptamer SEQID 61 treated with AP on PRDIII-I-Luc activity in cells in which the amount of each protein in the cell was reduced by using siRNA specific for RIG-I and MDA5. One,
FIG. 3B shows the results of Immuno-staining to confirm the effect of IRF3 activity on the intracellular position through AP-treated RIG-I RNA aptamer SEQ ID NO: 61,
3C compares the effect of RIG-I RNA aptamer SEQID 61 treated with AP with pPRDIII-I-Luc activity in cells overexpressing RIG-I or MDA5, respectively.
FIG. 3D compares the effect of RIG-I RNA aptamer SEQ ID 61 with pPRDIII-I-Luc activity in cells overexpressing various mutant genes of RIG-I,
Figure 4A is a result of processing the RIG-I RNA aptamer SEQ ID 61 treated with AP to the cells infected with NDV-GFP hourly and confirmed the change in the amount of virus as the amount of GFP protein,
Figure 4B is a result of processing the AP-treated RIG-I RNA aptamer SEQ ID No. 61 to the cells infected with NDV-GFP hourly and confirmed the change in the amount of virus through the RNA amount of the NDV,
Figure 4C is the result of confirming the amount of interferon-beta at the same time under these conditions,
Figures 5A and 5B is a result of confirming the virus amount changes in the amount of GFP protein infected with NDV-GFP in the cells treated with AP RNA-treated RIG-I RNA aptamer SEQ ID NO: 61,
5C and 5D show the results of confirming the RNA amount of NDV and the RNA amount of interferon-beta at the same time under these conditions.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example  One: RIG For -I protein RNA Of app tamer  making

To prepare RNA aptamers for RIG-I proteins, we used RNA libraries and purified RIG-I proteins.

RNA library of the single oligonucleotide of 40 bases containing a random 76mer oligonucleotide _{(5'-GCGCAAGCGTGCTGGGCC- [N 38 ~} 46] -CATAACCCAGAGGTCGA T -3 ', N is from the group consisting of A, T, G, and C 5'-primer (5'-GGTAATACGACTCACTATAGG GAGAGCGCAAGCGTGCTGGG-3 ', SEQ ID NO: 100) and 3'-primer (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3', SEQ ID NO: 101) with a T7 promoter as a template DNA libraries were prepared using the Durascribe T7 transcription kit (Epicentre Biotechnologies). After incorporating the purified RIG-I protein (Professor Byung-Ha Oh, POSTECH Biotechnology) and RNA library in vitro, only RNA bound to RIG-I was isolated and amplified by RT-PCR. RNA was synthesized again using the amplified DNA as a template, and the process of binding to RIG-I was repeated 13 times (Fig. 1A).

Sequencing was performed by selecting a total of 45 clones from 13 selected / amplified RNA pools. As a result, a total of 45 aptamer RNAs having independent nucleotide sequences were obtained (SEQ ID NOs: 54 to 98). RNA-EMSA was performed on eight randomly selected clones (SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 61, and SEQ ID NO: 63). (Fig. 1B).

Sequencing analysis showed that the selected RNA aptamer clones contained uracil (U) base in a very high proportion (52% on average), and were sequentially contiguous uracil base in all RIG-I RNA aptamers. The sequence structure (Un; n = 2-11) was found repeatedly. The alignment of 45 RNA sequences provided information on the position of the U on the RIG-I RNA aptamer random sequence.

5 '-------- U--U ----- UU--U ---- UUUUUUUU-UUUUUUUUUU-3'

The base sequence of the resulting RNA aptamer comprises _{38 ~ 46} N to mean A, G, C, 38 to 46 nucleotides U is randomly selected from among the base mixture with the same amount (U-rich region).

_{5'- GGUAAUACGACUCACUAUAGGGAGAGCGGAAGCGUGCUGGG N 38 ~ 46 CAUAACCCAGAG GUCGAUGGAUCCCCC} -3 '

RNA aptamer according to the present embodiment is composed of oligonucleotides selected from the group consisting of SEQ ID NO: 55 to 98, and for the stability the hydroxyl group attached to the second carbon position of U (uracil) and C (cytosine) fluorine It was produced by substituting with a group.

Above and SEQ ID NO: 54-98 removed the 5 'site necessary for sequence analysis, such as T7 polymerase binding site, and represented only as a sequence that actually functions as aptamer, the specific sequence is as follows (bold letters are U means the -rich region.

SEQ ID NO: 54

GCGGAAGCGUGCUGGG UCGAAUUUCCAUCUUGUAUAUAAACUAUGUCUAAAUUUUUUUUU CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 55

GCGGAAGCGUGCUGGGCC AUAUUUUUUUCAGGGUAGCUCUCAUAGUUUUUUUUUUUCGAUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 56

GCGGAAGCGUGCUGGGCC ACGUUUUAUUCAUAUUAUUUUCAAGUUAUUUGUUUGUGU CAUAACCCAGAGGUCGAUGGAU

SEQ ID NO: 57

GCGGAAGCGUGCUGGG UCGACUUUAAAUUUUUUCGGAUAUACACAAAUUAUUUUUUAAC CAUAACCCAGAGGUCGAU

SEQ ID NO: 58

GCGGAAGCGUGCUGGG GAAUUAAAAAUAAAACGUGUAUGGAAUCACUGAGGCAUUGG CAUAACCCAGAGGUCGAU

SEQ ID NO: 59

GCGGAAGCGUGCUGGGCC UAAUAGUGGUUUAUUCCACUCGACUACUUUUUUUGUUUUAUAU CAUAACCCAGAGGUCGAU

SEQ ID NO: 60

GCGGAAGCGUGCUGGG CCACACUUCAUUUCUAAGUCCGCUCAAUUUUGUUUUUUUUGC CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 61

GCGGAAGCGUGCUGGG CCACCAUCCGUAACUAGCUAAUACUUGUUAUCUUUUUAUUUU CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 62

GCGGAAGCGUGCUGGG UCCAUAUUUUACCCAGUAGUAUAAUGUUUUAAUUUUUUGUUUA CAUAACCCA

SEQ ID NO: 63

AAGCGUGCUGGG GCCAUAAUACCUAUACAUAUAUUAUAUCUUGUUUUGUUUGUUC CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 64

GCGGAAGCGUGCUGGG CUAGUAGAACUUUUGUUUUUUCGAUUAAUGUAUUUUUUAUUUGG CAUAACCCAGAGGUCGAU

SEQ ID NO: 65

GCGGAAGCGUGCUGGG GCGCUUUACCGACAUGUUGCACAUGCUUAUUUUAACUUUUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 66

GCGGAAGCGUGCUGGG UCUCCGGGAAGGAAUUUCUGUUUGUUAUUUUAUCUUACUUUU CAUAACCCAGAGGUCGAUGGAUCCCCC

SEQ ID NO: 67

GCGGAAGCGUGCUGGGCC GCUAGCAUACUUUCGCCAUCUAUAAUUACUUUUAUUUUUUA CAUAACCCA

SEQ ID NO: 68

GCGGAAGCGUGCUGGG UCUAAAUCAUUAAUUAUCCGCAUCUCAACAUGUUUUACUUUA CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 69

GCGGAAGCGUGCUGGG UCCUUUAAUAUGAGUUGUCAUUAUUUUGAUUGUUUUUUUUUG CAUAACCCAGAGGUCGAU

SEQ ID NO: 70

GCGGAAGCGUGCUGGGCC UACGUCGCUCGUUUCUAUUAAUUUCGUAUUUUGUUUUUC CAUAACCCAGAGGUCGAU

SEQ ID NO: 71

GCGGAAGCGUGCUGGG GCGUUUUUCGACUCUCAUAUUAUUAAUUCAAGUGUAUAUUGC CAUAACCCA

SEQ ID NO: 72

GCGGAAGCGUGCUGGGCC AUAUAACGGACCUCGACCGCUACCUUUUGUCUAAUUUUUUUAUUUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 73

GCGGAAGCGUGCUGGGCC AGCUAUCUUGUUAUUUUAUUAACUUUCUGAUUUUUUAU CAUAACCCAGAGGUCGAU

SEQ ID NO: 74

GCGGAAGCGUGCUGGG CCAUACCUUUACCGCAAUUCGUUCCUAUUUAGCAUUUUUUUC CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 75

GCGGAAGCGUGCUGGG UCUAUUUUCUUUCUCUUGCUAAUUUAUUUUAACUUCAUGUAU CAUAACCCAGAGGUCGAU

SEQ ID NO: 76

GCGGAAGCGUGCUGGG UCAACUAGAAAGUUCGUUUUAUUUUGAUGUUAUUUGAUUUUUA CAUAACCCAA

SEQ ID NO: 77

GCGGAAGCGUGCUGGGCC UUCAUGGGCUAAUGACCUCUUAUUCUUAUUUAUUUGUUUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 78

GCGGAAGCGUGCUGGG GCAUUUCCAGAUUUAUUUAUUGGCAAUCUAUAUUUUUAUUUA CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 79

GCGGAAGCGUGCUGGG ACUAUUUAACACGGCUUUACAAAACUUUGCUUGUUUUUUUUUUGUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 80

GCGGAAGCGUGCUGGG UCAUAAUAUAUAUCAUUGCUCUUGUUAAUUUGUUUAUUUUUCA CAUAACCCAGAGGUCGAU

SEQ ID NO: 81

GCGGAAGCGUGCUGGGCC UUCCAUCCUUUUUUUAUGAUCCAUAAUUAACAUUUCUUUUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 82

GCGGAAGCGUGCUGGG UCACGAUAUUUUUUAGCUAGUGUCAUACAGUUUUUUUAUUUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 83

GCGGAAGCGUGCUGGG CUAAAUCUUAUUUCUAAUUUUGUAUUUUGUCUAUGAUUUUUU CAUAACCCA

SEQ ID NO: 84

GCGGAAGCGUGCUGG ACAUGUGACAUUACUAAGUAACUUUUAAUUUUUAAAUCUUUUU CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 85

GCGGAAGCGUGCUGGGCC GUUUUAGUAUUUCUUUCAUUUAUAAUUUUGACUAUCUUUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 86

GCGGAAGCGUGCUGGG UCGUAGUGCACUAAUUCAUGUCACAUUUUUUAUAUUUGUUUUU CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 87

GCGGAAGCGUGCUGGG CUGGAAACGCUUCGCUUAAUAUUUGUAUUUUCGUUUAUUUC CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 88

GCGGAAGCGUGCUGGG UCUUUAUUGCGUUUUCCGUUGGAUUUGUGCAACUGUUUUUUUAUU CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 89

GCGGAAGCGUGCUGGG UCUAUUACACUCGAGUCUCAUUUGUUUUACAUGUUAUUUUUC CAUAACCCAGAGGUCGAU

SEQ ID NO: 90

GCGGAAGCGUGCUGGG CUUCGAUUAUUAAGAUUUCCGAACAUUUUUUAGUUUAUUUUU CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 91

GCGGAAGCGUGCUGGGCC CUAUCCAAGAUUUGGAAAUUUAUUGAUGUUUUUUUGUUG CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 92

GCGGAAGCGUGCUGGG CCAUUGAAUUUUGAUGUACACAGUUUAUUUCUUUUUUGGUUUA CAUAACCCAGAGGUCGAUGGAU

SEQ ID NO: 93

GCGGAAGCGUGCUGGG CUCAUUAGAAAUCUAUUAUUCGUUUUGUUUUUCUCUGUUUC CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 94

GCGGAAGCGUGCUGGG ACGAAGUCAUAAUGUCGUAUAUCUCUUAUUUGUUUUUUUGU CAUAACCCAGAGGUCGAU

SEQ ID NO: 95

GCGGAAGCGUGCUGGG UCGUCCAGUUCUCACUCACCGAUUUUUGUUUGUUUCUUAUUAA CAUAACCCAGAGGUCGAU

SEQ ID NO: 96

GCGGAAGCGUGCUGGG UCACUAACUUAGCUUUGCGAUAGAAGCAUUUACUACUUUUUUUA CAUAACCCAGAGGUCGAUGGAUCCCCCC

SEQ ID NO: 97

GCGGAAGCGUGCUGGG GCCACAAAGGCGGUCUUAUCUUCAUUUAAUUUUUUAAUUUU CAUAACCCAGAGGUCGAU

SEQ ID NO: 98

GCGGAAGCGUGCUGGG UCAUUUUCAUCAAAUAUAGUUAUCAAAAUUGUUAUUGUUUU CAUAACCCAGAGGUCGAU

Example  2: RIG -I RNA In Aptamer  Test for increasing interferon-beta synthesis

pPRD-III-I-luc is a reporter plasmid that is used to measure the activity of transcriptional regulation by IRF3 transcriptional protein. The expression of genes that make luciferase enzyme is regulated by the promoter of interferon-beta gene. Have RIG-I RNA aptamer (SEQ ID NO: 54 (Aptamer 1), SEQ ID NO: 55 (Aptamer 2), SEQ ID NO: 56 (Aptamer 3), SEQ ID NO :) in a HepG2 human liver cancer cell line (ATCC) containing a pPRDIII-I-luc vector 57 (Aptamer 4), SEQ ID NO: 58 (Aptamer 5), SEQ ID NO: 59 (Aptamer 6), SEQ ID NO: 61 (Aptamer 9), SEQ ID NO: 63 (Aptamer 11), respectively, at a concentration of 1.5 ug / ml As a result of measuring the synthesis efficacy of interferon-beta, the activity of PRDIII-I-luc was significantly increased compared to the control by all RNA aptamers used in the experiment (see FIG. 2A, Dual-Sold by Promega). Experiment according to manufacturer's protocol using luciferase reporter assay kit).

Efficacy of Interferon-beta Synthesis of RIG-I RNA Aptamers SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58 Treated with Alkaline Phosphatase (AP), Roche, 30 U AP for 20 ug RNA This decreased compared to before AP treatment (Fig. 2B, Library: RNA library of Example 1), CL1 (SEQ ID NO: 54), CL3 (SEQ ID NO: 56), CL5 (SEQ ID NO: 58)). This translates into the partial recognition of the 5'triphosphate-ssRNA structure of these RNA aptamers by the RIG-I protein.

On the other hand, in the case of RIG-I RNA aptamer SEQID 61 treated with alkaline phosphatase (AP), the synthesis efficacy of interferon-beta was no difference even after removal of 5'-ppp using dephosphorase or was significantly greater than before removal. Increased (see FIG. 2B, CL9 (SEQ ID NO: 61)). This RIG-I RNA aptamer SEQ ID NO 61 is interpreted as a result recognized by the RIG-I protein or binding to the RIG-I protein through a new structure or nucleotide sequence unknown.

RIG-I RNA aptamer SEQ ID 61 treated with AP increases the activity of the STAT1 transcriptional protein responsible for signal transduction by interferon (see FIG. 2C). PRDIII-I of FIG. 2C is known as a binding site of IRF3 / 7, which is an important transcription factor for the expression of the interferon-beta gene. Dr. Katherine A. Fitzgerald (University of Massachusetts) was used. ISRE is known as the binding site of STAT activated by interferon signal transduction, and was purchased from Stratagene. Luciferase assay was previously used a kit of promega (see Example 5). As a result, the synthesis of interferon-beta was increased by AP 61 RIG-I RNA aptamer, and the expression of RANTES, an important substance mediating an inflammatory response, was also significantly increased (see FIG. 2D). , Q-real-time PCR results, see Example 6).

The efficacy of interferon-beta synthesis by the RIG-I protein is increased by polyI: C treatment, which is an artificially synthesized double helix RNA strand. Longer polyI: C (Sigma) transmits signals primarily through the MDA5 protein, whereas shorter polyI: C (Sigma) cleaved by RNaseIII (TAKARA) forms interferon-beta synthesis signals via RIG-I. To pass. Interferon-beta synthesis efficacy by AP-treated RIG-I RNA aptamer SEQ ID NO 61 is most effective when compared to short polyI: C treated with the same amount of long polyI: C or RNaseIII ( 2e).

AP treatment through a filter binding assay (White, R. et al, 2001, Mol Ther., 4 (6), 567-73, Fitzwater, T et al, 1996, methods Enzymol (267), 275-301). As a result of confirming the Kd value of the RIG-I RNA aptamer sequence number 62, when the Bmax value was 0.2945 (standard error 1.21E-02), Kd = 37.2333 (standard error 6.5659) (see FIG. 2F).

Example  3: RIG -I RNA Aptamer  Signal transduction through

Biomaterials involved in the efficacy of interferon-beta synthesis through RIG-I RNA aptamers were identified. For this purpose non-specific siRNA (siControl, Quiagen, 5'-GAA UUU GCA CGA AAA CGC C-3 ', SEQ ID NO: 112), MDA-5 specific siRNA (siMDA5, Qiagen validated siRNA (S103649037)), and RIG-I specific Interferon-beta of RIG-I RNA aptamer SEQ ID NO: 61 treated with AP in HepG2 cell line treated with red siRNA (siRIG-I, Quiagen, 5'-GAG GUG CAG UAU AUU CA GG-3 ', SEQ ID NO: 113) Synthetic potency was compared with potency by RNA library (Example 1) (see FIG. 3A). Compared to control or MDA-5 siRNA-treated cells, RIG-I RNA aptamer SEQ ID No. 61 treated with AP was characteristic only in cells in which RIG-I protein expression was decreased by RIG-I siRNA treatment. Interferon-beta synthesis efficacy decreased. This suggests that RIG-I protein is required for signal transduction by RIG-I RNA aptamers.

It was observed that the intracellular location of IRF3, a transcription factor that regulates interferon-beta gene expression, was shifted from the I cytoplasm to the nucleus by AP-treated RIG-I RNA aptamer SEQID 61 (FIG. 3B). See Library: RNA library, Clone9: SEQ ID NO: 61, PolyC: Sigma). This suggests that signal transduction by RIG-I RNA aptamer is specific to RIG-I and is via IRF3.

Huh7 human liver cancer cell line (ATCC) with or without intracellular RIG-I activity was used to determine the biomaterials required for the signal transduction process through RIG-I RNA aptamers. To this end, first, pEF-BOS / Flag-RIG-I (Dr. Takashi Fujita, Institute for virus research Kyoto University) and pEF-BOS / myc-MDA5 (Dr S. Goodbourn, University of London, London, Great) Britain) was transfected with Lipofectamine2000 (Invitrogen), respectively, and overexpressed the RIG-I or MDA-5 gene, and then the AP-treated RIG-I RNA aptamer SEQ ID NO: 61 to the RNA library to the effect of synthesis Compared with efficacy (see FIG. 3C). As a result, in addition to the RIG-I protein, it can be seen that the MDA-5 protein may have a positive effect on signal transmission by the RIG-I RNA aptamer.

After overexpressing various mutant genes of RIG-I in the Huh7 cell line, the interferon-beta synthesis efficacy by RIG-I RNA aptamer SEQ ID 61 treated with AP was compared with that by the RNA library (Fig. 3D). The mutant genes of RIG-I are: 1) gene with the CARD domain removed from RIG-I (Helicase), 2) gene with only the second exon removed from RIG-I (△ exon2), 3) RNA helicase from RIG-I The gene with the domain removed (CARD), and 4) the gene with the RD domain of RIG-I removed (ΔRD) was used. All RIG-I mutant genes examined did not show any interferon-beta synthesis potency by AP-treated RIG-I RNA aptamer SEQ ID NO 61, which is normal for signal transduction by RIG-I aptamer. It can be seen that I protein is required.

Example  4: RIG -I RNA In Aptamer  Inhibition of virus proliferation by

<4-1> Processed after virus infection RIG -I RNA Of app tamer  effect

NDV-GFP (Dr. Peter Palese, Mount Sinai School of Medicine) was infected with the HepG2 cell line (the cells were treated with 10% FBS containing MEM in an amount such that at least 50% of the cells were GFP positive), 12 After hours, AP treated RIG-I RNA aptamer SEQID 61 was treated for 6 and 12 hours each and the amount of intracellular virus was examined by Western blot assay for GFP protein (see Example 7). As a result, it was found that the GFP protein was significantly reduced in the sample treated with RIG-I aptamer when compared to the sample infected with NDV-GFP only (see FIG. 4A).

After 3 hours of NDV-GFP infection with HepG2 cell line, AP-treated RIG-I RNA aptamer SEQID 61 was treated for 3 and 9 hours, respectively, and the amount of intracellular virus was real-time reverse transcription polymerase chain to NDV-RNA. Observation was made by the reaction (real time RT-PCR) method (see Example 6). As a result, it was observed that the RNA amount of the NDV virus was significantly reduced in the sample treated with RIG-I aptamer when compared to the sample infected only NDV-GFP (Fig. 4B).

At the same time, the cells treated with NDV-GFP were treated with AP-treated RIG-I RNA aptamer SEQ ID No. 61 for 3 hours and 9 hours, respectively, and then the amount of interferon-beta synthesized in the cells was real-time reverse transcription of the interferon-beta gene. Observation was made by a polymerization chain reaction (real time RT-PCR) method (see Example 6). As a result, it was observed that the gene expression of interferon-beta was significantly increased in the sample treated with RIG-I aptamer compared to the sample infected with NDV-GFP only (Fig. 4C). Through this, it can be seen that RIG-I RNA aptamer SEQ ID 61 treated with AP has an effect of inhibiting virus proliferation in cells infected with RNA virus.

<4-2> Treated before virus infection RIG -I RNA Of app tamer  effect

HepG2 cell line was treated with AP treated RIG-I RNA aptamer SEQID 61 for 6 hours, then infected with NDV-GFP for 12 hours and the amount of intracellular virus was examined by Western blot assay for GFP protein (Example 7). As a result, it can be seen that the amount of GFP protein was significantly reduced in the sample pre-treated with RIG-I aptamer compared to the sample infected with NDV-GFP only (see FIG. 5A).

In addition, the amount of NDV-GFP virus remaining in cells infected with NDV-GFP after pre-treatment of AP-treated RIG-I RNA aptamer SEQ ID No. 61 was examined under the microscope for fluorescence of the GFP protein. As a result, it can be seen that the amount of GFP protein was significantly reduced in cells pretreated with RIG-I aptamer compared to cells infected only with NDV-GFP (see FIG. 5B).

In addition, after infecting the NDV-GFP cells with the AP-treated RIG-I RNA aptamer SEQID 61, the amount of NDV-GFP virus remaining in the cells was converted to NDV virus-specific gene RNA in real time. Observation was made by a real time RT-PCR method (see Example 6). As a result, it was observed that the RNA amount of the NDV virus was significantly reduced in the sample treated with RIG-I aptamer when compared to the sample infected with NDV-GFP only (see FIG. 5C).

At the same time, when NDV-GFP was infected with a cell pretreated with RIG-I RNA aptamer SEQ ID 61, which treated AP, the amount of interferon-beta synthesized in the cell was transferred to the interferon-beta gene. Were observed by real time RT-PCR method (see Example 6). As a result, interferon-beta gene expression was significantly increased in the samples pretreated with RIG-I aptamer compared to cells infected only with NDV-GFP (Fig. 5D). Through this, it can be seen that the pretreatment with AP-treated RIG-I RNA aptamer SEQ ID NO 61 has an effect of effectively inhibiting the proliferation of infected RNA virus.

Example  5: Luciferase Assay  ( Luciferase assay )

pPRDIII-I-luc or pISRE-Luc reporter plasmids were injected into HepG2 or Huh7 cells with Lipofectamine 2000 (invitrogen) preparations along with pRL-CMV plasmids. After 36 hours, treated with an RNA library treated with interferon-beta 100U / ml (purchased from the R & D system), polyI: C (purchased from Sigma), AP, or RIG-I RNA aptamer of SEQ ID NO: 62, 6- After 12 hours, reporter enzyme activity was measured using a Dual-luciferase kit (purchased from Promega). In some cases, the expression vectors of RIG-I, Helicase, Δexon2, CARD, ΔRD and MDA5 cloned into pEF-BOS, pEF-BOS together with luciferase reporter vectors were also injected into the cells. The RIG-I expression vector cloned into pEF-BOS (pEF-BOS-Flag-RIG-I) was described by Dr. It was used by Takashi Fujita (Institute for virus research Kyoto University). With this template, Δexon2 is 5'- CCT GGT TTA GGG AGG GTT ATT CTG GAC TTT-3 '(SEQ ID NO: 114) and 5'-AAA GTC CAG AAT AAC CCT CCC TAA ACC AGG-3' (SEQ ID NO: 115) ) Primer, ΔRD is 5'-GCT CTA GAT AAG CCA CCA TGG AT-3 '(SEQ ID NO: 116) and 5'-CCA TCG ATT CAT CTT GCT CTT CCT CTG CC-3' (SEQ ID NO: 117) primer, CARD Primers 5'-GAAGGCCTATGGATTATAAGGATGAT-3 '(SEQ ID NO: 118) and 5'-CCATCGATTCAAGACACTTCTGAAGG-3' (SEQ ID NO: 119), helicase is 5'-GAAGGCCTATGGATTATAAGGATGAT-3 '(SEQ ID NO: 120) and 5'-CCATCGATTCATTT-3' (SEQ ID NO: 121) It was produced in the laboratory using a primer. The MDA5 expression vector cloned into pEF-BOS (pEF-BOS / myc-MDA5) was used from Dr S. Goodbourn (University of London, London, Great Britain).

Example  6: real time Reverse transcription  Polymerization Chain Reaction ( real - time RT - PCR )

Total RNA of the HepG2 cell line was extracted using TRIzol reagent (purchased from Invitrogen), and then cDNA was synthesized using an Improm-II reverse transcription system (purchased from Promega) using 1 ug of total RNA as a template. For real-time reverse transcription polymerase chain reaction, cDNA, primers for each gene, SYBR premix Ex-Taq (Takara) and One-step ^TM Real-time PCR system (AppliedBiosystem) were used. The primers of each gene used in the experiment are as follows. IFNb, 5'-TGCTCTCCTGTTGTGCTTCTCC-3 '(SEQ ID NO: 102) &5'-CATCTCATAGATGGTCAATGCGG-3' (SEQ ID NO: 103); RANTES, 5'-ATGAAGGTCTCCAAAGAG-3 '(SEQ ID NO: 104) &5'-GCTCATCTCCAAAGAG-3' (SEQ ID NO: 105); TFNa, 5'-CACCATCAGCCGCATC-3 '(SEQ ID NO: 106) &5'-CAGGGCAATGATCCCA-3' (SEQ ID NO: 107); NDV-GFP, 5'-TTGATGGCAGGCCTCTTGC-3 '(SEQ ID NO: 108) &5'-GGAGGATGTTGGACGCATT-3' (SEQ ID NO: 109); Actin, 5'-TCATGAAGTGTGACGTTGACATCCGT-3 '(SEQ ID NO: 110), and 5'-CCTAGAAGCATTTGCGGTGCACGATG-3 (SEQ ID NO: 111).

Example  7: Western Blot and  Immunofluorescence staining Western blot and  Immunofluorescence staining )

Cell lysates used in the luciferase assay or cell lysates obtained using lysis buffer (25 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate) After separation by SDS-PAGE, GFP (Santacruz), RIG-I (ALEXIS Biochemicals), MDA5 (ProSci Incorporated), Flag (M2, Sigma), c-Myc (Roche), and β-Actin (Santacruz) The amount of each protein was confirmed by using the antibody recognized as a target. The following experimental method was used to confirm the intracellular location of IRF3. HepG2 cell lines were incubated on cover-glass and then treated with polyI: C or aptamer for 6 hours. Afterwards, the cells were fixed with 4% paraformaldehyde and the cells permeable with 0.2% TritonX-100. Then, the anti-IRF3 (Santacruz) and anti-Rabbit IgG-Alexa Fluor 488 (Invitrogen) antibodies were used to Location was detected. Hoechst 33258 (Sigma) was used for nuclear staining. Fluorescence signal was confirmed using a fluorescence microscope.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION          POSCO <120> RNA Aptamer Targeting RIG-I Protein and Use <130> DPP-2010-0469-KR <160> 121 <170> Kopatentin 1.71 <210> 1 <211> 44 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 1 ucgaauuucc aucuuguaua uaaacuaugu cuaaauuuuu uuuu 44 <210> 2 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 2 auauuuuuuu caggguagcu cucauaguuu uuuuuuuucg auu 43 <210> 3 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 3 acguuuuauu cauauuauuu ucaaguuauu uguuugugu 39 <210> 4 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 4 ucgacuuuaa auuuuuucgg auauacacaa auuauuuuuu aac 43 <210> 5 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 5 gaauuaaaaa uaaaacgugu auggaaucac ugaggcauug g 41 <210> 6 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 6 uaauaguggu uuauuccacu cgacuacuuu uuuuguuuua uu 42 <210> 7 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 7 ccacacuuca uuucuaaguc cgcucaauuu uguuuuuuuu gc 42 <210> 8 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 8 ccaccauccg uaacuagcua auacuuguua ucuuuuuauu uu 42 <210> 9 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 9 uccauauuuu acccaguagu auaauguuuu aauuuuuugu uua 43 <210> 10 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 10 gccauaauac cuauacauau auuauaucuu guuuuguuug uuc 43 <210> 11 <211> 44 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 11 cuaguagaac uuuuguuuuu ucgauuaaug uauuuuuuau uugg 44 <210> 12 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 12 gcgcuuuacc gacauguugc acaugcuuau uuuaacuuuu u 41 <210> 13 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 13 ucuccgggaa ggaauuucug uuuguuauuu uaucuuacuu uu 42 <210> 14 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 14 gcuagcauac uuucgccauc uauaauuacu uuuauuuuuu a 41 <210> 15 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 15 ucuaaaucau uaauuauccg caucucaaca uguuuuacuu ua 42 <210> 16 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 16 uccuuuaaua ugaguuguca uuauuuugau uguuuuuuuu ug 42 <210> 17 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 17 uacgucgcuc guuucuauua auuucguauu uuguuuuuc 39 <210> 18 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 18 gcguuuuucg acucucauau uauuaauuca aguguauauu gc 42 <210> 19 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 19 auauaacgga ccucgaccgc uaccuuuugu cuaauuuuuu uauuuu 46 <210> 20 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 20 agcuaucuug uuauuuuauu aacuuucuga uuuuuuau 38 <210> 21 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 21 ccauaccuuu accgcaauuc guuccuauuu agcauuuuuu uc 42 <210> 22 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 22 ucuauuuucu uucucuugcu aauuuauuuu aacuucaugu au 42 <210> 23 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 23 aacuagaaag uucguuuuau uuugauguua uuugauuuuu a 41 <210> 24 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 24 uucaugggcu aaugaccucu uauucuuauu uauuuguuuu 40 <210> 25 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 25 gcauuuccag auuuauuuau uggcaaucua uauuuuuauu ua 42 <210> 26 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 26 acuauuuaac acggcuuuac aaaacuuugc uuguuuuuuu uuuguu 46 <210> 27 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 27 ucauaauaua uaucauugcu cuuguuaauu uguuuauuuu uca 43 <210> 28 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 28 uuccauccuu uuuuuaugau ccauaauuaa cauuucuuuu u 41 <210> 29 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 29 ucacgauauu uuuuagcuag ugucauacag uuuuuuuauu uu 42 <210> 30 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 30 cuaaaucuua uuucuaauuu uguauuuugu cuaugauuuu uu 42 <210> 31 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 31 acaugugaca uuacuaagua acuuuuaauu uuuaaaucuu uuu 43 <210> 32 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 32 guuuuaguau uucuuucauu uauaauuuug acuaucuuuu 40 <210> 33 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 33 ucguagugca cuaauucaug ucacauuuuu uauauuuguu uuu 43 <210> 34 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 34 cuggaaacgc uucgcuuaau auuuguauuu ucguuuauuu c 41 <210> 35 <211> 45 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 35 ucuuuauugc guuuuccguu ggauuugugc aacuguuuuu uuauu 45 <210> 36 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 36 ucuauuacac ucgagucuca uuuguuuuac auguuauuuu uc 42 <210> 37 <211> 42 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 37 cuucgauuau uaagauuucc gaacauuuuu uaguuuauuu uu 42 <210> 38 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 38 cuauccaaga uuuggaaauu uauugauguu uuuuuguug 39 <210> 39 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 39 ccauugaauu uugauguaca caguuuauuu cuuuuuuggu uua 43 <210> 40 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 40 cucauuagaa aucuauuauu cguuuuguuu uucucuguuu c 41 <210> 41 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 41 acgaagucau aaugucguau aucucuuauu uguuuuuuug u 41 <210> 42 <211> 43 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 42 ucguccaguu cucacucacc gauuuuuguu uguuucuuau uaa 43 <210> 43 <211> 44 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 43 ucacuaacuu agcuuugcga uagaagcauu uacuacuuuu uuua 44 <210> 44 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 44 gccacaaagg cggucuuauc uucauuuaau uuuuuaauuu u 41 <210> 45 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> U-rich region of RNA aptamer for RIG-I protein <400> 45 ucauuuucau caaauauagu uaucaaaauu guuauuguuu u 41 <210> 46 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> 5 'terminal oligonucleotides of RNA aptamer for RIG-I protein <400> 46 gcggaagcgu gcugggcc 18 <210> 47 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> 5 'terminal oligonucleotides of RNA aptamer for RIG-I protein <400> 47 gcggaagcgu gcuggg 16 <210> 48 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> 5 'terminal oligonucleotides of RNA aptamer for RIG-I protein <400> 48 gcggaagcgu gcugg 15 <210> 49 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> 5 'terminal oligonucleotides of RNA aptamer for RIG-I protein <400> 49 aagcgugcug gg 12 <210> 50 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> 3 'terminal oligonucleotides of RNA aptamer for RIG-I protein <400> 50 cauaacccaa 10 <210> 51 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> 3 'terminal oligonucleotides of RNA aptamer for RIG-I protein <400> 51 cauaaccca 9 <210> 52 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> 3 'terminal oligonucleotides of RNA aptamer for RIG-I protein <400> 52 cauaacccag aggucgau 18 <210> 53 <211> 28 <212> RNA <213> Artificial Sequence <220> <223> 3 'terminal oligonucleotides of RNA aptamer for RIG-I protein <400> 53 cauaacccag aggucgaugg aucccccc 28 <210> 54 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 54 gcggaagcgu gcugggucga auuuccaucu uguauauaaa cuaugucuaa auuuuuuuuu 60 cauaacccag aggucgaugg aucccccc 88 <210> 55 <211> 79 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 55 gcggaagcgu gcugggccau auuuuuuuca ggguagcucu cauaguuuuu uuuuuucgau 60 ucauaaccca gaggucgau 79 <210> 56 <211> 79 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 56 gcggaagcgu gcugggccac guuuuauuca uauuauuuuc aaguuauuug uuugugucau 60 aacccagagg ucgauggau 79 <210> 57 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 57 gcggaagcgu gcugggucga cuuuaaauuu uuucggauau acacaaauua uuuuuuaacc 60 auaacccaga ggucgau 77 <210> 58 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 58 gcggaagcgu gcuggggaau uaaaaauaaa acguguaugg aaucacugag gcauuggcau 60 aacccagagg ucgau 75 <210> 59 <211> 78 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 59 gcggaagcgu gcugggccua auagugguuu auuccacucg acuacuuuuu uuguuuuauu 60 cauaacccag aggucgau 78 <210> 60 <211> 86 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 60 gcggaagcgu gcugggccac acuucauuuc uaaguccgcu caauuuuguu uuuuuugcca 60 uaacccagag gucgauggau cccccc 86 <210> 61 <211> 86 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 61 gcggaagcgu gcugggccac cauccguaac uagcuaauac uuguuaucuu uuuauuuuca 60 uaacccagag gucgauggau cccccc 86 <210> 62 <211> 68 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 62 gcggaagcgu gcugggucca uauuuuaccc aguaguauaa uguuuuaauu uuuuguuuac 60 auaaccca 68 <210> 63 <211> 83 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 63 aagcgugcug gggccauaau accuauacau auauuauauc uuguuuuguu uguuccauaa 60 cccagagguc gauggauccc ccc 83 <210> 64 <211> 78 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 64 gcggaagcgu gcugggcuag uagaacuuuu guuuuuucga uuaauguauu uuuuauuugg 60 cauaacccag aggucgau 78 <210> 65 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 65 gcggaagcgu gcuggggcgc uuuaccgaca uguugcacau gcuuauuuua acuuuuucau 60 aacccagagg ucgau 75 <210> 66 <211> 85 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 66 gcggaagcgu gcugggucuc cgggaaggaa uuucuguuug uuauuuuauc uuacuuuuca 60 uaacccagag gucgauggau ccccc 85 <210> 67 <211> 68 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 67 gcggaagcgu gcugggccgc uagcauacuu ucgccaucua uaauuacuuu uauuuuuuac 60 auaaccca 68 <210> 68 <211> 86 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 68 gcggaagcgu gcugggucua aaucauuaau uauccgcauc ucaacauguu uuacuuuaca 60 uaacccagag gucgauggau cccccc 86 <210> 69 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 69 gcggaagcgu gcuggguccu uuaauaugag uugucauuau uuugauuguu uuuuuuugca 60 uaacccagag gucgau 76 <210> 70 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 70 gcggaagcgu gcugggccua cgucgcucgu uucuauuaau uucguauuuu guuuuuccau 60 aacccagagg ucgau 75 <210> 71 <211> 67 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 71 gcggaagcgu gcuggggcgu uuuucgacuc ucauauuauu aauucaagug uauauugcca 60 uaaccca 67 <210> 72 <211> 82 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 72 gcggaagcgu gcugggccau auaacggacc ucgaccgcua ccuuuugucu aauuuuuuua 60 uuuucauaac ccagaggucg au 82 <210> 73 <211> 74 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 73 gcggaagcgu gcugggccag cuaucuuguu auuuuauuaa cuuucugauu uuuuaucaua 60 acccagaggu cgau 74 <210> 74 <211> 86 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 74 gcggaagcgu gcugggccau accuuuaccg caauucguuc cuauuuagca uuuuuuucca 60 uaacccagag gucgauggau cccccc 86 <210> 75 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 75 gcggaagcgu gcugggucua uuuucuuucu cuugcuaauu uauuuuaacu ucauguauca 60 uaacccagag gucgau 76 <210> 76 <211> 69 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 76 gcggaagcgu gcugggucaa cuagaaaguu cguuuuauuu ugauguuauu ugauuuuuac 60 auaacccaa 69 <210> 77 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 77 gcggaagcgu gcugggccuu caugggcuaa ugaccucuua uucuuauuua uuuguuuuca 60 uaacccagag gucgau 76 <210> 78 <211> 86 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 78 gcggaagcgu gcuggggcau uuccagauuu auuuauuggc aaucuauauu uuuauuuaca 60 uaacccagag gucgauggau cccccc 86 <210> 79 <211> 80 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 79 gcggaagcgu gcugggacua uuuaacacgg cuuuacaaaa cuuugcuugu uuuuuuuuug 60 uucauaaccc agaggucgau 80 <210> 80 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 80 gcggaagcgu gcugggucau aauauauauc auugcucuug uuaauuuguu uauuuuucac 60 auaacccaga ggucgau 77 <210> 81 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 81 gcggaagcgu gcugggccuu ccauccuuuu uuuaugaucc auaauuaaca uuucuuuuuc 60 auaacccaga ggucgau 77 <210> 82 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 82 gcggaagcgu gcugggucac gauauuuuuu agcuaguguc auacaguuuu uuuauuuuca 60 uaacccagag gucgau 76 <210> 83 <211> 67 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 83 gcggaagcgu gcugggcuaa aucuuauuuc uaauuuugua uuuugucuau gauuuuuuca 60 uaaccca 67 <210> 84 <211> 86 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 84 gcggaagcgu gcuggacaug ugacauuacu aaguaacuuu uaauuuuuaa aucuuuuuca 60 uaacccagag gucgauggau cccccc 86 <210> 85 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 85 gcggaagcgu gcugggccgu uuuaguauuu cuuucauuua uaauuuugac uaucuuuuca 60 uaacccagag gucgau 76 <210> 86 <211> 87 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 86 gcggaagcgu gcugggucgu agugcacuaa uucaugucac auuuuuuaua uuuguuuuuc 60 auaacccaga ggucgaugga ucccccc 87 <210> 87 <211> 85 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 87 gcggaagcgu gcugggcugg aaacgcuucg cuuaauauuu guauuuucgu uuauuuccau 60 aacccagagg ucgauggauc ccccc 85 <210> 88 <211> 89 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 88 gcggaagcgu gcugggucuu uauugcguuu uccguuggau uugugcaacu guuuuuuuau 60 ucauaaccca gaggucgaug gaucccccc 89 <210> 89 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 89 gcggaagcgu gcugggucua uuacacucga gucucauuug uuuuacaugu uauuuuucca 60 uaacccagag gucgau 76 <210> 90 <211> 86 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 90 gcggaagcgu gcugggcuuc gauuauuaag auuuccgaac auuuuuuagu uuauuuuuca 60 uaacccagag gucgauggau cccccc 86 <210> 91 <211> 85 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 91 gcggaagcgu gcugggcccu auccaagauu uggaaauuua uugauguuuu uuuguugcau 60 aacccagagg ucgauggauc ccccc 85 <210> 92 <211> 81 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 92 gcggaagcgu gcugggccau ugaauuuuga uguacacagu uuauuucuuu uuugguuuac 60 auaacccaga ggucgaugga u 81 <210> 93 <211> 85 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 93 gcggaagcgu gcugggcuca uuagaaaucu auuauucguu uuguuuuucu cuguuuccau 60 aacccagagg ucgauggauc ccccc 85 <210> 94 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 94 gcggaagcgu gcugggacga agucauaaug ucguauaucu cuuauuuguu uuuuugucau 60 aacccagagg ucgau 75 <210> 95 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 95 gcggaagcgu gcugggucgu ccaguucuca cucaccgauu uuuguuuguu ucuuauuaac 60 auaacccaga ggucgau 77 <210> 96 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 96 gcggaagcgu gcugggucac uaacuuagcu uugcgauaga agcauuuacu acuuuuuuua 60 cauaacccag aggucgaugg aucccccc 88 <210> 97 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 97 gcggaagcgu gcuggggcca caaaggcggu cuuaucuuca uuuaauuuuu uaauuuucau 60 aacccagagg ucgau 75 <210> 98 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> RNA aptamer for RIG-I protein <400> 98 gcggaagcgu gcugggucau uuucaucaaa uauaguuauc aaaauuguua uuguuuucau 60 aacccagagg ucgau 75 <210> 99 <211> 925 <212> PRT <213> Artificial Sequence <220> <223> full length amino acid sequence of RIG-I protein of Homo sapiens <400> 99 Met Thr Thr Glu Gln Arg Arg Ser Leu Gln Ala Phe Gln Asp Tyr Ile   1 5 10 15 Arg Lys Thr Leu Asp Pro Thr Tyr Ile Leu Ser Tyr Met Ala Pro Trp              20 25 30 Phe Arg Glu Glu Glu Val Gln Tyr Ile Gln Ala Glu Lys Asn Asn Lys          35 40 45 Gly Pro Met Glu Ala Ala Thr Leu Phe Leu Lys Phe Leu Leu Glu Leu      50 55 60 Gln Glu Glu Gly Trp Phe Arg Gly Phe Leu Asp Ala Leu Asp His Ala  65 70 75 80 Gly Tyr Ser Gly Leu Tyr Glu Ala Ile Glu Ser Trp Asp Phe Lys Lys                  85 90 95 Ile Glu Lys Leu Glu Glu Tyr Arg Leu Leu Leu Lys Arg Leu Gln Pro             100 105 110 Glu Phe Lys Thr Arg Ile Ile Pro Thr Asp Ile Ile Ser Asp Leu Ser         115 120 125 Glu Cys Leu Ile Asn Gln Glu Cys Glu Glu Ile Leu Gln Ile Cys Ser     130 135 140 Thr Lys Gly Met Met Ala Gly Ala Glu Lys Leu Val Glu Cys Leu Leu 145 150 155 160 Arg Ser Asp Lys Glu Asn Trp Pro Lys Thr Leu Lys Leu Ala Leu Glu                 165 170 175 Lys Glu Arg Asn Lys Phe Ser Glu Leu Trp Ile Val Glu Lys Gly Ile             180 185 190 Lys Asp Val Glu Thr Glu Asp Leu Glu Asp Lys Met Glu Thr Ser Asp         195 200 205 Ile Gln Ile Phe Tyr Gln Glu Asp Pro Glu Cys Gln Asn Leu Ser Glu     210 215 220 Asn Ser Cys Pro Pro Ser Glu Val Ser Asp Thr Asn Leu Tyr Ser Pro 225 230 235 240 Phe Lys Pro Arg Asn Tyr Gln Leu Glu Leu Ala Leu Pro Ala Met Lys                 245 250 255 Gly Lys Asn Thr Ile Ile Cys Ala Pro Thr Gly Cys Gly Lys Thr Phe             260 265 270 Val Ser Leu Leu Ile Cys Glu His His Leu Lys Lys Phe Pro Gln Gly         275 280 285 Gln Lys Gly Lys Val Val Phe Phe Ala Asn Gln Ile Pro Val Tyr Glu     290 295 300 Gln Gln Lys Ser Val Phe Ser Lys Tyr Phe Glu Arg His Gly Tyr Arg 305 310 315 320 Val Thr Gly Ile Ser Gly Ala Thr Ala Glu Asn Val Pro Val Glu Gln                 325 330 335 Ile Val Glu Asn Asn Asp Ile Ile Ile Leu Thr Pro Gln Ile Leu Val             340 345 350 Asn Asn Leu Lys Lys Gly Thr Ile Pro Ser Leu Ser Ile Phe Thr Leu         355 360 365 Met Ile Phe Asp Glu Cys His Asn Thr Ser Lys Gln His Pro Tyr Asn     370 375 380 Met Ile Met Phe Asn Tyr Leu Asp Gln Lys Leu Gly Gly Ser Ser Gly 385 390 395 400 Pro Leu Pro Gln Val Ile Gly Leu Thr Ala Ser Val Gly Val Gly Asp                 405 410 415 Ala Lys Asn Thr Asp Glu Ala Leu Asp Tyr Ile Cys Lys Leu Cys Ala             420 425 430 Ser Leu Asp Ala Ser Val Ile Ala Thr Val Lys His Asn Leu Glu Glu         435 440 445 Leu Glu Gln Val Val Tyr Lys Pro Gln Lys Phe Phe Arg Lys Val Glu     450 455 460 Ser Arg Ile Ser Asp Lys Phe Lys Tyr Ile Ile Ala Gln Leu Met Arg 465 470 475 480 Asp Thr Glu Ser Leu Ala Lys Arg Ile Cys Lys Asp Leu Glu Asn Leu                 485 490 495 Ser Gln Ile Gln Asn Arg Glu Phe Gly Thr Gln Lys Tyr Glu Gln Trp             500 505 510 Ile Val Thr Val Gln Lys Ala Cys Met Val Phe Gln Met Pro Asp Lys         515 520 525 Asp Glu Glu Ser Arg Ile Cys Lys Ala Leu Phe Leu Tyr Thr Ser His     530 535 540 Leu Arg Lys Tyr Asn Asp Ala Leu Ile Ile Ser Glu His Ala Arg Met 545 550 555 560 Lys Asp Ala Leu Asp Tyr Leu Lys Asp Phe Phe Ser Asn Val Arg Ala                 565 570 575 Ala Gly Phe Asp Glu Ile Glu Gln Asp Leu Thr Gln Arg Phe Glu Glu             580 585 590 Lys Leu Gln Glu Leu Glu Ser Val Ser Arg Asp Pro Ser Asn Glu Asn         595 600 605 Pro Lys Leu Glu Asp Leu Cys Phe Ile Leu Gln Glu Glu Tyr His Leu     610 615 620 Asn Pro Glu Thr Ile Thr Ile Leu Phe Val Lys Thr Arg Ala Leu Val 625 630 635 640 Asp Ala Leu Lys Asn Trp Ile Glu Gly Asn Pro Lys Leu Ser Phe Leu                 645 650 655 Lys Pro Gly Ile Leu Thr Gly Arg Gly Lys Thr Asn Gln Asn Thr Gly             660 665 670 Met Thr Leu Pro Ala Gln Lys Cys Ile Leu Asp Ala Phe Lys Ala Ser         675 680 685 Gly Asp His Asn Ile Leu Ile Ala Thr Ser Val Ala Asp Glu Gly Ile     690 695 700 Asp Ile Ala Gln Cys Asn Leu Val Ile Leu Tyr Glu Tyr Val Gly Asn 705 710 715 720 Val Ile Lys Met Ile Gln Thr Arg Gly Arg Gly Arg Ala Arg Gly Ser                 725 730 735 Lys Cys Phe Leu Leu Thr Ser Asn Ala Gly Val Ile Glu Lys Glu Gln             740 745 750 Ile Asn Met Tyr Lys Glu Lys Met Met Asn Asp Ser Ile Leu Arg Leu         755 760 765 Gln Thr Trp Asp Glu Ala Val Phe Arg Glu Lys Ile Leu His Ile Gln     770 775 780 Thr His Glu Lys Phe Ile Arg Asp Ser Gln Glu Lys Pro Lys Pro Val 785 790 795 800 Pro Asp Lys Glu Asn Lys Lys Leu Leu Cys Arg Lys Cys Lys Ala Leu                 805 810 815 Ala Cys Tyr Thr Ala Asp Val Arg Val Ile Glu Glu Cys His Tyr Thr             820 825 830 Val Leu Gly Asp Ala Phe Lys Glu Cys Phe Val Ser Arg Pro His Pro         835 840 845 Lys Pro Lys Gln Phe Ser Ser Phe Glu Lys Arg Ala Lys Ile Phe Cys     850 855 860 Ala Arg Gln Asn Cys Ser His Asp Trp Gly Ile His Val Lys Tyr Lys 865 870 875 880 Thr Phe Glu Ile Pro Val Ile Lys Ile Glu Ser Phe Val Val Glu Asp                 885 890 895 Ile Ala Thr Gly Val Gln Thr Leu Tyr Ser Lys Trp Lys Asp Phe His             900 905 910 Phe Glu Lys Ile Pro Phe Asp Pro Ala Glu Met Ser Lys         915 920 925 <210> 100 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> 5'-primer having T7 promoter for preparing RNA aptamer <400> 100 ggtaatacga ctcactatag ggagagcgca agcgtgctgg g 41 <210> 101 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> 3'-primer for preparing RNA aptamer <400> 101 ggggggatcc atcgacctct gggttatg 28 <210> 102 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for IFNb gene <400> 102 tgctctcctg ttgtgcttct cc 22 <210> 103 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for IFNb gene <400> 103 catctcatag atggtcaatg cgg 23 <210> 104 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer for RANTES gene <400> 104 atgaaggtct ccaaagag 18 <210> 105 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer for RANTES gene <400> 105 gctcatctcc aaagag 16 <210> 106 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer for TFNa gene <400> 106 caccatcagc cgcatc 16 <210> 107 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer for TFNa gene <400> 107 cagggcaatg atccca 16 <210> 108 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer for NDV-GFP gene <400> 108 ttgatggcag gcctcttgc 19 <210> 109 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer for NDV-GFP gene <400> 109 ggaggatgtt ggacgcatt 19 <210> 110 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer for Actin gene <400> 110 tcatgaagtg tgacgttgac atccgt 26 <210> 111 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer for Actin gene <400> 111 cctagaagca tttgcggtgc acgatg 26 <210> 112 <211> 19 <212> RNA <213> Artificial Sequence <220> Non-specific siRNA <400> 112 gaauuugcac gaaaacgcc 19 <210> 113 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> MDA-5 specific siRNA <400> 113 gaggugcagu auauucagg 19 <210> 114 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer for exon2-deleted RIG-I <400> 114 cctggtttag ggagggttat tctggacttt 30 <210> 115 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer for exon2-deleted RIG-I <400> 115 aaagtccaga ataaccctcc ctaaaccagg 30 <210> 116 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for RD domain deleted RIG-I gene <400> 116 gctctagata agccaccatg gat 23 <210> 117 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer for RD domain deleted RIG-I gene <400> 117 ccatcgattc atcttgctct tcctctgcc 29 <210> 118 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> priemr for RNA helicase domain deleted RIG-I gene (CARD) <400> 118 gaaggcctat ggattataag gatgat 26 <210> 119 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> priemr for RNA helicase domain deleted RIG-I gene (CARD) <400> 119 ccatcgattc aagacacttc tgaagg 26 <210> 120 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer for CARD domain deleted RIG-I gene (helicase) <400> 120 gaaggcctat ggattataag gatgat 26 <210> 121 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer for CARD domain deleted RIG-I gene (helicase) <400> 121 ccatcgattc atttggacat ttctgc 26

Claims (15)

delete delete delete delete delete delete An RNA aptamer specifically binding to a Retinoic-acid inducible gene-I (RIG-I) protein consisting of the nucleotide sequence of SEQ ID NO: 61. An immune inducer containing an RNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 61 as an active ingredient. 9. The method of claim 8,
The immune inducing agent is an immune inducing agent, characterized in that for increasing the synthesis of one or more immune proteins selected from the group consisting of RIG-I gene, MDA5 gene, interferon gene, and lantis gene. An anti-RNA viral agent containing an RNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 61 as an active ingredient. The method of claim 10,
The anti-RNA virus is hepatitis C virus (HCV), acute respiratory syndrome (SARS) virus, Influenza virus, West Nile Virus, Ebola Virus, vesicular It has antiviral activity against at least one RNA virus selected from the group consisting of Vesicular Stomatitis Virus, and Newcastle Disease Virus,
Anti-RNA viral agents. Applying the RNA aptamer according to claim 7 to a sample; And
Identifying the position or level of the RNA aptamer forming the double bond to determine the position or amount of the protein encoded by RIG-I in the sample
Including, RIG-I protein analysis method. A gene expression regulator comprising an RNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 61 as an active ingredient. The method of claim 13,
The gene is selected from the group consisting of RIG-I gene, MDA5 gene, interferon gene, and lantis gene,
Gene expression regulators. 9. The method of claim 8,
Immune inducer, characterized in that it further comprises an RNA aptamer consisting of a base sequence selected from the group consisting of SEQ ID NO: 54 to 59 or SEQ ID NO: 63 as an active ingredient.

Images