KR101242726B1 - Diagnosis of a cancer with cancer stem cell property and composition for treatment thereof - Google Patents

Abstract

PURPOSE: A diagnostic and therapeutic agent for cancer with a tumor stem cell property is provided to measure the expression level of aldehyde dehydrogenase. CONSTITUTION: A diagnostic and therapeutic agent for cancer with a tumor stem cell property contains a thiocarbamate compound, especially disulfiram as an active ingredient. The agent additionally contains an anticancer agent. The anticancer agent is selected from a group consisting of an alkylating agent, an anti-metabolic drug, an enzyme, hormone, an immunotherapeutic agent, and an antagonist to genetic mutation.

Description

Diagnosis of a Cancer with Cancer Stem Cell Property and Composition for Treatment Thereof}

The present invention provides a method for providing information on the diagnosis of tumor stem cell characteristics by measuring the degree of aldehyde dehydrogenase (ALDH) expression, and searching for compounds that reduce the degree of aldehyde dehydrogenase expression tumor stem cells The present invention relates to a method for screening a therapeutic agent for cancer, and a composition for preventing and / or treating cancer of tumor stem cell properties, which contains an aldehyde dehydrogenase inhibitor as an active ingredient.

Some of the cells that make up tumors are called tumor stem cells (CSCs) or tumor initiating cells (TICs), and certain populations of cells target these tumor cells because they are resistant to conventional chemotherapy. It is very important to develop new treatments.

In particular, tumors known to have a very poor prognosis, such as pancreatic ductal adenocarcinoma (PDAC), have been made in various efforts to develop treatments targeting cancer stem cells.

Human PDAC is a tumor that is resistant to chemotherapy or radiation therapy and has a mean survival time even with concurrent chemoradiation therapy and Whipple's operation or PPPD-pylorus preserving pancreatoduodenectory. It is a very poor tumor, ranging from 20 to 22 months. Drug resistance is particularly well seen in tumor stem cells (cancer stem cells (CSC)), the presence of tumor stem cells in PDAC has already been reported. Therefore, in order to increase the treatment effect and survival rate of PDAC patients, there is a need for a method for diagnosing cancers having such treatment-resistant tumor stem cell characteristics and for treating them.

The inventors of the present invention, while studying a technology for diagnosing and treating cancers having anti-cancer treatment-resistant tumor stem cell characteristics, confirmed that the degree of expression of Aldehyde dehydrogenase (ALDH) in cancer cells and tumor stem cell characteristics was related. The present invention was completed.

Thus, one example of the present invention provides a method for providing information for cancer diagnosis of tumor stem cell characteristics by measuring the degree of aldehyde dehydrogenase (ALDH) expression.

Another example provides a method for screening for a therapeutic agent for cancer of tumor stem cell characteristics by searching for compounds that reduce the degree of aldehyde dehydrogenase expression.

Another example provides a composition for the prevention and / or treatment of cancer of tumor stem cell characteristics containing an aldehyde dehydrogenase inhibitor as an active ingredient. In particular, the composition is a combination of the aldehyde dehydrogenase inhibitor and the existing anticancer agent in combination to minimize the amount of anticancer agents to minimize the side effects and at the same time characterized in that it can exhibit a significantly better anticancer effect than when administered alone do.

The present inventors preferentially diagnose cancers in which tumor stem cells expressing aldehyde dehydrogenase specifically in malignant tumors are present, and thiocarbamate compounds, particularly disulfiram, which are aldehyde dehydrogenase inhibitors , DSF) selectively kills these tumor stem cells with high aldehyde dehydrogenase expression levels, and in particular, kills a group of cancer cells containing tumor stem cells with high anticancer drug resistance. It has an excellent therapeutic effect, and the combination of these aldehyde dehydrogenase inhibitors with existing anticancer drugs can significantly lower the anticancer dose, thereby minimizing side effects for normal cells vulnerable to anticancer drugs, which is the biggest problem of cancer treatment. Vs cancer-resistant cancer It was confirmed that the excellent anticancer effect can be obtained to complete the present invention. In the pathological diagnosis of existing cancers, new diagnosis / classification of tumors including aldehyde dehydrogenase-expressing tumor stem cells and specific target treatment of these tumor stem cell cancers can greatly improve existing diagnosis and treatment.

The present invention is to investigate the expression of aldehyde dehydrogenase in malignant tumors including pancreatic ductal adenocarcinoma to diagnose and classify cancers comprising tumor stem cells and to effectively treat the same, a die aldehyde dehydrogenase inhibitor The present invention relates to a technique of using a thiocarbamate family compound including sulfiram, and a technique of concurrent treatment with various existing anticancer agents.

First, an example of the present invention is a specific cell group (hereinafter referred to as 'tumor stem cell' or 'CSC') called tumor stem cell (CSC) or tumor initiating cell (TIC). Provided are methods for providing information in the diagnosis and / or classification of cancers with characteristics.

Since the cancer having the characteristics of tumor stem cells as described above is conventionally resistant to chemotherapy and its prognosis is poor, a treatment different from conventional chemotherapy should be applied. For example, even in the same pancreatic adenocarcinoma, if the pancreatic adenocarcinoma corresponds to a high proportion of tumor stem cells, the patient may obtain a cancer treatment effect by conventional chemotherapy such as chemotherapy or radiation therapy for pancreatic adenocarcinoma. It becomes impossible. Therefore, even in the same type of cancer, it is very important to diagnose and / or classify a high proportion of tumor stem cells in the cells of the cancer lesion site, and to apply a new therapy different from the existing chemotherapy.

In the present specification, 'cancer (or tumor) having the characteristics of tumor stem cells' refers to a cancer having a high ratio of tumor stem cells in a cell group constituting cancer. Considering that the ratio of tumor stem cells in general tumor cells is about 1% or more and less than 5%, for example, the proportion of tumor stem cells in the cell population constituting cancer is 5% or more, 30% or more, 40% or more, or 50%. The above case may be defined as 'cancer (or tumor) having the characteristics of tumor stem cells', and as described above, it exhibits resistance to existing anticancer treatments and is characterized by poor prognosis of anticancer treatment.

In addition, the term "tumor" in this specification means a malignant tumor unless otherwise specified, and is used in the same sense as cancer.

In the present invention, by confirming that the aldehyde dehydrogenase can be used as a marker of tumor stem cells of the cancer cell group, a technique for diagnosing or classifying cancer having tumor stem cell characteristics by measuring the expression level of the aldehyde dehydrogenase. Suggest.

Thus, the method of providing information for the diagnosis (and / or classification) of cancer with tumor stem cell characteristics according to the present invention is to determine the degree of Aldehyde dehydrogenase (ALDH) expression in test samples obtained from patients. And measuring the aldehyde dehydrogenase (ALDH) expression level in the test sample, as compared with the normal sample, characterized in that the patient is characterized as a tumor patient with tumor stem cell characteristics.

In another example, the method comprises measuring the degree of aldehyde dehydrogenase (ALDH) expression in a test sample obtained from a patient, wherein the degree of aldehyde dehydrogenase expression in the test sample is compared with normal stem cells. If the same or higher, it may be characterized in that the patient is determined as a cancer patient of tumor stem cell characteristics.

The patient refers to a mammal, preferably a human, a patient diagnosed with cancer or suspected of having cancer, wherein the test sample is any form of biological that includes a lesion site diagnosed or suspected of having cancer of the patient. It means a state separated from the patient as a sample, it may be a tissue, a cell group, blood, body fluids and the like obtained by all possible resection methods including biopsy.

For example, the patient to be diagnosed refers to a patient diagnosed with or suspected of all cancers, for example, the cancers listed below, and the cancer having a tumor stem cell characteristic to be diagnosed is a cancer having a high ratio of tumor stem cells in each of the cancers. Means:

Pancreatic cancer, pancreatic duct carcinoma, spiny cell carcinoma, adenocarcinoma, adenocarcinoma, aponic melanoma, adenomas, acute eosinophilic leukemia, acute lymphoblastic leukemia, acute megaloblastic leukemia, acute monocytic leukemia, accompanied by maturation Acute myeloid leukemia, Acute myeloid dendritic cell leukemia, Acute myeloid leukemia, Acute promyelocytic leukemia, Enamel, Adenocarcinoma, Adenocystic carcinoma, Adenomas, Adenocarcinoma, Adrenal carcinoma, Adult T-cell leukemia, Aggressive NK -Cell leukemia, AIDS-related cancer, AIDS-related lymphoma, acinar soft sarcoma, enamel fibroblastoma, anal cancer, degenerative large cell lymphoma, anaplastic thyroid cancer, angioimmunoblastic T-cell lymphoma, angiomycolipoma, Vascular sarcoma, appendic carcinoma, astrocytoma, atypical malformation rhabdomyocarcinoma, basal cell carcinoma, basal-like carcinoma, B-cell leukemia, B-cell lymphoma, ductal carcinoma, biliary cancer, bladder , Blastoma, bone cancer, bone tumor, brain stem glioma, brain tumor, breast cancer, Brenner tumor, bronchial tumor, bronchoalveolar carcinoma, brown tumor, Burkitt lymphoma, primary site unknown cancer, carcinoid tumor, carcinoma, in situ carcinoma, penile carcinoma, Primary unknown carcinoma, carcinosarcoma, castleman's disease, central nervous system cultured tumor, cerebellar astrocytoma, cerebral astrocytoma, cervical cancer, cholangiocarcinoma, chondroma, chondroma, chordoma, choriocarcinoma, choroid plexus papilloma, chronic lymphocytic leukemia, Chronic monocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disease, chronic neutrophil leukemia, clear-cell tumors, colon cancer, colorectal cancer, head pharynx, cutaneous T-cell lymphoma, Degos disease, bumpy dermal fibrosarcoma, dermis Cyst, Abdominal connective tissue-forming small cell tumor, Diffuse giant B cell lymphoma, Embryonic dysplasia Neuroepithelial tumor, Embryonic carcinoma, Endoderm carcinoma, Endometrial cancer, Endometrial uterine cancer, Purple Endothelial tumors, enteropathy-associated T-cell lymphoma, glioblastoma, glioblastoma, epithelial sarcoma, red leukemia, esophageal cancer, sensory neuroblastoma, Ewing's lineage tumor, Ewing's lineage, Ewing's sarcoma, extracranial germ cell tumor, gonad Extragonadal cell tumor, extrahepatic biliary tract cancer, extraectosis, tubal cancer, fetal fetus, fibroma, fibrosarcoma, follicular lymphoma, follicular thyroid cancer, gallbladder cancer, gallbladder cancer, gangliomas, ganglion neuroma, stomach cancer , Gastric lymphoma, gastrointestinal cancer, gastrointestinal carcinoma, gastrointestinal stromal tumor, gastrointestinal stromal tumor, germ cell tumor, germ cell tumor, gestational choriocarcinoma, gestational chorionic tumor, giant cell tumor of bone, glioblastoma multiforme, glioma, cerebral glioma , Glomerular tumor, glucagon, germ cell tumor, granulosa cell tumor, hairy cell leukemia, hairy cell leukemia, head and neck cancer, head and neck cancer, heart cancer, hemangioblastoma, pericarcinoma, angiosarcoma, Liquid malignant, hepatocellular carcinoma, hepatocellular T-cell lymphoma, hereditary breast-ovarian cancer syndrome, Hodgkin's lymphoma, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic glioma, inflammatory breast cancer, intraocular melanoma, islet cell carcinoma, islet cells Tumors, juvenile osteoblastic leukemia, Kaposi's sarcoma, Kaposi's sarcoma, kidney cancer, Klatzkin's tumor, Krugenberg's tumor, laryngeal cancer, laryngeal cancer, malignant melanoma, leukemia, leukemia, lip and oral cancer, liposarcoma, Lung cancer, Progesterone, Lymphangioma, Lymphangioma, Lymphoma, Lymphoma, Lymphoma, Macroglobulinemia, Malignant fibrous histiocytoma, Malignant fibrous histiocytoma, Malignant fibrous histiocytoma of bone, Malignant glioma, Malignant mesothelioma Malignant peripheral nerve tumor, malignant rhabdomyosarcoma, malignant triton tumor, MALT lymphoma, cover cell lymphoma, mast cell leukemia, mediastinal germ cell tumor, mediastinal tumor, thyroid medulla, stromal hair Edema, stromal blastoma, stromal epithelioma, melanoma, melanoma, meningioma, merkel cell carcinoma, mesothelioma, mesothelioma, latent metastatic squamous carcinoma, metastatic urinary epithelial carcinoma, mixed muller tumor, monocytic leukemia, oral cancer, mucous tumor Multiple endocrine tumor syndrome, multiple myeloma, multiple myeloma, myeloma sarcoma, myxosarcoma, myelodysplastic disease, myelodysplastic syndrome, myeloid leukemia, myeloid sarcoma, myeloproliferative disease, myxoma, nasal cancer, nasopharyngeal cancer, coin Two carcinomas, neoplasm, neuromyoma, neuroblastoma, neuroblastoma, neurofibroma, neuroma, nodular melanoma, non-Hodgkin's lymphoma, non-Hodgkin's lymphoma, non-melanoma skin cancer, non-small cell lung cancer, ocular tumor , Rare-glioblastoma, oligodendrocyte, eosinophilic cell tumor, optic nerve meningioma, oral cancer, oral cancer, oropharyngeal cancer, osteosarcoma, osteosarcoma, ovarian cancer, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, hypoovary Sexual malignant tumors, Paget's disease, breast cancer, pancreatic cancer, pancreatic cancer, thyroid papillary cancer, papillomatosis, lateral ganglion tumor, sinus cancer, parathyroid cancer, penile cancer, perivascular epithelial cell tumor, pharyngeal cancer, pheochromocytoma , Mesenchymal parenchyma, medulloblastoma, pituitary gland tumor, pituitary adenoma, pituitary gland tumor, plasma cell neoplasia, pleural blastoma, polyblastoma, progenitor T-lymphoblastic lymphoma, primary CNS lymphoma, primary exudative lymphoma , Primary hepatocellular carcinoma, primary liver cancer, primary peritoneal cancer, primitive neuroectodermal tumor, prostate cancer, peritoneal pseudomyxoma, rectal cancer, renal cell carcinoma, respiratory carcinoma associated with NUT gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, rhabdomyosarcoma , Richter's transformation, Cicada teratoma, Salivary gland carcinoma, Sarcoma, Multiple neuroeplasia, Sebaceous gland carcinoma, Secondary neoplasm, Normal , Serous tumors, Sertoli Reich cell tumors, adult-substrate tumors, tridentate syndrome, ring-cell carcinoma, skin cancer, blue small round cell tumor, small cell carcinoma, small cell lung cancer, small cell lymphoma, small intestine cancer, soft tissue sarcoma, somatostatin, Soot warts, spinal tumors, spinal tumors, splenic bun lymphoma, squamous cell carcinoma, gastric cancer, superficially expanding melanoma, primitive neuroectodermal tumor, superficial epithelial-stromal tumor, synovial sarcoma, T-cell acute lymphoblastic leukemia , T-cell large granular lymphocytic leukemia, T-cell leukemia, T-cell lymphoma, T-cell prelymphoid leukemia, teratoma, terminal lymphoid cancer, testicular cancer, follicular melanoma, throat cancer, thymic carcinoma, thymomas , Thyroid cancer, renal cell carcinoma of the renal and ureter, transitional cell carcinoma, urinary tract cancer, urethral cancer, genitourinary neoplasm, uterine sarcoma, uveal melanoma, vaginal cancer, burner- Morrison syndrome, wart carcinoma, visual path nerve At least one cancer selected from the group consisting of glioma, vulvar cancer, Waldenström macroglobulinemia, Bartin's tumor, Wilm's tumor, and the like.

In a preferred embodiment, the cancer diagnosed according to the invention can be pancreatic cancer, such as pancreatic adenocarcinoma. Unlike other organs, the pancreas is an organ that maintains a certain level of expression of ADLH in a developmental and physiological manner. However, there have been no reports of higher levels of ALDH expression in tumor stem cells than in normal pancreatic stem cells. Discrimination of tumor stem cells based on the ADLH expression level of normal stem cells in the human pancreas is the first attempt in the present invention, considering the characteristics that the expression level of ADLH in the pancreas is relatively high, early diagnosis by conventional methods This is believed to be advantageous for early and accurate diagnosis of pancreatic cancer, which was not easy.

The normal sample is any type of biological sample including the same site as the test sample, which is isolated from a patient who has not been diagnosed with cancer or suspected of having cancer, or a site that has been isolated from a cancer patient but does not contain a tumor (same tissue). Refers to a sample separated from other sites or sites of other tissues). However, in determining the expression level of ALDH, the test sample and the normal sample are examined under the same conditions.

In particular, in the diagnosis of cancer of organs or tissues in which the expression level of ALDH is relatively high, such as the pancreas, the expression level of ALDH is compared with that of other organs or tissues in which the expression pattern of ALDH may be different. Based on normal stem cells from the same organs or tissues as the test sample, it is accurate to measure whether the ALDH expression is positive (overexpression of ALDH) compared to the normal stem cells that are positive (high expression). It is more advantageous for diagnosis.

Thus, the normal stem cells used as a comparative reference in the diagnosis according to the present invention may be all normal stem cells without tumors, and more preferably, around the lesion site of the cancer to be diagnosed (ie, Means a stem cell in a normal state without a tumor of the same tissue or organ as the tissue or organ in which the cancer is to be diagnosed, for example, a stem cell or a progenitor cell in the normal duodenum or pancreas. .

The degree of aldehyde dehydrogenase expression can be confirmed by measuring the amount of aldehyde dehydrogenase protein through a conventional measuring method applicable to the obtained cancer tissue, cancer cells, blood, body fluids and the like. For example, the obtained sample can be quantitatively evaluated by methods of biopsy, fine needle aspiration test and blood test. Determination of aldehyde dehydrogenase protein amount can be performed by any conventional protein quantification method, such as immunohistochemistry, immunofluorescence, flow cytometry, Western blot, chemical staining (e.g., immunostaining of H & E, etc.). ), aldehyde dehydrogenase protein can be measured by methods such as mRNA quantification.

The number of cells overexpressing aldehyde dehydrogenase can be obtained by quantifying cells in which the amount of the aldehyde dehydrogenase protein obtained above is greater than normal stem cells (e.g., more than one or two or more times, such as 3-20 times). Can be.

Evaluation of the degree of aldehyde dehydrogenase expression can be performed by comparing the amount of aldehyde dehydrogenase protein or the number of cells overexpressing aldehyde dehydrogenase of the test sample measured by the above method with the normal sample. For example, the amount of aldehyde dehydrogenase protein measured throughout the test sample is greater than that in the normal sample (e.g., at least two times greater than the normal sample, such as 3 to 20 times), or overexpressing the aldehyde dehydrogenase at the cellular level. For example, if the number of cells more than 1 times or more than 2 times, such as 3-20 times more than the normal sample (eg, more than 2 times, such as 3-20 times), in particular, aldehyde dehydrogenase is normal sample When the number of more overexpressed cells occupies 5% or more of the entire sample, for example, 30% or more, 40% or more, or 50% or more, it may be determined that cancer of tumor stem cell characteristics.

As described above, tumors having tumor stem cell characteristics are resistant to conventional anticancer treatments, and thus, new therapeutic agents need to be developed.

Accordingly, another example of the present invention provides a method for screening a cancer therapeutic agent for tumor stem cell characteristics.

In one embodiment, the screening method,

Treating the candidate compound with a portion of a sample comprising cells expressing ALDH; And

Measuring the degree of aldehyde dehydrogenase expression and / or the number of cells overexpressing the aldehyde dehydrogenase of the sample treated with the candidate compound and the remaining untreated sample,

When the degree of aldehyde dehydrogenase expression of the sample treated with the candidate compound is lower than that of the untreated sample, and / or the number (or cell quantity) of overexpressing aldehyde dehydrogenase is decreased (i.e., the candidate compound is Induced death of aldehyde dehydrogenase overexpressing cells), the candidate compound may be characterized in that it is determined as a therapeutic agent for cancer of tumor stem cell characteristics.

In another embodiment, the screening method,

Determining the degree of aldehyde dehydrogenase expression and / or the number of cells (or cell quantity) overexpressing aldehyde dehydrogenase in a sample comprising cells expressing ALDH;

Treating the sample with a candidate compound; And

Measuring the degree of aldehyde dehydrogenase expression and / or the number of cells (or cell volume) overexpressing aldehyde dehydrogenase of the cells treated with the candidate compound,

When the degree of aldehyde dehydrogenase expression and / or the number of cells (or cell amount) overexpressing aldehyde dehydrogenase in the cells treated with the candidate compound is lower than before treatment with the candidate compound, the candidate compound is replaced with tumor stem cells. It may be characterized in that it is determined as a therapeutic agent for cancer of the characteristic.

The sample means an ALDH-expressing cell, in particular, a sample containing cancer (tumor) cells, which may be isolated from cancer patients or obtained by culturing ALDH-expressing cells in a conventional manner, and in a living state. It is good to be a cell.

The method of measuring the degree of expression of the aldehyde dehydrogenase and / or the number (or cell volume) of overexpressing the aldehyde dehydrogenase is as described above.

The candidate compound is not particularly limited and may be a natural or synthetic compound, and may be one or more selected from the group consisting of proteins, peptides, nucleic acids, inorganic and organic compounds other than these, and the like.

In another embodiment of the present invention, the tumor stem cell-specific cancer as described above overexpressing ALDH, the composition for the prevention and / or treatment of cancer of the tumor stem cell-specific cancer comprising an aldehyde dehydrogenase inhibitor as an active ingredient To provide.

In the present invention, aldehyde dehydrogenase means an enzyme that metabolizes toxic aldehydes to acetic acid, which is non-toxic, during alcohol metabolism as follows:

[Reaction Scheme]

Aldehyde dehydrogenases include all aldehyde dehydrogenase classes, such as ALDH1A1 (NM_000689.4), ALDH1A2 (DQ322171.1), ALDH1A3 (NM_000693.2), ALDH1B1 (NM_000692.4), ALDH1012190 (NM_000691) .2), ALDH1L2 (BC103934.1), ALDH2 (NG_012250.1), ALDH3A1 (NG_012251.1), ALDH3A2 (NG_007095.2), ALDH3B1 (NG_012282.1), ALDH3B2 (NG_012255.1), ALDH4A1 (NG_012283. 1), ALDH5A1 (NG_008161.1), ALDH6A1 (NM_005589.2), ALDH7A1 (NG_008600.2), ALDH8A1 (NG_012261.1), ALDH9A1 (NM_000696.3), ALDH16A1 (NG_012747.1), etc. It may be one or more.

By aldehyde dehydrogenase inhibitor is meant any compound that inhibits or reduces the activity of one or more enzymes belonging to all aldehyde dehydrogenase classes as described above. More specifically, aldehyde dehydrogenase inhibitors are complexed with aldehyde dehydrogenases to modify the molecular structure of the enzyme, reduce activity, compete with substrates, or bind to aldehyde dehydrogenase coding genes. It means all substances, such as compounds, aptamers, antibodies, siRNA, shRNA, micRNA, etc., which have all inhibitory effects such as inhibiting expression.

For example, the aldehyde dehydrogenase inhibitor may be at least one selected from the group consisting of thicarbamate-based drugs, and the like, and may be, for example, disulfiram (DSF).

As described above, the pancreas has high expression levels of ALDH in both normal and tumor stem cells, and is not simply divided into two types, such as negative / positive or positive, when distinguishing tumor cells by ALDH expression. It was confirmed that tumor cells showing continuous spectrum from negative to positive or positive and more than double standard expression levels (normal stem cells) showed more characteristics of tumor stem cells. In addition, disulfiram, a direct inhibitor of ALDH, may target the ALDH positive cell population including the ALDH bright cell, which may be the most important feature in the present invention.

Regarding disulfiram, a representative aldehyde dehydrogenase inhibitor, it has been known that disulfiram alone has only minimal tumor suppression effect and significant level of tumor suppression effect when treated with other components such as metal ions. It is known. However, the present invention is characterized in that disulfiram alone induces apoptosis in tumor (stem) cells expressing high levels of aldehyde dehydrogenase. Particularly in cancer patients, the content of metal ions in the blood or tissues may be lower or higher than normal levels. In this case, the prescription of disulfiram with metal ions does not present any risk of other secondary changes. There is no situation. However, disulfiram is already used as a therapeutic agent for alcoholism and its toxicological properties are well known, and it does not harm normal cells in the dose range (500 mg / day or 250 mg / day) prescribed for alcoholic patients. Is reported.

Therefore, disulfiram can target aldehyde dehydrogenase overexpressing tumor cells by inhibiting aldehyde dehydrogenase and not affect normal cells, and thus can be a target therapeutic agent for tumor stem cells. In view of the fact that the existing anticancer drugs affect not only tumor cells but also normal cells, they cause many side effects, and thus, it is expected that not only the effective tumor removal but also the compliance of the treated patients will be improved.

In addition, disulfiram has the advantage of taking the drug because it can be administered orally rather than invasive route. Since most of the conventional anticancer drugs are injected by vascular injection, anticancer drugs leak out of the blood vessels at the site of drug administration, and inevitable vasculitis occurs, and vascular damage is caused by repeated vascular administration, which makes it difficult for additional chemotherapy to patients. It is true that it caused great pain.

In the present invention, the thiocarbamate compound, in particular, disulfiram alone cannot remove the entire tumor cells constituting the tumor. However, the thiocarbamate compound, particularly disulfiram alone, has excellent selective removal activity even for tumor cell populations with high aldehyde dehydrogenase expression. It was confirmed that it has. As described above, tumors with high expression of aldehyde dehydrogenase are classified as cancers (tumors) having tumor stem cell characteristics. Since these cancers have poor treatment prognosis and high anticancer drug resistance, The effect of the selective removal of such tumor cell populations alone is of great significance as it can significantly reduce the dose of conventional anticancer drugs to be additionally administered.

In addition, by the use of thiocarbamate compounds, especially aldehyde dehydrogenase inhibitors such as disulfiram, the additional anticancer drugs reduce the effects on normal cells, reduce side effects, increase patient compliance, and improve anticancer drugs. There is an advantage in that secondary damage due to the administration of conventional invasive methods can be reduced. In addition, the use of inexpensive drugs such as thiocarbamate compounds, in particular disulfiram, may replace all or part of the anticancer drugs, thereby reducing the use of expensive anticancer drugs, thereby reducing the burden of the patient's treatment costs, which was another problem of chemotherapy. It is expected to greatly alleviate the problem.

The administration route includes all clinically possible methods such as oral administration, intravenous injection, intramuscular injection, intraperitoneal injection, patch attachment (transdermal administration), etc., and may be appropriately selected depending on the condition of the patient. For example, disulfiram is not toxic when administered at or below 500 mg / day when administered orally based on an adult (about 70 kg body weight). Depending on the condition, the type of indication, etc., the dosage can be adjusted in the range of 1 to 500 mg / day, preferably 100 to 500 mg / day, based on 70 kg adult.

The composition for preventing and / or treating cancer of the tumor stem cell characteristics may further include a pharmaceutically acceptable excipient and / or additive commonly used in formulation, and is an aldehyde dehydro which is an active ingredient in the composition. The content of the genase inhibitor may be about 0.0001 to 99% by weight, such as 0.001 to 90% by weight, or about 0.01 to 50% by weight, but there is no particular limitation, and may be appropriately adjusted according to the form and purpose of the final formulation.

In the administration of thiocarbamate drugs, including disulfiram, as described above, even by administration of the drug alone can obtain a therapeutic effect of cancer having sufficient tumor stem cell characteristics, and in a way to enhance the drug effect One or more metal ions selected from the group consisting of copper, zinc, and the like may be administered in parallel. However, as described above, the patient's condition should be taken care of at the time of concurrent administration of metallic substances, for example, a group of patients diagnosed with Wilson's disease, which is caused by high ionic copper ions in the body, and copper ions in blood tests. It is advisable to prohibit the simultaneous administration of metallic substances in patients with excessive metal ions, such as the patient group determined to be high in the body and the patient group suspected of zinc poisoning.

In addition, the composition may be used together with the existing anticancer agent to increase the therapeutic effect for cancers resistant to the existing anticancer agent, as well as to significantly reduce the amount of the anticancer agent to minimize side effects.

Therefore, the composition for preventing and / or treating cancer of tumor stem cell characteristics of the present invention may further include a conventional anticancer agent for indication cancer (tumor) in addition to the aldehyde dehydrogenase inhibitor as an active ingredient. The additionally included anticancer agent may be in a form formulated with an aldehyde dehydrogenase inhibitor and administered simultaneously, or separately formulated and administered simultaneously or at a time interval. Such dosage forms and / or methods of administration may be appropriately prescribed depending on the type of indication, the condition of the patient, and the like.

In conventional chemotherapy, tumor cells (tumor stem cells) that have treatment-resistant tumor stem cell characteristics are not completely removed after treatment or cause tumor recurrence, which makes it difficult to cure pancreatic adenocarcinoma and the patient's prognosis. It is a bad reason. 9 is a diagram illustrating a tumor treatment effect by the combined administration of such disulfiram and an anticancer agent. According to the present invention, in the treatment of pancreatic adenocarcinoma, the tumor stem cells (ALDH strong positive (overexpressing) tumor cells) showing anticancer drug resistance are removed by disulfiram and tumor cells that respond well to conventional chemotherapy Since these tumor cells are left, the effect of complete tumor removal may be shown by administering a low dose of anticancer agent, and FIG. 9 illustrates this.

The anticancer agent may be any conventional anticancer agent, such as gemcitabine, 5-FU (fluorouracil), cisplatin, gimeracil, oreracil potassium, which are commonly used in pancreatic cancer. It consists of oteracil potassium, various antimetabolites, alkylating agents, antibiotics, vinca alkaloids-based anticancer agents, enzymes, hormones, immunotherapeutics, and antagonists against genetic variation. It may be one or more selected from the group. In the present invention, representative anticancer agents that can be co-administered with disulfiram are summarized in Table 1 below.

Alkylated chemicals Nitrogen Mustard Mechloethamine, chlorambucil, phenylalanine, mustard cyclophosphamide, ifosfamide, etc. Nitrosurea
(Nitrosurea) Carmustine, lomustine, streptozotocin, etc. Etc Busulfan, Thiotepa, Cisplatin, Carnoplatin, etc. Antipsychotic Folic acid antagonists Methotrexate, etc. Purine system Mercaptopurine, Thioguanine, etc. Pyrimidine
(Pyrimidines) 5-fluorouracil, loxuridine, cytarabine, fludarabine, gemcitabine, gimeracil, etc. Antibiotic Dactinomycin, doxorubicin, dounorubicin, daunorubicin, idarubicin, mitosantron, plicamycin, mitomycin, bleomycin, bleomycin ), Etc hormone Tamoxifen, extrogen, progestin, androgen, leuprolide, flutamide, prednisone Etc Vincristine, vinblastine, etoposide, asparaginase, hydroxyurea, mitotane, procarbazine, oreracyl potassium (oteracil potassium), etc.

As such, by administering an existing anticancer agent in combination with an aldehyde dehydrogenase inhibitor, the dosage of the anticancer agent (e.g., gemcitabine, antimetabolic drug, etc.) is less than 1/10 of the conventional, preferably 1/100 or less, such as It can be reduced to 1 / 1,000,000 to 1 / 1,000, and accordingly characterized by significantly reducing the anticancer side effects.

In order to further enhance the anticancer effect of the composition of the present invention, conventional radiation therapy may be further combined.

As an example of the present invention, a method for diagnosing and treating human pancreatic ductal adenocarcinoma (PDAC) having tumor stem cells through aldehyde dehydrogenase (ALDH) expression test is as follows.

ALDH  Tumor stem cells through expression test PDAC  Diagnosis

Immunohistochemistry showed that normal normal stems could be used as internal controls when DAB (diaminobenzidine) was developed during ALDH staining or when the degree of fluorescence of ALDH antibody was detected by immunofluorescent stain (IF). PDACs that are tumor stem cell-specific when they exhibit a positivity that is comparable to or greater than the expression level of cells (e.g., stem cells or progenitor cells of normal duodenum or pancreas), or when multiple undifferentiated cells in the tumor tissues show ALDH positives. It can be diagnosed as.

In flow cytometry, in detecting tumor stem cells using the Aldefluor kit, the major population included the ALDH high population (defined as the higher ALDH expression than the ALDH low population identified under DEAB control conditions), and compared to the major population. When 5% or more of ALDH bright cells showing higher ALDH expression levels can be diagnosed as PDAC of tumor stem cell characteristics.

With tumor stem cells PDAC  Treatment: Anticancer drugs Disulfiram  Concurrent treatment

If the above diagnosis determines that there are tumor stem cells expressing ALDH bright cells, disulfiram may be selected as a combination therapy of other anticancer drugs to effectively treat tumor stem cells and other cancer cells.

The present invention provides the use of aldehyde dehydrogenase as an indicator for effectively diagnosing cancer of tumor stem cell characteristics, thereby diagnosing cancer of tumor stem cell characteristics, and treating the aldehyde dehydrogenase inhibitor thereto. It can effectively treat cancers with tumor stem cell characteristics that are resistant to anticancer drugs.At this time, it can not only increase anticancer activity by treating with existing anticancer drugs but also dramatically reduce the use of anticancer drugs, thereby reducing side effects of using anticancer drugs. By providing a technique that can alleviate, it is useful for the effective treatment of cancers with tumor stem cell characteristics, which have a poor prognosis of conventional chemotherapy.

Figure 1 shows the results of ALDH immunohistochemical staining in human pancreatic tissue, A is normal pancreas, B is chronic pancreatitis, C and D is the result of pancreatic adenocarcinoma tissue.
Figure 2 shows the results of ALDH protein expression in the normal pancreatic ductal epithelium cell line and several pancreatic cancer tumor cell lines using flow cytometry (2a) and Western blotting (2b) (Control does not perform any treatment). Distribution of cells according to the amount of ALDH protein expression in tumor cell lines.
Figure 3a shows the flow cytometry results when the CD24 and CD44 treatment to the ALDH low / high / bright cell group of the CFPAC-1 cell line, respectively,
3b shows the results of microscopic observation of the growth of ALDH low / high / bright cell populations of CFPAC-1 cell line.
3c shows the results of flow cytometry after two weeks of culture of the ALDH low / bright cell population of the CFPAC-1 cell line.
3d shows the amount of mShh mRNA transcript in the ALDH low / bright cell population of the CFPAC-1 cell line.
4A shows MIA PaCa-2 (ACTT number: CRL-1420), CFPAC-1 (ACTT number: CRL-1918), PANC-1 (ACTT number: CRL-1469) and AsPc-1 (GCB and DSF). ACTT number: CRL-1682)] is a graph showing the survival rate by the concentration of the drug,
4b shows the results of flow cytometry according to ALDH level in DSF treatment of CFPAC-1 cell line.
4c is a flow cytometry showing the degree of apoptosis in DSF treatment of CFPAC-1 cell line,
4d shows the expression level of ALDH protein in DMSO-only control cells, DSF-treated cells, and DSF-treated cells (W / D).
4e shows the degree of cell death when normal cells (hTERT-HPNE) were treated with disulfiram (DSF) and gemcitabine (GCB).
4f shows the mRNA levels of ALDH1A1 (left) and Shh (right) when DSF was treated in the CFPAC-1 cell line.
4 g shows cell growth when cyclopamine was treated in CFPAC-1 and MIA PaCa-2 cell lines,
4h shows the result of measuring the surviving population by GCB treatment on CFPAC-1 cell line by flow cytometry.
5a to 5e show the results of confirming the cell population according to the degree of ALDH expression during DSF treatment in various tumor cells through flow cytometry.
FIG. 6A is a photograph comparing the tumor nodule (upper) and 5 weeks after injection of ⁵ × 10 ⁵ ALDH high and ALDH low CFPAC-1 cancer cells, and the time when tumor nodules were observed over time Is the graph shown (bottom),
6b shows the results of hematoxylin and eosin (H & E) staining (top left and bottom left) of xenograft tumor sections from injection of CFPAC-1 high cell population, and immunohistochemical staining (top right and bottom right) using ALDH1A1 antibody. It is a picture to show,
6c is a graph showing the size of tumor (CFPAC-1 cell) over time of the control group and oral administration of DSF,
6d shows the result of confirming the ALDH activity by flow cytometry after separating tumor cells from the control group and the tumor group (CFPAC-1 cells) orally administered DSF for 2 weeks.
6e shows the results of H & E staining (top and middle) and immunohistochemical staining (bottom) of control (CFPAC-1 cells) and DSF-treated mice.
6f is a graph illustrating the immunohistochemical staining results of tumors (CFPAC-1 cells) extracted from the control diet and the DSF diet mice,
6g shows the result of measuring the protein level of ALDH1A1 by Western blotting method for the protein sample extracted from the control group tumor and DSF diet tumor.
7A and 7B are graphs showing the effects of treating GCB alone and treating DSF in combination with CFPCA-1 cells.
8A to 8C show immunohistochemical staining results and ALDH expression levels in anticancer drug-resistant pancreatic adenocarcinoma samples.
9 is a diagram illustrating the therapeutic effect when disulfamine and an anticancer agent are concurrently administered.

Hereinafter, the present invention will be described in more detail with reference to Examples and Test Examples. However, these examples and test examples are for illustrating the present invention and should not be construed as limiting the present invention.

Example  One: ALDH  Tumor stem cells through expression test PDAC  Diagnostics and Screening

Tissue slides corresponding to the normal pancreatic region, chronic pancreatitis region, and pancreatic adenocarcinoma pancreatic region obtained from the pancreas extracted by the method of Whipple operation or pylorus preserving pancreatoduodenectomy (PPPD) (Yonsei University Shinchon Severance) Tissue slides obtained from a hospital pathology department with all patient consent) were fixed in 10% (w / v) paraformaldehyde for 24 hours, dehydrated in ethanol, and then embedded in paraffin to create paraffin blocks. . The prepared paraffin block was sliced to a thickness of 3-4 μm to prepare a slide.

Deparaffinization, antigen retrieval, and blocking procedures were performed by conventional methods. Specifically, 100% (w / v) xylene was treated for 30 minutes, paraffin was removed by dehydration in ethanol, and treated with 0.01M citric acid at 95 ° C. for 20 minutes to perform antigen recovery. , Non-specific endogenous peroxidase blocking was performed using Dako REAL ^™ , EnVision ^™ FLEX, peroxidase-blocking reagent, K4065.

To prevent nonspecific binding to the antibody, the prepared fragments were blocked with 3% (v / v) goat serum (jackson immunoresearch 005-000-121), and the ALDH1A1 antibody (Abcam, catalog number ab52492) was 1: 150 ( Diluted to volume) and reacted with the sections overnight in a 4 ° C chamber. At this time, bovine serum albumin (Bioworld 22070008-5) to the final 5% (v / v), Tween-20 (Duchefa, P1362.0500) solution to the final 0.1% (v / v) PBS (phosphate buffered saline) solution The diluted solution was used as the diluting solvent for the antibody. The obtained sections were washed three times with PBS solution three times, and reacted with HRP-conjugated secondary antibody (Dako, K4065) at room temperature for 2 hours.

DAB was back (diaminobenzidine, Dako REAL ^TM, EnVision ^TM FLEX, DAB + chromogen, K5007) a buffer substrate (Dako REAL ^TM, EnVision ^TM FLEX, substrate buffer, SK310) color reaction was diluted to 1:50 by volume, the After counter staining with hematoxylin (Sigma, HHS 32), the cover glass was covered and observed under a microscope (Olympus DP71, Leica DMLB, magnification X100, X200) and the results are shown in FIG. The brown color in Figure 1 is a positive reaction.

FIG. 1A shows the results of staining of normal pancreatic tissue. Pancreatic stem / progenitor cells are located between the three leaf structures (acinar, blue dotted line) and the tubular structure (duct, green dotted line) in the normal pancreas. In the terminal duct (TD) epithelial cell (red arrow) known as), ALDH shows a strong positive (dark brown) staining pattern. On average, one ALDH-positive stem cell per 10-20 cells was found in the terminal duct. Normal pancreatic cells had ALDH protein in the cells and thus showed weakly positive expression. Figure 1 B shows the results of staining in chronic pancreatitis (Chronic pancreatitis) tissue, ductal proliferation is accompanied in chronic pancreatitis tissue, it can be seen that the proliferation of the pancreatic stem / progenitor cells in part partially observed . In human chronic pancreatitis, tubular hyperplasia was observed in ADLH. That is, A and B of FIG. 1 demonstrate that ALDH of pancreatic stem / progenitor cells is strongly expressed in normal human pancreatic tissue and pancreatic tissue of chronic pancreatitis patients.

Figure 1 C and D shows the results of staining of human pancreatic ductal adenocarcinoma (PDAC) tissue, a well-differentiated portion (g-dotted line below D) The dotted line on the right side shows a positive or negative response to ALDH, but a large number of cells show a positive ALDH positive response in the poorly differentiated part (above the dotted line of C and to the left of the dotted line of D) that do not form gland well. Observed (on average, one ALDH per two cells is strongly positive tumor stem cells, 5-10 fold increase compared to normal) and concentrated in undifferentiated tumor areas. In particular, a small number of tumor cells with strong ALDH positive reactions were also observed in the well-differentiated gland. These tumor cells are located at the bottom of the gland structure. The bottom of the normal gland structure is where the basal cells are located. The basal cells generally function as stem / progenitor cells. That is, in tumors that produce well-differentiated gland structures, tumor cells that exhibit ALDH-positive responses are located in the basal cells where the basal cells are observed, as is observed in normal gland structures. That is, C and D of FIG. 1 demonstrate that the proliferation of cancer stem / progenitor cells showing ALDH-positive responses is observed in moderately or poorly differentiated PDACs in which proliferation occurs a lot.

Example  2: ALDH  Expression level test

Normal pancreatic ductal epithelium cell line (hTERT-HPNE, ACTT number: CRL-4023) and various human PDAC cell lines (CFPAC-1, ACTT number: CRL-1918; MIA PaCa-2, ACTT number: CRL-1420; PANC- 1, ACTT number: CRL-1469; AsPC-1, ACTT number: CRL-1682) ALDH expression was confirmed by flow cytometry and western blot.

Flow cell  analysis

For flow cytometry, the amount of ALDH was measured using an Aldefluor kit (ALDAGEN Inc.). At this time, 15 μL of 5X10 ⁵ cells were reacted with DEAB (diethylaminobenzaldehyde, 1.5 mM) included in the kit (negative control in FIG. 2A). At the top of each cell line, ALDH low), the test sample measured the amount of ALDH without DEAB treatment (bottom of each cell line in FIG. 2A). The visible population was measured and gated to ALDH high. In addition, the overexpressing cell group showing stronger ALDH expression amount out of the major population among the ALDH high population was used as ALDH bright.

More specifically, to measure the amount of ALDH, BODIPY-aminoacetaldehyde (BAAA), an active form of the ALDEFLUOR reagent included in the kit, was tested by test sample 1X10 ⁶ 5μl per cells / 1mL ALDEFLUOR buffer was added and reacted for 45 min in a 36 ℃ chamber. At this time, the control sample treated with DEAB (diethylaminobenzaldehyde, 1.5mM) was added to 15 μl per 5X10 ⁵ cells of the test sample. After centrifugation at 1350 rpm for 5 minutes, the supernatant was removed, and the pellet was resuspended in ALDEFLUOR buffer diluted 1: 1000 by volume of 7AAD (7-Aminoactinomycin D). Flow cytometry (using FACS Caliber product) was performed on the prepared samples. FSC (forward scatter) vs. All nucleated cells were gated by SSC (side scatter) (R1) and viable cells negatively reacted with 7AAD (R2). In the R2 population, FITC positive cell group was gated to define ALDH high cell group, and negative cell group was defined as ALDH low to negative cell group. Among the ALDH high cell populations, the ALDH bringt cell group was selected to show the expression level of ALDH protein higher than the major population.

The flow cytometry results of the various PDAC cell lines obtained above are shown in FIG. 2A. As can be seen in Figure 2a, in the normal pancreatic ductal epithelium cell line (hTERT-HPNE, ACTT number: CRL-4023) ALDH high cell group occupied 4.24% of the total. Normal stem cells are known to comprise less than 5% of the total cells, and it is thought that the side population of the ALDH high cell population will show the stem cell feature in the normal pancreatic ductal epithelium cell line.

Most of MIA PaCa-2 (94.83%) of PDAC cell lines were ALDH high and ALDH bright cells composed of overexpressed cells were also present. CFPAC-1 was found to have similar ALDH low (47.91%) and ALDH high (44.59%) and side populations containing ALDH bright cells.

Western  Blot Western blot )

Meanwhile, the amount of ALDH in the four PDAC cell lines was quantified by Western blot using ALDH1A1 antibody.

More specifically, each cell line was grown in a culture dish ( medium: CFPAC-1: IMDM (Sigma, I3390), MIA PaCa-2 and PANC-1: DMEM (GIBCO, 12100-046), AsPc-1: RPMI (GIBCO , 31800), hTERT-HPNE: low-glucose DMEM (Sigma, D6046) / culture conditions: CO ₂ 5% in a 37 ℃ incubator). After semi-confluent, the medium was washed with PBS buffer, 1 ml of 1 mM EDTA solution was added to PBS buffer, and each cell was harvested with a scraper. The pellet was centrifuged at 13000 rpm for 1 minute and the supernatant was removed to obtain cell pellet. 1% (v / v) NP-40 lysis buffer (50mM Tris-Cl (pH 7.5), 150mM NaCl, 1mM EDTA, 1% (v / v) NP-40 (detergent, Tergitol-type NP-40, Igepal CA -630, Sigma, I3021) added phosphatase inhibitors (PAFS: NaF, NaOVo3, β-glycerophosphate (Sigma) and proteinase inhibitors (pepstatin A (sigma, P5318), leupeptin (sigma L2884), PMSF (sigma, P7626)) The lysis buffer was prepared, and the lysis buffer thus prepared was placed in the obtained cell pellet and pipetting, followed by reaction for 30 minutes on ice, at which time it was vortexed every 10 minutes.

Centrifuged at 13000 rpm for 20 minutes and the supernatant was taken. Protein concentration of the samples prepared by Bradford assay was measured. LSB (Laemmli sample buffer (6X, 10ml: 1.2g SDS (sodium dodecyl sulfate) 1.2g, bromophenol blue 6mg, glycerol 4.7ml, 0.5M Tris (pH6.8) 1.2ml, distilled water 2.1ml, last 60μL β-mercaptoethanol / ml addition) 10μl per 50μl sample and boiled for 10 minutes at 100 ℃.

Samples were separated by molecular weight by SDS PAGE. After the SDS PAGE was transferred to the NC (nitrocellulose) membrane (Whatmann 10401196). The membrane was immersed in a fast green solution (Fast Green FCF, sigma, F7252 solution diluted to 0.1% in water diluted to 20% (v / v) methanol and 5% (v / v) acetic acid) band It was confirmed. ALDH1A1 was detected at a molecular weight of 55 kd.

The NC membrane was immersed in TBST buffer (890ml distilled water, 10X TBS 100ml, 10% twin-20 5ml, 10% NP-40 5ml) in a blocking solution diluted with 5% by weight of skim milk powder and reacted at room temperature for 1 hour. ALDH1A1 antibody (Abcam, catalog number ab52492) in 1: 5000 (by weight) in 5% (w / v) bovine serum albumin (BSA) solution (2.5 mg BSA diluted in TBST buffer to a final volume of 50 ml) After diluting, the blocking NC membrane was added thereto and reacted at room temperature for 2 hours. Wash in shaker three times for 10 minutes with sufficient TBST buffer.

Add the secondary antibody (anti-rabbit, KDR, 111-035-003) to the blocking solution (5% (w / v) skim milk) previously used at a volume ratio of 1: 10000 (antibody: blocking solution) at room temperature. The reaction was carried out for 1 hour. Wash in shaker three times for 10 minutes with sufficient TBST buffer. ECL western blotting detection reagent (GE healthcare, catalog number: RPN2106) 1 and 2 were mixed 1: 1 by volume on the prepared NC membrane and reacted at room temperature for 1 minute. Insert the NC membrane into the cassette in the darkroom, and react with the X-ray film (FUJI medical X-ray film, super RX, KNO.50594), and then the developer (Dongjinsa, Vivid X-RAY developer) and fixer (Dongjinsa, Vivid X-RAY fixer) to check the band.

The obtained result is shown in FIG. 2B. In MIA PaCa-2, 94% or more of the cells showed high ALDH (see FIG. 2A), and also showed the highest amount of ALDH in western blotting. CFPAC-1 showed ALDH high in about half (44.59%) of cells (see FIG. 2A), and was also confirmed by western blot. Meanwhile, PANC-1 and AsPc-1 showed ALDH high patterns of 1.73% and 3.23%, respectively (see FIG. 2A), and these cells were all located in the intermediate zone adjacent to the ALDH low cell population (see FIG. 2A). Almost no ALDH protein was identified.

In the above experiments, it was demonstrated that ALDH showed strong positive expression in normal and tumor stem cells.

In addition, the expression of ALDH IHC on PDAC was different from cell to cell within the same tumor, and the ALDH content of cells was positive vs. Rather than dividing by negative, we could see the spectrum from negative to bright cell.

Therefore, when comparing the amount of ALDH in cells, the degree of fluorescent color development for the ALDH antibody on the ALDH stain or the IFB on the ALDH stain in the IHC, the peripheral normal stem cells (e.g. duodenum) can be used as internal control. ALDH bright is when the expression level of pancreas is equal to or greater than 1-2 of 10 cells ALDH-positive. Characteristically, these ALDH bright (Strong Positive) cells are present in a large number of undifferentiated regions in tumor tissues as opposed to normal tissues.

In flow cytometry, DEAB was used to perform negative control of ALDH, and cells in this region in ALDH low and ALDH high and ALDH high expression cells were tested. The side population showing higher expression than the major population is ALDH bright.

Example  3: ALDH bright cell Tumor stem cell characteristics of CSC feature ) Research

The proportion of double positive cells to CD24 and CD44 was compared for ALDH low / high / bright cells (see FIG. 2A in Example 2 above) using a CFPAC-1 cell line (ACTT number: CRL-1918). CD24 (eBioscience, cat.No. 13-0247) and CD44 (eBioscience, cat.No. 55-3142) were used, where APC was conjugated with the CD24 antibody and PerCP-Cy5.5 was conjugated with the CD44 antibody. It was. Cells that were not reacted with each antibody were determined as flow control (BD ^TM , LSR II), and gating the areas where the cell populations were collected as negative controls. On the other hand, when flow cytometry was performed by staining the test sample with each antibody, it was determined that there were cells showing a positive response to each antibody in a positive region outside the gating region as a negative control. The extent to which cells positive for both antibodies were included in each cell group consisting of ALDH low / high / bright cells was measured. These are stem cell markers commonly used in pancreatic cancer and other tumors. The measurement was performed by the method of Example 2 using an Aldefluor kit (ALDAGEN Inc.).

The obtained result is shown in FIG. 3A. As shown in FIG. 3a, 32.99% of double positive cells in CD24 and CD44, 68.90% in ALDH high, and 83.28% in ALDH bright among ALDH low cells, and the more ALDH, the more double positive cells were included in CD24 and CD44. Appeared to be (Figure 3A right).

In addition, when the Aldefluor assay was performed on the CFPAC-1 cell line, the ALDH low and low ALDH high expression populations were divided into ALDH bright populations showing high expression in the ALDH high population (see left side of FIG. 3A). ). In the major population composed of ALDH low cells, 5% of the cells located in the more negative are selected, and in the major population composed of ALDH high cells, 5% of the cells constituting the most densely populated part are selected. ALDH bright population was selected and compared to the amount of cells positive for CD24 and CD44 simultaneously in each cell group.

Using the Aldefluor kit, the ALDH low / high / bright cells were sorted by FACS Aria-II (BD science, FACS Aria-II) for each CFPAC-1 cell line (ACTT number: CRL-1918). Cell groups were isolated and cultured. The medium used at this time was 10% (v / v) in IMDM (Iscove's Modified Dulbecco's Media, sigma aldrich, Cat.No.I3390-500ml), and FBS (fetal bovine serum, GIBCO, cat.No. 12617) was streptomycin and penicilllin ( GIBCO, cat.No. 15140-122) was used at 1000X.

When culturing each cell group (ALDH low / high / bright cells) 10000 cells in a 100mm cell dish two weeks later the cell growth was compared by microscopic observation. The obtained microscope observation result is shown in the photograph of FIG. 3B (x40). As shown in Figure 3b, it can be seen that there is a significant difference in cell growth, a larger number of cells were observed in the ALDH bright cell group compared to the ALDH low cell group. In order to quantitatively compare this, the cells were diluted in IMDM media so that 0.5 cells per well were put into a 96 well plate and grown in a 37 ° C., 5% CO ₂ incubator. ALDH low and ALDH birght cells were laid on three 96 well plates, and two weeks later, the numbers of colony-formed wells were compared to obtain statistical values. The results are shown in the graph of FIG. 3B. As shown in the graph, there was a statistically significant difference in colony formation between the two groups with p = 0.0003. In other words, ALDH birght cell population was able to confirm the high proliferative activity characteristic of tumor stem cells.

In addition, ALDH low / high / bright cells were sorted by FACS Aria-II using CFPAC-1 cell line (ACTT number: CRL-1918), and each cell group was separated and cultured (about ² × 10 ⁵ cells). Degree). After culturing the isolated cell groups for 2 weeks, when grown confluent in the plate again compared to the distribution of cells according to the amount of ALDH through flow cytometry as in Example 2 shown in Figure 3c.

One of the characteristics of cancer stem cells is that tumor stem cells (CSCs) can divide and proliferate and rebuild populations like the parental cell population. As can be seen from the results of FIG. 3C, when ALDH birght cells were incubated for two weeks, the population remodeled a cell hierarchy similar to that of the parental cell group shown in FIG. 3A, but the ALDH low cells showed a population shifted toward ALDH low. Seemed. That is, ALDH birght cell was confirmed to have a repopulation activity which is a representative feature of stem cells.

On the other hand, human PDAC is known to have high Shh (sonic hedgehog) signaling when showing tumor stem cell (CSC) characteristics, and therefore, it has been suggested that suppressing cancer cells with elevated Shh signaling is important for cancer treatment (Nature reviews 2005; 5). : 275-285, NEJM 2010; 362: 1605-17).

The following tests were performed to demonstrate that ALDH bright cells actually exhibited these tumor stem cell characteristics.

After flow cytometry of the ALDH low cell and ALDH bright cell in Example 2, reverse transcription polymerase chain reaction (RT-PCR) and real-time PCR were performed to compare the amount of transcript of the shh ligand.

More specifically, cDNA was synthesized from each cell group (ALDH low cell and ALDH bright cell) by the following method. Each separated cell group was precipitated at 13000 rpm for 1 minute with a centrifuge to obtain cell pellets. 500 μl of Ribo-Ex reagent (GeneAll, 301-001) was added thereto and vortexed. 100 μl of chloroform (Junsei) was added thereto, followed by vortexing, followed by precipitation at 13000 rpm for 5 minutes using a centrifuge to obtain a clear supernatant. Isopropanol (Merck) was added to the same volume as the clear supernatant and mixed with inversion. The pellet was precipitated for 5 minutes at 13000 rpm by centrifugation. 500 µl of 75% ethanol (Merck) was added thereto and precipitated at 13000 rpm for 2 minutes using a centrifuge to obtain pellets. The pellet obtained here was RNA, and 20 microliters of distilled water was added here, and RNA was melt | dissolved. 1 μg of RNA from each cell group was added to Maxime RT premix (oligo dT, Intron, 25081) to obtain a total volume of 20 μl, followed by PCR to obtain cDNA. PCR reaction conditions were 60 minutes at 45 degreeC, and 5 minutes at 95 degreeC.

Forward primer: 5 'GCG GCA CCA AGC TGG TGA AG 3' (SEQ ID NO: 1) and reverse primer as a primer for measuring mRNA level of shh ligand in cDNA synthesized in each cell group (ALDH low cell and ALDH bright cell) : 5 'GGT GAG CAG CAG GCG CTC GC 3' (SEQ ID NO: 2), and a primer for β-actin forward primer: 5 'CATGTACGTTGCTATCCAGGC 3' (SEQ ID NO: 3) and reverse primer: 5 'CTCCTTAATGTCACGCACGAT 3' (SEQ ID NO: 4) was used.

PCR conditions were 30 cycle reaction at 95 ° C / 30second (denature) → 60 ° C / 30second (annealing) → 72 ° C / 30minute (extension), where each PCR reaction was subjected to gel electrophoresis and subjected to gel electrophoresis. The band was identified at the location. At this time, comparing the mRNA (mShh) level for each shh ligand for β-actin was confirmed that the band is darker in ALDH bright. To quantify this, real time PCR was performed and the SYBR green method was used. The SYBR green method was performed by reacting the obtained cDNA with GENET BIO, Prime Q-Master Mix (with SYBR Green I, Q9200). Thermal cycler included in Bio-Rad Laboratories, CFX96 real-time PCR detection system was used, and analysis was performed using Bio-Rad iQ5 software included in Bio-Rad Laboratories, CFX96 real-time PCR detection system.

The relative expression amount of the mShh mRNA transcript thus obtained (Relative mShh expression level obtained by comparing relative values by ΔΔct method) is shown in FIG. 3D. As shown in Figure 3d, when comparing the respective mShh level for β-actin ALDH bright was measured about 5 times higher than the amount of mShh mRNA transcript ALDH low. That is, it can be seen that Shh signaling is increased in cancer cells showing ALDH bright expression.

In Examples 2 and 3, the ALDH protein expression level in pancreatic cancer tumor cell line (CFPAC1) was measured using an Aldefluor Kit (Aldagen) using flow cytometry, and each was separated according to the ALDH protein expression level. It is shown again by the expression level of tumor cell markers (CD24 and CD44). ALDH Low refers to a cell group in which ALDH protein expression is in the negative control group, ALDH High refers to a cell group in which ALDH protein expression is less than 5% of the upper expression level among the cell groups in the positive control group, and ALDH Bright is positive in ALDH protein expression amount It refers to a cell group belonging to the top 5% of the expression level among the cell group belonging to the control group. As shown in FIG. 2A, the cell populations showing positive expression patterns in both CD24 and CD44 were 32.99% in ALDH Low, 68.90% in ALDH High, and 83.28% in ALDH Bright, indicating a high correlation between ALDH expression and stem cell markers. Shows. That is, the cells with high ALDH expression amount are the cells showing the characteristics of stem cells, and thus, it is possible to distinguish tumor stem cells only by the ALDH expression pattern.

Example  4: ALDH bright  Correlation test with degree and anticancer effect

In the above, it was confirmed that ALDH bright cancer cell showed tumor stem cell characteristics (CSC feature). Since CSCs are characterized by drug resistance, PDAC cell lines [MIA PaCa-2 (ACTT number: CRL-1420) and CFPAC-1 (ACTT number: CRL-1918) with ALDH bright cell population are described below. And gemcitabine (GCB), the most commonly used for PDAC treatment in PDAC cell lines [PANC-1 (ACTT number: CRL-1469) and AsPc-1 (ACTT number: CRL-1682)] that do not have an ALDH bright cell population. WST assay was performed to confirm cell viability.

More specifically, the cells of each cell line were suspended at 10 ⁵ cells / ml using the culture medium of each cell, and then, 100 μl was dispensed into a 96well plate and incubated for 24 hours (37 ° C., 5% CO ₂ incubator). ). GCB (anticancer agent; Sigma Aldrich, Cat. No. G6423) and DSF (ALDH inhibitor; Sigma Aldrich, Cat. No. G86720) were each treated in 96well plates in which the cells were cultured at the concentrations described in FIG. 4A. At this time, three wells of each concentration were treated with the same concentration of drug by triplet for statistical treatment of the experimental group. After 12 hours of treatment with DSF and GCB, cell viability assay was performed. Cell survival analysis was performed using the WST assay method (according to the user protocol of EZ-Cytox Cell Viability Assay kit of Daeil Lab Service Co., www.daeillab.co.kr), and EZ-Cytox Cell Viability Assay kit (Daeil Lab Service Co. .,) Was used to measure the degree to which the water-soluble tetrazolium salt was reduced by mitochondrial NADH-dihydrogenase in the cell and converted to colored formazan. 10 μl of the reagent contained in the EZ-Cytox Cell Viability Assay kit was added to 100 μl of the medium, and after 100 minutes, the absorbance at 450 nm was measured using a microplate reader. The results obtained are shown in FIG. 4A, and the IC 50 values for each drug obtained therefrom are shown in Table 2 below.

As can be seen in Figure 4a, PDAC cell lines MIA PaCa-2 and CFPAC-1 showing ALDH high expression, including ALDH bright cell population, PANC-1 and the PDAC cell line IC50 for GCB does not have ALDH bright cell population and It was found to be higher than the IC50 value of AsPc-1. In other words, the resistance to anticancer drugs in PDAC cell lines showing high expression is greater than otherwise.

On the other hand, PDAC cell lines MIA PaCa-2 and CFPAC-1 exhibiting high ALDH expression showed lower IC50 values for DSF than IC50 values of PANC-1 and AsPc-1, PDAC cell lines without ALDH bright cell population. In other words, PDAC cell lines showing high ALDH expression inhibit tumor growth by DSF at lower concentrations.

This inverse relationship is related to the degree of expression of ALDH. In other words, most of the cell population had the highest IC50 for GCB and the lowest ICF for DSF, and the majority of the cell population was MIA PaCa- for CFPAC-1. IC50 values for DSF were higher than IC50 values for GCB of 2 cell lines. The PANC-1 and AsPc1 cell lines, which consist of the majority of ALDH low population and few ALDH bright cells (ALDH high expressing cells), showed much lower IC50 values for GCB and much higher IC50 values for DSF.

Therefore, cancer cells having ALDH bright (high expression) cell components showing tumor stem cell characteristics were highly resistant to cancer, while DSF, an ALDH inhibitor, was able to inhibit tumors even at low concentrations.

On the other hand, it was dispensed in an amount (10 ⁵ / ml) as the CFPAC-1 cell line, a dish not process the dish will handle the DSF, when each dish is hayeoteul semiconfluent a dish has DSF 5μM (DMSO (dimethyl sulfoxide) solvent In soluble, sigma, D2650), and in the other dish, only DMSO was treated with the same volume as DSF. At this time, DSF and DMSO were suspended in media (IMDM), each cell line was washed with PBS buffer, and 10 ml of the prepared media were added and cultured in the above-described culture conditions (37 ° C., 5% CO ₂ ). . As described above, ALDH levels of surviving cells confirmed by flow cytometry after 6 hours of DSF 5 μM treatment were measured by flow cytometry as in Example 2. The obtained result is shown in FIG. 4B. In FIG. 4B, the control was treated with only DMSO (dimethyl sulfoxide), and withdrawal was measured by flow cytometry after 6 hours of DSF treatment, and then changed into a culture medium containing no DSF and cultured for 2 weeks.

As shown in FIG. 4B, almost no ALDH high population was observed (0.09%) when the ALDH inhibitor DSF was treated. On the other hand, after DSF treatment, after removing DSF, changing to medium without adding DSF, and incubating for 2 weeks, when ALDH amount was measured by flow cytometry, shifting to ALDH low could not be made. (ALDH low: 59.84%). If DSF-treated ALDH-expressing cells did not die but only ALDH detection was masked, subpopulation of ALDH-expressing cells would be generated when DSF was removed. Because 2 weeks is enough for normal epithelial cells to resynthesize ALDH intracellularly. Therefore, the results of Figure 4b can be seen that not only the inhibition of ALDH activity by DSF but also ALDH high expression cell population is removed.

In order to prove that the result of FIG. 4B is due to apoptosis (apoptosis) of ALDH high expressing cells during DSF treatment, 5 μM of DSF was added to CFPAC-1 cell line (ACTT number: CRL-1918) as described above. Apoptosis occurred 3 hours after the treatment with the amount was confirmed by flow cytometry in the same manner as in Example 2. The test was performed using 7AAD (ebioscience, 00-6993) and AnnexinV (FITC conjugation, BD pharmingen, cat. No. 556547) and followed the manufacturer's instructions. The obtained result is shown in FIG. 4C.

As can be seen in Figure 4c, DSF treatment increased 7AAD negative and early apoptotic cells (M2), an AnnexinV positive cell component, increased by 30.41% from 4.78% to 35.19% compared to the control. That is, it was proved that apoptosis was significantly increased by DSF treatment.

In FIG. 4b, the control cells treated with DMSO, the cells treated with DSF, and the cells treated with DSF were extracted from the withdrawal cells, and Western blot was performed in the same manner as in Example 2 to compare the expression levels of ALDH proteins. The cell lines used were CFPAC-1 (ACTT number: CRL-1918) and MIA PaCa-2 (ACTT number: CRL-1420) with high ALDH levels and harvested cells 6 hours after 5 μM treatment of DSF as described above. Was used in this experiment.

The obtained result is shown in FIG. 4D. As shown in FIG. 4D, the amount of ALDH1 protein was significantly decreased during DSF treatment compared to the control compared to the same amount of cytosolic GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) which is intracellular control in both cell groups. In case of CFPAC-1, withdrawal of DSF is slightly higher than that of DSF, but still decreased compared to ctrl. DSF treatment also reduces the amount of ALDH1 in MIA PaCa-2. In MIA PaCa-2, almost all cells are composed of ALDH high cells (see FIG. 2A. 94.84%). Is disappeared (see Fig. 5a), it is considered difficult to confirm the blot because the amount of surviving cells and the amount of ALDH are very small even after removing the DSF. If the ALDH high cells were not killed by DSF, the treatment of DSF in western blot would not change the amount of protein, and the removal of DSF would not change the amount of protein. The results of this western blot can also prove that ALDH high cells are removed by DSF.

DSF is a drug with safe pharmacokinetics already approved by the FDA and commercialized as an oral preparation, and is known to not damage normal cells. 4A and Table 1 do not induce apoptosis in normal pancreatic epithelial cell lines (hTERT-HPNE, ACTT number: CRL-4023) at concentrations corresponding to IC50 values of DSF in ALDH high expressing cancer cell lines. Not shown (see FIG. 4E). The IC 50 value for the DSF of hTERT-HPNE is between 10-15 μM, which is similar to the IC 50 value of cancer cell lines consisting mainly of ALDH low expressing cells such as PANC-1 and AsPc-1. Thus, this level of DSF is drug-toxic enough to induce apoptosis of normal cells, which cannot be used physiologically. On the other hand, the IC50 value of hTERT-HPNE for anticancer drugs (GCB) is less than 1 × 10 ⁻⁵ μg / ml, indicating that normal cells are vulnerable to very low concentrations of anticancer drugs.

Therefore, based on the present results, DSF treatment was performed on ALDH high expressing cancer cells resistant to anticancer drugs to induce apoptosis of ALDH high expressing cancer cells and low dose anticancer drugs on ALDH low expressing cancer cells vulnerable to anticancer drugs. And new treatment strategies to minimize normal cell damage.

As described in FIGS. 3A-3D, since CSCs are drug resistant, blocking the increased signaling pathways has been suggested as a new therapeutic direction. Especially in the case of PDAC, the presence of CSC has been studied, and it is known that CSC of PDAC has high hedgehog signaling. Therefore, cyclopamine, an inhibitor of Smoothened, a receptor for Shh ligands, has emerged as a new therapeutic agent. However, previous studies have reported that the inhibition of smoothened receptors using cyclopamine in cancer cells with increased Hedgehog signal does not inhibit tumor growth. The reason is that even if the hedgehog ligand is produced in a large amount of cancer cells, it does not directly affect the tumor cells themselves, but rather signals the cancer associated fibroblast (CAF) in the cancer cell environment to create an environment where tumor cells can grow better. Because.

Therefore, ALDH low-expressing cancer cells remain mainly when DSF is treated, compared to controls not treated with DSF. Therefore, ALDH1A1 and Shh of control cells and DSF-treated cells in the CFPAC-1 cell line were treated in the same manner as in Example 3. mRNA levels were compared by RT-PCR and real time PCR.

In the same manner as described above, cDNA was synthesized in the control cells that were not treated with DSF and treated with 5 μM of DSF in the CFPAC-1 cell line and harvested after 6 hours. The primer used at this time is ALDH1A1 is Forward: 5 'CTGCTGGCGACAATGGAGT 3' (SEQ ID NO: 5) and Reverse: 5 'CGCAATGTTTTGATGCAGCCT 3' (SEQ ID NO: 6). Primer and RT-PCR and real time PCR method for Shh and β-actin is the same as used in the test procedure of Figure 3d of Example 3.

The relative expression amount (Relative mShh expression level obtained by comparing relative values by the ΔΔct method) of the obtained mShh mRNA transcript is shown in Figure 4f (Y axis: relative mShh expression). The mRNA levels of ALDH1A1 (left) and Shh (right) of DSF-treated cell groups were about 1/5 lower than those of controls. In other words, ALDH1A1 transcript was low in the cancer cells that survived DSF treatment and Shh transcript was increased in CSC. In other words, the cells remaining after DSF treatment showed a reasonable pattern for ALDH low expression cancer cells.

Treatment with cyclopamine that inhibits Shh signaling confirmed that the growth of CFPAC-1 (ACTT number: CRL-1918) and MIA PaCa-2 (ACTT number: CRL-1420) was actually inhibited.

Suspend each cell line at 10 ⁵ cells / ml (suspension: medium for each cell line; CFPAC-1: IMDM, MIA-PaCa-2 and PANC-1: DMEM, AsPc-1: RPMI) 1 ml aliquots and incubated for 24 hours (37 ° C. and 5% CO ₂ incubator). After removing the medium and washing with 1XPBS, cyclopamine (cyclopamine, Sigma Aldrich, Cat. No. C4116) diluted in 10 mM concentration in DMSO was added to the medium (CFPAC-1: IMDM, MIA-PaCa-2 and PANC-1: 2 μl per 1 ml of DMEM, AsPc-1: RPMI) was added and cultured by replacing the prepared medium. As a control, tomadine (tomatidine, Sigma Aldrich, Cat. No. T2909), a compound of the inactive form of cyclopamine, was diluted to 10 mM in DMSO, and 2 μl per 1 ml of media was replaced with a culture medium. It was. Cyclopamine or tomatidine was treated in each cell line, followed by cell counts by time, and WST assay for cell growth.

The obtained result is shown in FIG. 4G. There was no difference in growth between control and test groups in both cell groups. Statistics were treated with two-way ANOVA (SPSS program) and the p values were all greater than 0.05. That is, although the Shh signaling pathway is increased in the ALDH high population including ALDH high expressing cells showing tumor stem cell characteristics, cell growth was not inhibited even by inhibiting Shh signaling.

Therefore, even if Shh signaling is increased in PDAC, suppressing it does not help treatment. Therefore, detection of cancers showing tumor stem cells through ALDH activity and removal of these cell populations using DSF may be a much more effective method.

In order to confirm that ALDH low expressing cells are effectively killed by GCB, the surviving population of GCB treated CFPAC-1 cell line was examined by flow cytometry. In the method, GCB (Sigma Aldrich, Cat. No. G6423) diluted to 10 mg / ml in distilled water was treated with cells (ACTT number: CRL-1918) at a concentration of 5 µg / ml. Alefluor assay was performed by the method of Example 2.

The obtained result is shown in FIG. 4H. It can be seen that the ALDH high expressing cell population (54.71%) survived more than the ALDH low expressing cell population (38.47%). In other words, flow cytometry confirmed that ALDH high cell population had higher anticancer resistance than low population.

As described above, ALDH expression is lowered in the order of MiaPaca2, CFPAC1, PANC1, AsPc1, IC50 value in GCB is lowered in the order of MiaPaca2, CFPAC1, PANC1, AsPc1, so that drug resistance to GCB is lower than MiaPaca2, CFPAC1, PANC1, AsPc1. High (see FIG. 2A). MIA PaCa-2 and CFPAC-1 are more resistant to GCB than PANC-1 and AsPc-1, and GCB-resistant MIA PaCa-2 and CFPAC-1 are more sensitive to DSF and cell growth inhibited. Sensitive PANC-1 and AsPc-1 did not appear to inhibit cell growth effectively by DSF.In DSF, IC50 values increased in the order of MiaPaca2, CFPAC1, PANC1, AsPc1, and therefore MiaPaca2, CFPAC1, PANC1, AsPc1 for DSF. In order, tumor growth is well suppressed.

In conclusion, cell lines with high ALDH expression are highly resistant to anticancer drugs such as GCB and cell lines are well inhibited by DSF. Cell lines with low ALDH expression are well inhibited by anticancer drugs like GCB but have no significant effect on DSF.

In addition, inhibiting the increased Shh pathway in tumor stem cells of PDAC did not inhibit the growth of cancer cells. Therefore, by treating DSF to remove ALDH high cell population including ALDH bright cancer cells showing tumor stem cell characteristics and removing ALDH low cell population vulnerable to anticancer drug with low concentration of GCB, PDAC can be effectively treated It can prevent damage and minimize side effects.

Example  5: various In tumor cell lines ALDH high  And bright  Cell population

By comparing several cancer cell lines originating from different organs, including PDAC, the proportion of ALDH high cell populations including ALDH bright cells among the cells constituting each tumor cell line was examined, and the effect of DSF on each was confirmed.

The cell lines used in this experiment were as follows:

number: CRL-1420), PANC-1(ACTT

number: CRL-1469)PDAC: MIA PaCa-2 (ACTT

number: CRL-1420), PANC-1 (ACTT

number: CRL-1469)

number: CCL-185TM), H1299(ATCC

number: CRL-5803TM)Lung adenocarcinoma: A549 (ATCC)

number: CCL-185TM), H1299 (ATCC

number: CRL-5803TM)

number: CRL-1582TM)Leukemia (T-ALL): Molt4 p53 (ATCC

number: CRL-1582TM)

number: HB-8064TM)Hepatocellular carcinoma: SNU886 (SNU cell bank, SNU886), HepB3 (ATCC

number: HB-8064TM)

number: CCL-2TM) Uterine cervical carcinoma: HeLa (ATCC)

number: CCL-2TM)

Thyroid papillary carcinoma: BcPAP (COSMIC ID: 924104)

The cells were cultured by dispensing each of the cell lines (10 ⁵ cells / ml) by the method described above, and then treated with each cell line at a concentration of 15 uM for 6 hours, using an Aldefluor kit (ALDAGEN Inc.), manufacturer's instruction. Assay was followed. Flow cytometry was performed by the method as described in Example 2. Control was a cell group not treated with DSF.

The obtained results are shown in Figs. 5A to 5E. Most cells (83.37%), such as MIA PaCa-2, consisted of cell lines composed of ALDH high, and cell lines with few ALDH high cells (2.37%) such as H1299. However, it was confirmed that all ALDH high cells were removed by DSF regardless of the composition.

Example  6: in vivo In DSF of ALDH bright  Investigation of tumor stem cell growth inhibitory effect

In Example 2 in using ALDH bright cell of CFPAC-1 cancer cell lines and found to ALDH high cell population is present, including in vitro tests, in fact, even in vivo As in vitro , it was confirmed that DSF effectively acts on ALDH bright tumor stem cells (CSC) in comparison with ALDH low cells.

The materials used in this experiment were as follows:

Mouse: Nude mouse (OrientBio, Foxn1 mutation, 6 weeks old male)

Cell line: CFPAC-1 (ACTT number: CRL-1918, ALDH high and ALDH low cells classified in Example 2)

Disulfiram:

1) Oral Administration: Health'n Care, Ind-Swifr Limited, 500mg Tablet, 1mg / Kg / day per mouse

2) Intraperitoneal injection: Sigma Aldrich, Cat. No. G86720, used at 50mg / kg / week per mouse

Gemcitabine: Sigma Aldrich, Cat. No. Intraperitoneal injection at G6423, 20 mg / kg / week, 2 mg / kg / week, 0.2 mg / kg / week.

After injecting CFPAC1 tumor cell line (ACTT number: CRL-1918) into the subcutaneous tissue of the nude mice, a certain size, that is, tumor volume is 200-500mm ³ When the size of the nude mice were divided into control and experimental groups, the normal diet and the DSF (2mg / mice / day) diet was added daily for 2 weeks. After two weeks, each tumor was excised and a paraffin block was prepared as described in Example 1.

Hematoxylin and eosin (H & E) slides were prepared by cutting the block into 3-4 μm thickness sections, and immunohistochemical staining with ALDH1A1 (abcam) antibody was performed to compare expression levels in tumor cells of each experimental group. And diagrams are shown in FIGS. 6A-6F. In the figure 'Ctrl' is a tumor tissue obtained from the control group provided a diet without the addition of DSF 'DSF' is a tumor tissue obtained from the experimental group provided a diet with the addition of DSF. Compared with the control group, more tumor-forming parts of the tumor were formed in the experimental group than in the control group. On the slides of immunohistochemical staining with ALDH1A1 (abcam) antibody to compare the expression level of ALDH, the number of tumor cells that were determined to be positive for each field when observed at high magnification (400 times) under a microscope In each experimental group, more than 20 fields were measured and compared. Statistics were obtained by t-test and SPSS program was used. The mean values of the number of positive cells expressed in both groups were lower in the experimental group treated with DSF, and the P-value was less than 0.0001. There was a statistically significant difference in the number of tumor cells overexpressing ALDH between the two groups. Can be. Therefore, it was demonstrated in vivo in mice that DSF administration in ALDH-expressing tumors could over-express ALDH and selectively kill cells highly anti-cancer therapy.

More specifically, ALDH high cells and ALDH low cells were prepared by 5X10 ⁵ , 1X10 ⁶ , 2X10 ⁶ per mouse, respectively. Zoletil 50 (Virbac): Rompun (Bayer, cat.No. 41882): 1XPBS buffer was mixed at 5: 1: 14 (by volume) to prepare anesthesia, and anesthetized by intraperitoneal injection of 40 μl into 6-week-old nude mice. Each prepared ALDH high and ALDH low CFPAC-1 cancer cells were injected into the subcutaneous tissue of the right flank of the mouse using an insulin syringe.

5 weeks after the injection of ⁵ × 10 ⁵ ALDH high and ALDH low CFPAC-1 cancer cells, the tumor nodules were compared at the top of FIG. 6A.

In addition, CFPAC-1 cancer cells were injected and divided into ALDH high 30% cells and ALDH low 30% cells according to ALDH activity by flow cytometry in the same manner as in Example 2 (5X10 ⁵ , 1x10 ⁶ , 2x10 ⁶ each). The timing of tumor nodules observed over time after injection is shown in Table 3 below and in the graph at the bottom of FIG. 6A.

When 5X10 ⁵ ALDH low cells were injected, no tumors were observed over time. However, when 5X10 ⁵ ALDH high was injected, nodules began 2 weeks after injection. It became. In both 1 × ^{10 6} and 2 × 10 ⁶ injections, tumor nodules developed earlier in ALDH high cells than in ALDH low cells. That is, the proliferative activity of ALDH high cancer cells is much greater than ADLH low in It could be confirmed in vivo .

Among the CFPAC-1 cancer cell-injected mice, xenograft tumors generated by injecting ALDH high cell populations were extracted, and paraffin blocks were prepared in the same manner as in Example 1, and then sliced on glass slides. Hematoxylin and eosin (H & E) (hematoxylin: sigma HHS32, eosin: sigma HT110132) staining was observed histological characteristics of the tumor and the results are shown in the upper left and lower left of Figure 6b. As shown in the upper left photo of Figure 6b, the tumor is a well-formed portion and the left portion of the form of a little like the shape of the shape of the solid sheet was mixed. When observing the shape of the tumor cells, the tumor cells that form poorly differentiated areas such as the lower left are more diverse in cell shape and cell division than in the well-differentiated tumor areas that form well glands as shown in the upper left picture. More often observed.

In the same manner as in Example 1, ALDH1A1 antibody (Abcam, catalog number ab52492) was diluted 1: 150, and the results obtained by immunohistochemical staining are shown in the upper right and lower right of FIG. 6B. In the part of good differentiation, as shown in the upper right picture of FIG. 6b, most of the cells are composed of week positive or negative cells. At this time, the criterion for the determination of the positivity was based on showing the degree of color development or the same as that of the progenitor cells observed in the pancreatic tissue of the normal mouse as in Example 1.

As seen in FIGS. 6A and 6B, in As in the in vitro experiments, cancer cells showing ALDH high expression including ALDH bright cells are more tumorigenic in vivo , and ALDH strong on poorly differentiated tumors where active division occurs through ALDH immunohistostaining. There was a positive cell.

DSF Effects in In order to determine in vivo , ⁶ x 3 weeks old CFPAC-1 cells (ACTT number: CRL-1918) were injected into 6-week-old nude mice in the same manner as in FIG. 6A. When the tumor had grown sufficiently (volume> 2000 mm 3) mice were divided into the following two groups. The control (control) was a diet without the DSF, DSF treated group was orally administered with disulpyram (Health'n Care, Ind-Swifr Limited, 500mg tablet, 1mg / Kg / day per mouse). Tumor volume was compared over time and statistically processed for both groups (SPSS program, two-way ANOVA).

The obtained result is shown in FIG. 6C. As can be seen in Figure 6c, there was a change in tumor size over time (p <0.0001), and this change in size over time was statistically significantly reduced by DSF oral administration (p = 0.0002). In other words, it can be seen that tumor growth was inhibited to a statistically significant level by treating DSF.

The tumors of the control group and the experimental group administered orally with DSF for 2 weeks in FIG. 6c were isolated from tumor cells, and ALDH activity was compared by flow cytometry.

The extracted tumor was placed in an EP tube (Eppendorf tube, SARSTEDT, 72.690) and chopped with scissors. 120 μl of Collagenase IV / Dispase (Roche, Cat. No. 10269638001) was put in 6 ml of 1XPBS buffer and 500 μl of diluted enzyme solution was added and chopping was performed again. 1500 μl each of the same concentration of Collagenase IV / Dispase solution was added thereto and then rotated in a 37 ° C. incubator for 30 minutes. Then, each sample was passed through a 70μm → 40μm strainer in order to obtain a soup. This was centrifuged at 1350 rpm for 5 minutes to remove supernatant and pellets. ACK hypotonic solution (8.29g NH4Cl; 1g KHCO3; 37.2mg Na2-EDTA.pH solution to 7.2-7.4; sterilize using 0.2μm filter) was prepared and 100μl of each obtained pellet was pipetted to remove RBC. Again centrifuged for 5 minutes at 1350rpm and the supernatant was removed. Put the PBS buffer in the remaining pellets to check the number of cells, ALDH activity was determined by flow cytometry using the Aldefluor kit as in Example 2.

The obtained result is shown in FIG. 6D. In the upper left and lower graphs of FIG. 6D, the two cells in the control diet were isolated from the tumor cells of the Aldefluor assay, and the upper and lower graphs of the right and lower cells were separated from the tumor cells of the mice fed the DSF Aldefluor. The assay was performed. The top is gating the ALDH low cell population using DEAB (diethylaminobenzaldehyde, 1.5 mM, included in the Aldefluor assay kit, following the manufacturer's instructions). Comparing the distribution of the cell populations on the lower left and the right, the tumors of the control diet mice showed similar distributions of ALDH low population (48.40%) and ALDH high population (41.48%) as in the original CFPAC-1 cancer cell line. On the other hand, tumors extracted from DSF diet mice showed that the ALDH low population (85.31%) occupies much higher portion than the ALDH high population (9.89%).

The graph on the right is a graph comparing ALDH activity by flow cytometry for a plurality of tumor nodules extracted from control and DSF diet mice, respectively. Comparing the distribution of ALDH high population (t-test), it can be seen that much less ALDH high cells remain in tumors of mice orally treated with DSF with p value = 0.0001.

On the other hand, in the same manner as in Example 1, the control diet and the DSF diet was made from a tumor extracted from a mouse to make a paraffin block to make a slide, and observed by H & E staining.

The obtained result is shown in FIG. 6E. As shown in FIG. 6E, in the tumors of the DSF diet group on the H & E staining (upper right photo), more differentiated parts were observed than in the tumors in the control group (upper left photo). Tumors in the group (middle right) showed lower cellular density than tumors in the control group (middle left). In other words, the treatment of DSF in tumors removes more of the poorly differentiated parts that proliferate and lowers the cell density of the remaining poorly differentiated parts. When immunohistochemical staining was performed on ALDH1A1, the number of cells that exhibited a positive color development was counted in 500 cells in 30 or more high power fields (400 magnification field of view). Much fewer ALDH strong positive cells remained in DSF diet tumors (bottom left and right). Figure 6f is a graph of the immunohistochemical staining results, and showed a significant difference as p value <0.0001 when the statistical treatment (t-test).

In addition, the protein levels of ALDH1A1 were compared with protein samples extracted from tumors of the control group and tumors of the DSF diet group.

The protein sample was extracted in the following manner. Tumors extracted from mice were placed in EP tubes and chopped by scissors. The above-described PAFS was diluted in Pro-Pre (intron, 17081) at a volume of 1: 100, and the diluted solution was vortexed into 500 µl of the EP tube containing the cut tumor. This was put on ice for 20 minutes, precipitated at 13000 rpm for 20 minutes by centrifugation, and the supernatant was transferred to another EP tube. Protein concentration of the samples prepared by Bradford assay was measured. LSB (Laemmli sample buffer (6X, 10ml: 1.2g SDS (sodium dodecyl sulfate) 1.2g, bromophenol blue 6mg, glycerol 4.7ml, 0.5M Tris (pH6.8) 1.2ml, distilled water 2.1ml, last 60μL β-mercaptoethanol / ml addition) was added 10 μl per 50 μl sample and boiled for 10 minutes at 100 ° C. Samples were separated according to molecular weight by SDS PAGE After transfer of SDS PAGE to nitrocellulose membrane (Whatmann 10401196). The membrane was immersed in a fast green solution (Fast Green FCF, sigma, F7252 diluted 0.1% in water diluted to 20% methanol and 5% acetic acid) to identify the band ALDH1A1 was detected at a molecular weight of 55 kd. NC membrane was immersed in TBST buffer (890ml distilled water, 10X TBS 100ml, 10% twin-20 5ml, 10% NP-40 5ml) in a blocking solution diluted with 5% by weight of skim milk powder and reacted at room temperature for 1 hour. ALDH1A1 antibody (Abcam, catalog number ab52492) at 5% (w / v) BSA (bovine se) at 1: 5000 (volume) rum albumin) solution (2.5 mg BSA was diluted in TBST buffer so that the final volume was 50 ml), and the blocking NC membrane was added thereto and reacted at room temperature for 2 hours. In a shaker, using a blocking solution (5% (w / v) skim milk) of a secondary antibody (anti-rabbit, KDR, 111-035-003) in a volume ratio of 1: 10000 (antibody: blocking solution) The reaction was carried out at room temperature for 1 hour. Wash in shaker three times for 10 minutes with sufficient TBST buffer. ECL western blotting detection reagent (GE healthcare, catalog number: RPN2106) 1 and 2 were mixed 1: 1 by volume on the prepared NC membrane and reacted at room temperature for 1 minute. Insert the NC membrane into the cassette in the darkroom, and react with the X-ray film (FUJI medical X-ray film, super RX, KNO.50594), and then the developer (Dongjinsa, Vivid X-RAY developer) and fixer (Dongjinsa, Vivid X-RAY fixer) to check the band.

The protein level of the obtained protein sample was performed by the Western blotting method described in Example 2. The obtained result is shown in FIG. 6G. It can be seen that the amount of ALDH1A1 relative to the amount of intracellular β-actin is significantly lower in the DSF diet group. This suggests that the tumor cells remaining as a result of DSF expression are cells with low ALDH levels.

In other words, in that the Figure 6c to 6g through the results to the DSF when orally administered DSF alone inhibited tumor growth, at which time cells are removed ADLH high population in It was confirmed in vivo .

Example  7: ALDH high cancer cell Combination treatment test with existing anticancer agent for cancer cells

In FIG. 4, the IC50 for the GCB of the CFPAC-1 cell line is shown and the resistance to the anticancer agent is large. Also through FIGS. 4-5 in In vitro, DSF was able to inhibit tumor growth by targeting ALDH high cancer cells including ALDH bright cells. Therefore, if DSF removes ALDH high cancer cell, it will show IC50 value at lower concentration when GCB treatment. In order to confirm these contents, the WST assay was performed in the same manner as in Example 4.

First, CFPCA-1 cells (ACTT number: CRL-1918) were suspended at 10 ⁵ cells / ml, and 100 µl was dispensed into 96well plates. After 24 hours, three wells each were DMSO (ctrl), 10 μM DSF, 10 μM DSF + 1 × 10 ⁻³ μg / mL GCB, 10 μM DSF + 1 × 10 ⁻² μg / mL GCB, 10 μM DSF + 1 × 10 ⁻¹ μg / mL GCB, 10 μM DSF + 1 μg / mL GCB. After 12 hours, the WST reagent (reagent included in the EZ-Cytox Cell Viability Assay kit as in Example 4) was added to 10 μl of 100 μl of medium (IMDM media) and reacted for 100 minutes. Absorbance at 450 nm was measured.

The obtained results are shown in 7. As can be seen in FIG. 7A, the IC50 value (0-1X10 ⁻ ) when the DSF was co-treated with the IC50 value (1-10 μg / ml) of GCB alone (upper graph). ³ μg / ml) was much lower. In other words, treatment with DSF proved that even lower doses of GCB would be effective.

In order to directly determine the DSF combined therapeutic effect on ALDH strong positive cell showing resistance to anticancer agents in In vivo experiments were performed. Mice injected with the same cell line in the same manner as in FIG. 6C of Example 6 were divided into five experimental groups. Each experimental group is as follows.

Control: Control

DSF: oral administration of disulfiram (Health'n Care, Ind-Swifr Limited, 500 mg tablet, 1 mg / Kg / day per mouse)

Low dose GCB: intraperitoneal injection of gemcitabine (sigma-aldrich, 40 mg / m ² / week per mouse)

High dose GCB: intraperitoneal injection of gemcitabine (sigma-aldrich, 400 mg / m ² / week per mouse)

DSF + GCB: disulfiram (Disulfiram, Health'n Care, Ind-Swifr Limited, 500 mg tablet, orally administered 1 mg / Kg / day per mouse) and low dose GCB (gemcitabine, sigma-aldrich, 40 mg / m ² per mouse) / week intraperitoneal injection)

Tumor volume was compared over time and statistically processed for both groups (SPSS program, two-way ANOVA).

The obtained result is shown in FIG. 7B. As can be seen in Figure 7b, there is a change in tumor size over time (p <0.05), and the size change over time is statistically determined by the combination of oral DSF and GCB intraperitoneal administration compared to the control group. Significantly decreased (p <0.05). More specifically, the low-dose GCB (40 mg / m ² / week) alone and the DSF alone alone showed about the same effect as the tumor size of about 1/2 of the control group, while the low-dose GCB (40 mg / m ² / week) When co-administered with DSF, tumor size was reduced to about one third or less of the control group, and the tumor suppression effect was equivalent to that of high-dose GCB (400 mg / m ² / week). That is, when GCB was co-administered with DSF, tumor growth was inhibited to a statistically significant level equal to or higher than that of high-dose GCB even with low-dose GCB.

Example  8: chemotherapy PDAC patient Showing therapeutic resistance in ALDH  strong positive cell To verify

In fact, we examined the expression of ADLH bright cancer cells in PDAC patients. Earlier experiments demonstrated that ASC has strong positivity in CSCs resistant to cancer.

Therefore, when the patients who were diagnosed with human PDAC and who underwent pancreatic resection by the method of Whipple's operation or pylorus preserving pancreatoduodenectomy (PPPD), In this case, ALDH low cells susceptible to anticancer drugs were killed and anti-cancer drug resistant ALDH strong positive cells were left.

Subjects were stage IIA (T3N0M0) and IIB (T1-3N1M0) at the time of diagnosis, and the control group was a group of 40 cases who underwent PPPD or whiplash treatment without any treatment before surgery. The group consisted of 21 patients who underwent preoperative concurrent chemoradiation therapy (CCRT). Representative sections were identified by H & E slide search among tissue sections prepared from surgical specimens in the same manner as in Example 6, and then subjected to immunohistochemical staining with ALDH1A1 antibody (Abcam, catalog number ab52492). The representative section is that the pathology doctor does not interfere with the microscopic reading because it contains the most tumor cells and scans the H & E slide made from several sections produced by visual inspection on the patient's specimen. It is one slide judged.

The criterion was based on the internal control of the duodeanl stem / progenitor cell (black arrows in the top left and top right pictures of FIG. 8C) and the normal pancreas stem / progenitor cells (black arrows in the bottom right and bottom left pictures) included in the tissue section. Cancer cells more than the expression level was used as a strong positive (black arrow in Figure 8a photo). FIG. 8A shows human pancreas with PDAC, two above pano of human pancreas containing duodenum, and two below panC of human pancreas with PDAC.

In FIG. 8A, the area indicated by the blue dotted line, the area indicated by W, includes a region containing weak positive cells, the area represented by N, includes a region containing negative cells, and the region represented by S mainly includes a region including strong positive cells. Indicates.

The number of strong positive cells and weak positive or negative cells as shown in FIG. 8A is shown in Table 4 below and FIG. 8B (STx: Surgical Treatment (surgical resection)).

(p value = 0.0313)

As can be seen in FIGS. 8A, 8B and Table 3, more cases in tumor tissues of patients undergoing chemoradiation therapy (CCRT) prior to surgery include ALDH strong positive cancer cells (black arrows in FIG. 8A) and In other words, even after chemoradiation therapy, CSCs showing ALDH strong expression remain. Therefore, the administration of DSF in PDAC patients can eliminate a large number of ALDH strong positive cancer cells, thereby reducing the dose of other anticancer drugs that are toxic to normal cells.

<110> KOREA ADVANCED INSTITUTE OF SCIENCE AND TECHNOLOGY <120> Diagnosis of a Cancer with Cancer Stem Cell Property and          Composition for Treatment Thereof <130> DPP20114232KR <160> 6 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for shh ligand <400> 1 gcggcaccaa gctggtgaag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for shh ligand <400> 2 ggtgagcagc aggcgctcgc 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for beta-actin <400> 3 catgtacgtt gctatccagg c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for beta-actin <400> 4 ctccttaatg tcacgcacga t 21 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer for ALDH1A1 <400> 5 ctgctggcga caatggagt 19 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for ALDH1A1 <400> 6 cgcaatgttt tgatgcagcc t 21

Claims (14)

delete delete delete delete delete delete delete delete delete A pharmaceutical composition for preventing or treating pancreatic cancer having tumor stem cell characteristics comprising disulfiram as an active ingredient.
The method of claim 10,
A pharmaceutical composition for preventing or treating pancreatic cancer of tumor stem cell characteristics, further comprising an anticancer agent, and for combination treatment with disulfiram and an anticancer agent.
The method of claim 11,
The anticancer agent is at least one member selected from the group consisting of alkylation drugs, anti-metabolites, antibiotics, vinca alkaloid anticancer agents, enzymes, hormones, immunotherapeutic agents, and antagonists for genetic variation,
A pharmaceutical composition for preventing or treating pancreatic cancer having tumor stem cell characteristics.
The method of claim 10,
A pancreatic cancer having tumor stem cell characteristics is a pharmaceutical composition for preventing or treating pancreatic cancer having tumor stem cell characteristics, wherein the ratio of tumor stem cells in the cell group constituting the cancer is 5% or more.
The method of claim 10,
The composition is for oral administration, pharmaceutical composition for the prevention or treatment of pancreatic cancer of tumor stem cell characteristics.

Images