KR101198096B1 - Specific primer for personal identification and paternity testing and uses thereof - Google Patents

Abstract

The present invention includes an oligonucleotide primer set for personal identification or paternity comprising one or more primer sets selected from the primers represented by SEQ ID NOs: 1 to 24, a method for personal identification or paternity using the primer set, and the primer set. It relates to a kit for personal identification or paternity.

Description

Specific primer for personal identification and paternity testing and uses according to personal identification or paternity

The present invention relates to specific primers for personal identification or paternity and their use, more specifically oligos for personal identification or paternity comprising one or more primer sets selected from primers represented by SEQ ID NOS: 1 to 24 It relates to a nucleotide primer set, a personal identification or paternity method using the primer set, and a kit for personal identification or paternity comprising the primer set.

Personal identification and kinship and paternity identification using typing of the STR (Short Tandem Repeat) locus called microsatellite have been commercialized since the 1990s, and autosomal STR is used for personal identification and paternity Is used for paternity check. For autosomal STR loci, since the 10 loci co-amplification kit was developed by Applied Biosystems (US) in the late 1990s, 16 loci co-amplification kits have been released since 2000 (AmpFℓSTR Identifiler, PowerPlex 16 System). . For the Y-STR, 12-16 loci co-amplification kits have been developed by Applied Biosystems and Promega (USA) for the last 4-5 years (AmpFℓSTR Identifiler, PowerPlex Y System).

The application of DNA analysis for personal identification in the field of forensic science is a very generalized method, and the identification of the frequency of match between genotypes analyzed in the case evidence and the subjects involved in the case is used as a legal basis. Markers, called STRs or microsatellites, used to identify concordance in DNA analysis, have the advantage of very high individual identification, and are also analytical in small amounts of DNA (> 0.01 ng) and decayed samples. In human DNA, there are more than millions of STR loci called microsatellites and two to six bases are repeated. Microsatellite, known to have a highly distributed polymorphism in the mammalian genome, is recognized for diversity among individuals according to the number of repeats in a particular locus of DNA (Koreth J, O'Leary JJ and McGee JO (1996)). J Pathol 178: 239-248. When there is a polymorphism between varieties in the number of repeats, a polymerase chain reaction (PCR) is carried out using primers designed in an adjacent region, whereby polymorphisms are observed in the length of the PCR product and DNA polymorphism can be detected. In addition, microsatellite, like other genes, is delivered to a child according to Mendel's genetic law and can be amplified using PCR, and exhibits co-dominant behavior when subjected to electrophoresis. In particular, microsatellite is small in size, which can amplify from two to eight primers simultaneously (Chamberlain JS et al., (1988)Nucleic Acids Res 16: 11141-11156) Analyzing gene polymorphism saves time and money, and results in high sensitivity and accuracy. Therefore, such microsatellite is very useful for personal identification of human, kinship, paternity and forensic science.

Korean Patent No. 10-0443569 discloses a personal identification and paternity identification method using a length polymorphic DNA sequence, and Korean Patent No. 10-0861384 discloses a personal identification method using a polymorphic microsatellite of SLC6A19 gene. It is.

The present invention is derived from the above requirements, the inventors of the present invention devised specific primers for microsatellite loci with high polymorphism and distributed throughout the human chromosome to perform multiplex PCR, and also the existing imports As a result of confirming high discrimination ability, reproducibility and accuracy through a comparative experiment with the product, it was found that the personal identification or paternity can be identified through the analysis of the amplification product and completed the present invention.

Accordingly, it is an object of the present invention to provide a method for human personal identification or paternity characterized in that amplification of multiplex PCR is performed using primers specific for microsatellite markers present on human chromosomes.

In order to solve the above problems, the present invention provides an oligonucleotide primer set for personal identification or paternity comprising one or more primer sets selected from the primers represented by SEQ ID NO: 1 to 24.

In addition, the present invention provides a method of identifying or paternity using the primer set.

In addition, the present invention provides a kit for identifying or paternity comprising the primer set.

According to the present invention, the use of the primer of the present invention in the situation of 100% dependence on the imported product in human genetic identification still enables gene identification with high reproducibility and accuracy. It is expected to be very useful in forensic fields such as cases. In addition, it is expected to reduce costs by replacing expensive imported products.

1 shows the results of electrophoresis by concentration using the primer set of the present invention using 9947A control genomic DNA provided by AmpFlSTR Identifiler PCR amplification Kit from Applied Biosystems (USA).
Figure 2 is one of the verification experiments for establishing the same PCR amplification conditions as the Identifiler product developed by Applied Biosystems (USA), showing the optimization of the temperature that the primer is attached to the target site, that is, annealing (annealing) temperature will be.
Figure 3 is one of verification experiments for establishing the same PCR amplification conditions as Identifiler products developed by Applied Biosystems (USA), showing the optimization of the PCR amplification cycle (cycle).
Figure 4 shows the results of analyzing the DNA collected from the oral cells using a cotton swab to compare the primer set of the present invention with the Identifiler product developed by Applied Biosystems (Applied Biosystems, USA).
FIG. 5 is a DNA collected by applying blood to Gene Collector (Gendax Co., Ltd.), which is a stabilizer-treated product, to compare the primer set of the present invention with an Identifiler product developed by Applied Biosystems (USA). It shows the result of analysis.
Figure 6 shows the results of DNA extraction from the blood analysis to compare the primer set of the present invention with Identifiler product developed by Applied Biosystems (Applied Biosystems, USA).
Figure 7 shows the results of extracting and analyzing DNA from cigarette butts to compare the primer set of the present invention with the Identifiler product developed by Applied Biosystems (Applied Biosystems, USA).

In order to accomplish the object of the present invention, the present invention provides an oligonucleotide comprising at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of fragments of at least 15 consecutive nucleotides in the sequence of SEQ ID NO: 1 and at least 15 oligonucleotides in the sequence of SEQ ID NO: An oligonucleotide primer set comprising at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of fragments of consecutive nucleotides;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 3 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 4 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 5 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 6 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 7 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 8 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. 9 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

One or more oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in SEQ ID NO: 11 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in SEQ ID NO: 12 An oligonucleotide primer set comprising one or more oligonucleotides selected from;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 13 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 14 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

One or more oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of 15 or more consecutive nucleotides in the sequence of SEQ ID NO: 15 and oligonucleotides consisting of fragments of 15 or more consecutive nucleotides in the sequence of SEQ ID NO: 16 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. 17 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 19 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 20 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group;

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 21 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 22 An oligonucleotide primer set comprising one or more oligonucleotides selected from the group; And

One or more oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 23 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 24 Oligonucleotide primer set comprising one or more oligonucleotides selected from the group

One or more oligonucleotide primer sets for personal identification or paternity selected from the group consisting of:

The oligonucleotide may preferably be an oligonucleotide consisting of fragments of at least 16, at least 18, at least 19, at least 20, at least 21 consecutive nucleotides in the sequence of SEQ ID NO: 1. In addition, the oligonucleotide is preferably 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more in the sequence of SEQ ID NO: 2 , Oligonucleotides consisting of at least 25 and at least 26 contiguous nucleotide segments.

In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO.

In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 consecutive nucleotides in the sequence of SEQ ID NO. In addition, the oligonucleotide is preferably an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 consecutive nucleotides in the sequence of SEQ ID NO: 6. Can be.

The oligonucleotide may also be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides within the sequence of SEQ ID NO. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 consecutive nucleotides in the sequence of SEQ ID NO: 8.

In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO.

In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO. The oligonucleotide may also be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides within the sequence of SEQ ID NO.

In addition, the oligonucleotide is preferably an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 consecutive nucleotides in the sequence of SEQ ID NO. Can be. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 consecutive nucleotides in the sequence of SEQ ID NO.

The oligonucleotide may also be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides within the sequence of SEQ ID NO: 15. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO.

In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO.

In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides within the sequence of SEQ ID NO. The oligonucleotide may also be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides within the sequence of SEQ ID NO.

In addition, the oligonucleotide is preferably 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more in the sequence of SEQ ID NO: 21. , Oligonucleotides consisting of at least 25 and at least 26 contiguous nucleotide segments. In addition, the oligonucleotide is preferably a fragment of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 consecutive nucleotides in the sequence of SEQ ID NO: 22. It may be an oligonucleotide consisting of.

In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20 consecutive nucleotides within the sequence of SEQ ID NO. In addition, the oligonucleotide is preferably an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 consecutive nucleotides in the sequence of SEQ ID NO. Can be.

Oligonucleotide primer set according to an embodiment of the present invention is the oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; Oligonucleotide primer sets of SEQ ID NOs: 13 and 14; Oligonucleotide primer sets of SEQ ID NOs: 15 and 16; Oligonucleotide primer sets of SEQ ID NOs: 17 and 18; Oligonucleotide primer sets of SEQ ID NOs: 19 and 20; Oligonucleotide primer sets of SEQ ID NOs: 21 and 22; And one or more oligonucleotide primer sets for personal identification or paternity selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 23 and 24.

Oligonucleotide primer set according to an embodiment of the present invention is the oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; Oligonucleotide primer sets of SEQ ID NOs: 13 and 14; Oligonucleotide primer sets of SEQ ID NOs: 15 and 16; Oligonucleotide primer sets of SEQ ID NOs: 17 and 18; Oligonucleotide primer sets of SEQ ID NOs: 19 and 20; Oligonucleotide primer sets of SEQ ID NOs: 21 and 22; And oligonucleotide primer sets for personal identification or paternity comprising the oligonucleotide primer sets of SEQ ID NOs: 23 and 24. By using 12 primer sets simultaneously, personal identification or paternity can be performed relatively easily and accurately.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primers will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

In order to achieve still another object of the present invention,

Separating genomic DNA from human samples;

Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set according to the present invention as a primer; And

It provides a personal identification or paternity method comprising the step of detecting the amplification product.

The method includes separating genomic DNA from a human sample. As a method for separating genomic DNA from the sample, a method known in the art may be used. Using the isolated genomic DNA as a template, an amplification reaction may be performed using an oligonucleotide primer set according to an embodiment of the present invention as a primer to amplify a target sequence. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, polymerase chain reaction is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. Such polymerase chain reaction methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, amplification of the target sequence may be performed through multiplex PCR. Multiplex PCR refers to a method of performing PCR amplification in one reaction tube at the same time using a plurality of primer sets. After each PCR reaction using each primer set, it is also possible to perform gel electrophoresis by combining PCR products, but it is more preferable to perform multiplex PCR to shorten the PCR time and reaction.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, the polymerase chain reaction is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer so that the target sequence may be labeled with a detectable fluorescent labeling substance. In addition, the label using a radioactive material is added to the polymerase chain reaction solution by adding radioactive isotopes such as ³² P or ³⁵ S to the polymerase chain reaction solution when the polymerase chain reaction is performed, and the amplification product is radioactively incorporated into the amplification product. Can be labeled. The set of oligonucleotide primers used to amplify the target sequence are as described above.

The method of the present invention comprises detecting said amplification product. The detection of the amplification product can be performed by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In the fluorescence measurement method, the target sequence is labeled with a detectable fluorescent labeling substance by performing a polymerase chain reaction by labeling Cy-5 or Cy-3 at the 5'-end of the primer. Can be measured. In addition, the radioactivity measuring method is to add a radioactive isotope such as ³² P or ³⁵ S to the polymerase chain reaction solution to label the amplification product when performing the polymerase chain reaction, and then radioactive measuring apparatus, for example, Geiger counter ( Radioactivity can be measured using a Geiger counter or a liquid scintillation counter.

The personal identification or paternity method of the present invention is characterized by performing multiplex PCR using primers specific for microsatellite markers for polymorphism analysis in humans. Preferably, the microsatellite markers used in the identification or paternity method may be D21S11, CSF1PO, S3S1358, TH01, D13S317, D16S539, vWA, amelogenin, TPOX, D18S51, D5S818 or FGA.

The term "microsatellites" refers to short repeat sequences in the form of mono-, di-, tri- and tetranucleotides distributed throughout the eukaryotes gene. In general, such repeat sequences are present in a tandem repeat of about 10 to 40 times in the chromosome. The "microsatellite marker" refers to a DNA polymorphism detection marker using microsatellite. The term "polymorphism" refers to the diversity of specific DNA structures of organisms of the same species.

In the present invention, the microsatellite locus with high polymorphism, which is distributed throughout the chromosome for effective human identification, was prepared, primers were prepared for the selected locus, and optimal PCR conditions were established (see Examples 2 and 3). Using this, DNA samples of 500 Koreans (see Example 1) were amplified by multiplex PCR, and their allele frequencies were calculated to compare the frequencies of the Korean population with those published in the paper (see Example 4). . In addition, each microsatellite polymorphism index (He, Heterozygosity) and polymorphic information index (PIC, polymorphic Infomation Content) was calculated (see Example 5). As a result, all 11 microsatellites (except sex chromosome microsatellites) selected in the present invention showed high polymorphism and compared with the existing imported and used Applied Biosystems product (AmpFℓSTR Identifiler) and showed high reproducibility. It was found that the accuracy was shown, and furthermore, the microsatellite marker of the present invention was not only able to personally identify a human but also very useful as a product that can replace an imported product.

In order to achieve still another object of the present invention,

Oligonucleotide primer sets according to the present invention; And it provides a kit for identifying or paternity, including a reagent for performing the amplification reaction. In the kit of the present invention, the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffer solution and the like. In addition, the kits of the present invention may further comprise a user guide describing the optimal reaction performance conditions. The guide is a printed document that explains how to use the kit, such as how to prepare a PCR buffer, and the reaction conditions presented. The instructions include brochures in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information that is disclosed or provided through electronic media such as the Internet.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  One: DNA  Sample Preparation

The sample should be large enough to be statistically useful, so we surveyed at least 500 Koreans (300 males and 200 females) who had at least one unrelated relationship. Samples were taken from blood and saliva, and genomic DNA was extracted from them. Blood was collected in a tube treated with EDTA (ethylenediaminetetra acetic acid), and DNA extraction was performed according to the instructions of the Genomic DNA Extraction Kit (Bioneer ^TM ), and DNA extraction from saliva was performed by Gene Collector (Note). ) And dried at room temperature using Gendax) was used in the experiment. First, 4 ~ 5 paper discs were placed in a 1.5 mL tube using a 1 mm diameter puncher, and then 20 μl of solution I (TNEs buffer) and proteinase K (20 mg / μl). Put and mixed. Repeat 20 times at room temperature and repeat twice. Solution 200 (10 mM Tris, 0.1 mM EDTA) was added to 200 μl, and hemoglobin inhibited PCR reaction for 10 minutes and repeated twice at room temperature. 500 μl was added and washed twice, followed by drying for about 20 minutes. The purified DNA is a nucleic acid spectrophotometer NanoDrop? Concentration and purity were confirmed using ND-1000 (NanoDrop Technologies, Inc., USA) and agarose gel.

Example  2: simultaneous amplification Kit  for On microsatellite  About primer  making

In order to select microsatellite markers for effective personal identification of humans, primers were designed in consideration of the size, type of fluorescent dye, and amplification conditions of the human polymorphism analysis satellite proposed by CODIS. Request was made to order. Primer sequences, labeled dyes, size and allele size ranges are shown in Table 1.

Microsatellite for Human Identification location chromosome sign Allele
Size range (bp) Primer sequence D21S11 21 FAM 198-262 F tgggacttttctcagtctccat (SEQ ID NO: 1) R agactggatagatagacgatagataga (SEQ ID NO: 2) CSF1PO 5 FAM 312-366 F tgccaaggactagcaggttg (SEQ ID NO: 3) R ctcttccacacaccactggc (SEQ ID NO: 4) vWA 12 FAM 120-185 F ttgacttggctgagatgtgaaa (SEQ ID NO: 5) R cataggatggatggatagatgga (SEQ ID NO: 6) D3S1358 3 VIC 97-146 F gcagtccaatctgggtgaca (SEQ ID NO: 7) R aaatcaacagaggcttgcatgt (SEQ ID NO: 8) TH01 11 VIC 152-202 F gctctagcagcagctcatgg (SEQ ID NO: 9) R agtgcaggtcacagggaaca (SEQ ID NO: 10) D13S317 13 VIC 210-258 F tgggttgctggacatggtat (SEQ ID NO: 11) R ccttcaacttgggttgagcc (SEQ ID NO: 12) D16S539 16 VIC 269-321 F gggggtctaagagcttgtaaaaa (SEQ ID NO: 13) R ccatttacgtttgtgtgtgcat (SEQ ID NO: 14) Amelogenin X, Y NED 105, 111 F agtgkgtkgattcttcatcc (SEQ ID NO: 15) R acacaggcttgaggccaacc (SEQ ID NO: 16) TPOX 2 NED 225-270 F agatcgtaagcccaggagga (SEQ ID NO: 17) R caggtccaatcccaggtctt (SEQ ID NO: 18) D18S51 18 NED 284-375 F cagctacttgcagggctgag (SEQ ID NO: 19) R gcctaaggtggacatgttgg (SEQ ID NO: 20) D5S818 5 PET 119-170 F tttggtatccttatgtaatattttgaa (SEQ ID NO: 21) R tccaatcatagccacagtttacaa (SEQ ID NO: 22) FGA 4 PET 190-348 F aaatgccccataggttttgaa (SEQ ID NO: 23) R tggttattgaagtagctgctgag (SEQ ID NO: 24)

Example  3: multiplex PCR

Using the DNA sample of Example 1 as a template and using the primers prepared in Example 2, an optimal combination was experimented to determine the most suitable temperature and cycle for multiplex PCR (FIGS. 2 and 3). Carried out under conditions.

Distilled water was added to the composition of 20ng / μl of template DNA, 30pmol of each primer set, Taq DNA polymerase 2.5 unit (Gendax Co., Ltd.), 10 × buffer solution, 1.8μl and 10 mM dNTP so that the final volume was 15μl. , PCR conditions were treated for 11 minutes at 94 ℃, it was repeated 28 times 60 seconds at 95 ℃, 60 seconds at 59 ℃, 60 seconds at 72 ℃ as a cycle (cycle). And it finished at 4 degreeC after 1 hour extension at 60 degreeC. PCR products were subjected to electrophoresis to be classified by size using ABI-3130XL automatic base sequence analysis device (Applied Biosystems, USA), and then classified by size and type of marker using GeneMapper 3.7 (Applied Biosystems, USA). The data were collected using a soft Excel program (Microsoft Excel, Microsoft, USA).

Example  4: Microsatellite primer  Effectiveness test by concentration using set

Using the multiplex PCR method of Example 3, the control genomic DNA (9947A) in Applied Biosystems (AmpFlSTR Identifiler) was tested by concentration to set the most effective genomic DNA. As a result, about 2.5 ng / μl of control genomic DNA (9947A) in Applied Biosystems, Inc. (AmpFlSTR Identifiler) was shown as the minimum concentration in the use of gene identification (FIG. 1).

Example  5: Microsatellite primer  Field sample using set Verification test

Using the multiplex PCR method of Example 3 was carried out verification experiments with the Applied Biosystems (AmpFℓSTR Identifiler) with a sample that is actually used in the field (Figs. 4, 5, 6 and 7). DNA extracted from oral cells using cotton swabs, blood DNA extracted from Gene Collector Co., Ltd., a stabilized product, DNA extracted directly from blood, and DNA extracted from cigarette butts showed the same results as the comparative products. I could confirm it.

Example  6: Microsatellite  Allele frequency comparison

Each microsatellite allele frequency was calculated from the results of Example 2, and compared with the published paper (Y. L Kim et al., (2003) Forensic Science International 136: 92-95), which investigated the Korean population. It was.

Five to fourteen different alleles were observed in each marker, and the frequency of most markers was similar.

Example  7: Microsatellite  Polymorphism index

From the results of Example 3, the heterozygosity (He, Heterozygosity) and polymorphic information index (PIC), which are the microsatellite polymorphism indexes, were calculated using Cervus version 2.0 (Marshall et al (1998) Mol . Ecol 7:. 639-655). As a result, the polymorphism index of each microsatellite is as shown in Table 5.

Polymorphism Index of Microsatellite location N Allele number Size range (bp) He PIC D21S11 85 11 198-262 0.835 0.746 CSF1PO 85 6 312-366 0.788 0.686 D3S1358 85 6 97-146 0.788 0.680 TH01 85 5 152-202 0.765 0.632 D13S317 85 7 210-258 0.753 0.752 D16S539 85 6 269-321 0.718 0.733 vWA 85 7 145-210 0.488 0.749 TPOX 85 5 225-270 0.682 0.589 D18S51 85 14 284-375 0.871 0.831 D5S818 85 7 119-170 0.800 0.748 FGA 85 12 190-348 0.800 0.825

The usefulness of microsatellite as indicators of paternity, etc., was compared by measuring the exclusion power calculated according to the method of Jamieson et al. (1996). Exclusion is used as an indicator to indicate the degree of discrimination ability of markers used in paternity discrimination when randomly selected from the entire population, which does not have the same allele among the individuals to be compared.

As a result, exclusion 1 is the probability of not knowing both parent and parent, and exclusion 2 is applied if one of the parents knows. The exclusion force showed a value of 0.5 or higher for all markers except CSF1PO, D3S1358, TH01 and TPOX. In addition, all the markers were 0.99 or more.

Microsatellite Exclusion Index location Exclusion 1 Exclusion 2 D21S11 0.405 0.584 CSF1PO 0.321 0.496 D3S1358 0.314 0.487 TH01 0.265 0.436 D13S317 0.400 0.579 D16S539 0.374 0.553 vWA 0.397 0.575 TPOX 0.229 0.383 D18S51 0.535 0.699 D5S818 0.394 0.572 FGA 0.523 0.690 All 0.9956 0.9999

Attach an electronic file to a sequence list

Claims (8)

delete delete Oligonucleotide primer sets of SEQ ID NOs: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; Oligonucleotide primer sets of SEQ ID NOs: 13 and 14; Oligonucleotide primer sets of SEQ ID NOs: 15 and 16; Oligonucleotide primer sets of SEQ ID NOs: 17 and 18; Oligonucleotide primer sets of SEQ ID NOs: 19 and 20; Oligonucleotide primer sets of SEQ ID NOs: 21 and 22; And an oligonucleotide primer set for personal identification or paternity comprising the oligonucleotide primer sets of SEQ ID NOs: 23 and 24. Separating genomic DNA from human samples;
Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set according to claim 3 as a primer; And
Detecting the amplification product, personal identification or paternity method. The method of claim 4, wherein the amplification reaction is performed using multiplex PCR. The method of claim 4, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. An oligonucleotide primer set according to claim 3; And a reagent for performing an amplification reaction. 8. The kit of claim 7, wherein the reagent for performing the amplification reaction comprises DNA polymerase, dNTPs, and a buffer solution.

Images