KR101194795B1 - Lactic acid bacterium separated from kimchii and uses thereof - Google Patents

Lactic acid bacterium separated from kimchii and uses thereof Download PDF

Info

Publication number
KR101194795B1
KR101194795B1 KR1020110055349A KR20110055349A KR101194795B1 KR 101194795 B1 KR101194795 B1 KR 101194795B1 KR 1020110055349 A KR1020110055349 A KR 1020110055349A KR 20110055349 A KR20110055349 A KR 20110055349A KR 101194795 B1 KR101194795 B1 KR 101194795B1
Authority
KR
South Korea
Prior art keywords
strain
pediococcus
pentosakeus
lactic acid
culture
Prior art date
Application number
KR1020110055349A
Other languages
Korean (ko)
Inventor
김인철
고강희
Original Assignee
목포대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 목포대학교산학협력단 filed Critical 목포대학교산학협력단
Priority to KR1020110055349A priority Critical patent/KR101194795B1/en
Application granted granted Critical
Publication of KR101194795B1 publication Critical patent/KR101194795B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Microbiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

PURPOSE: A Pediococcus pentosaceus strain isolated from Kimchi is provided to ensure high antibacterial activity and to be used in various industrial field. CONSTITUTION: A Pediococcus pentosaceus KFCC 11504P is isolated from Kimchi and has an antibacterial effect against Salmonella typhymurium, Micrococcus leteus, Bacillus subtilis, Bacillus cereus, Vibrio parahaemoliticus, and Escherichia coli. The strain also has acid resistance and bile acid resistance. An antibacterial composition contains the strain, culture liquid thereof, concentrate of the culture liquid, or dry material of the culture liquid as an active ingredient.

Description

김치로부터 분리된 유산균 및 그의 용도{LACTIC ACID BACTERIUM SEPARATED FROM KIMCHII AND USES THEREOF}Lactobacillus isolated from Kimchi and its use {LACTIC ACID BACTERIUM SEPARATED FROM KIMCHII AND USES THEREOF}

본 발명은 위해 미생물에 대한 항균 활성을 가지며, 산성 환경 및 장내 환경에서 생존 가능한 균주 및 상기 균주를 이용한 생균활성제(probiotics)에 관한 것이다.The present invention relates to a strain having antimicrobial activity against harmful microorganisms and viable in an acidic and intestinal environment and probiotics using the strain.

유산균은 당류를 발효해서 50% 이상 젖산을 생성하는 세균으로, 인간이 이용할 수 있는 가장 유익한 미생물이다. 음식물뿐만 아니라 포유동물의 구강과 소화관, 토양 등 자연계에 널리 분포하고 있으며, 식품의 보존과 관능적 특성과 관련된 중요한 역할 등을 수행하는 인간생활에 유익한 균주이다. 전 세계적으로 오랜 기간에 걸쳐 유산균 함유 발효 식품으로 널리 식품으로 사용된 유산균은 최근에 GRAS(Generally Recognized As Safe) 미생물로 안정성을 인정받고 있다.Lactic acid bacteria are bacteria that ferment sugars to produce more than 50% lactic acid, which is the most beneficial microorganism available to humans. It is widely distributed in the natural world such as the oral cavity, digestive tract, and soil of mammals as well as food, and it is a beneficial strain for human life that plays an important role related to food preservation and sensory characteristics. Lactic acid bacteria, widely used as foods as fermented foods containing lactic acid bacteria for a long time, have recently been recognized as stability as GRAS (Generally Recognized As Safe) microorganisms.

이러한 유산균의 안정성 및 유산균이 건강에 좋다는 인식을 기초로 하여 유산균 함유 식품을 통하여 건강을 유지하고, 질병을 예방하려는 노력이 증대되었으며, 최근 유산균을 기능성 식품에 사용하기 위하여 잠재력을 평가하기 위한 프로바이오틱 유산균에 대한 연구가 전 세계적으로 광범위하게 진행되고 있다.Based on the stability of lactic acid bacteria and the recognition that lactic acid bacteria are good for health, efforts to maintain health and prevent diseases have been increased through foods containing lactic acid bacteria. Recently, probiotics for evaluating the potential for use of lactic acid bacteria in functional foods have been increased. The research on tick lactic acid bacteria is extensively carried out worldwide.

프로바이오틱 유산균은 유래 및 이용에 대한 안정성이 인정될 뿐만 아니라 위장관 상부의 산성 조건 및 담즙 존재 하에서도 존재하여야 하고, 대장에서 부착이 가능해야 하며, 균주 안정성이나 생존력이 뛰어나야 한다. 현재 상기 요구 조건을 만족하는 프로바이오틱 유산균은 락토바실러스 속 균주(Lactobacillus sp.)와 비피도박테리움 균주(Bifidobacterium sp.)가 대부분이다.Probiotic lactic acid bacteria should not only be recognized for their stability in origin and use, but also under acidic conditions in the upper gastrointestinal tract and in the presence of bile, should be able to adhere to the large intestine, and should have excellent strain stability or viability. Currently, probiotic lactic acid bacteria satisfying the above requirements are mostly Lactobacillus sp. ( Lactobacillus sp.) And Bifidobacterium strains ( Bifidobacterium sp.).

한편, 김치는 특별한 지식 없이도 가정에서 누구나 전래의 보편적인 방법으로 제조 가능한 식품으로, 보다 구체적으로는 삼국시대부터 발달한 한국의 대표적 전통발효식품으로 소금물에 절인 배추나 무 등의 채소류에 고춧가루, 파, 마늘 등의 양념류를 혼합하여 생활환경 주변에 존재하는 미생들에 의한 발효과정을 거쳐 숙성되는 대표적인 한국의 발효식품 중 하나이다.On the other hand, Kimchi is a food that can be manufactured by anyone at home without any special knowledge. More specifically, Kimchi is Korea's representative traditional fermented food that has been developed since the Three Kingdoms period. It is one of the representative Korean fermented foods that are aged through the fermentation process by microorganisms that exist around the living environment by mixing spices such as garlic and garlic.

최근에는 김치의 유용성에 관한 연구가 다수 발표되었으며, 일 예로 면역활성 증진 및 항암효과 등의 생리활성 기능이 밝혀지면서 영양공급 외에도 건강유지에 꼭 필요한 식품으로 인식되고 있고, 신선한 야채를 열처리하지 않고 담그기 때문에 야채의 모든 영양소가 유지되어 유산균에게 좋은 서식환경을 제공할 수 있으므로 유산균의 함유량이 발효유제품에 비하여 놓은 것으로 보고되어 있다.Recently, a number of studies on the usefulness of kimchi have been published. For example, as physiological activities such as immune activity enhancement and anti-cancer effects have been revealed, it is recognized as a food necessary for maintaining health as well as nutrient supply, and soaking fresh vegetables without heat treatment. Therefore, it is reported that the content of lactic acid bacteria is higher than that of fermented milk products because all nutrients of vegetables are maintained to provide a good habitat for lactic acid bacteria.

상기 유산균에 대한 연구는 주로 유제품에 대해서 진행되어 왔으며, 오랜 역사에 비해 김치발효과정에 관여하는 유산균에 대해서는 최근에서야 체계적이고 과학적인 연구가 진행되고 있다.The research on the lactic acid bacteria has been mainly conducted for dairy products, and the systematic and scientific researches on lactic acid bacteria involved in kimchi foot effect tablets have been conducted recently compared to the long history.

따라서, 우리의 전통 발효음식인 김치발효과정에 관여하는 유산균 중에서 프로바이오틱 유산균 또는 위해 미생물에 대한 항균작용을 할 수 있는 유산균에 대한 연구의 필요성이 대두되고 있다.Therefore, the necessity of research on lactic acid bacteria that can act as antimicrobial against probiotic lactic acid bacteria or harmful microorganisms among kimchi bal effect tablet which is our traditional fermented food has emerged.

본 발명은 김치로부터 분리되고 위해 미생물에 대한 항균활성을 가지며, 프로바이오틱 유산균이 되기 위하여 내산성 및 내담즙성이 인정되고, 장내부착능이 우수한 균주를 제공하는 것을 목적으로 한다.An object of the present invention is to provide a strain that is isolated from kimchi, has antimicrobial activity against harmful microorganisms, has acid resistance and bile resistance, and has excellent intestinal adhesion ability to become a probiotic lactic acid bacterium.

또한 본 발명은 상기 균주, 이의 배양액, 상기 배양액의 농축액 및 상기 배양액의 건조물로 이루어지는 군에서 선택된 하나 이상을 활성성분으로 포함하는 항균조성물을 제공하는 것을 목적으로 한다.In addition, an object of the present invention is to provide an antimicrobial composition comprising at least one selected from the group consisting of the strain, its culture, the concentrate of the culture and the dried product of the culture as an active ingredient.

또한 본 발명은 상기 균주, 이의 배양액, 상기 배양액의 농축액 및 상기 배양액의 건조물로 이루어지는 군에서 선택된 하나 이상을 활성성분으로 포함하는 생균활성제(probiotics)를 제공하는 것을 목적으로 한다.In addition, an object of the present invention is to provide a probiotic (probiotics) comprising at least one selected from the group consisting of the strain, its culture, the concentrate of the culture and the dried product of the culture as an active ingredient.

상기 목적을 달성하기 위하여, 본 발명은 김치로부터 분리되고 위해 미생물에 대한 항균활성을 가진 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus)를 제공한다. 바람직하게는 상기 위해 미생물은 살모넬라 티피뮤리움 균주(Salmonella typhymurium), 마이크로코커스 류테우스 균주(Micrococcus leteus), 바실러스 서브틸리스 균주(Bacillus subtilis), 바실러스 세레우스 균주(Bacillus cereus), 비브리오 파라헤몰리티쿠스 균주(Vibrio parahaemoliticus) 및 대장균(Escherichia coli)에 대한 항균 활성을 갖는 균주일 수 있다.In order to achieve the above object, the present invention provides a Pediococcus pentosaceus strain ( Pediococcus pentosaceus ) which is isolated from kimchi and has antimicrobial activity against harmful microorganisms. Preferably the harmful microorganism is Salmonella typhimurium strain ( Salmonella typhymurium), the micro flow Proteus strains Rhodococcus (Micrococcus leteus), Bacillus subtilis strain (Bacillus subtilis), Bacillus cereus strains (Bacillus cereus), Vibrio para Molly Tee hee Syracuse strain (Vibrio parahaemoliticus ) and Escherichia coli ) may be a strain having antimicrobial activity.

또한, 본 발명은 상기 균주, 이의 배양액 상기 배양액의 농축액 및 상기 배양액의 건조물로 이루어지는 군에서 선택된 하나 이상을 활성성분으로 포함하는 항균조성물을 제공하는 것을 목적으로 한다.In addition, an object of the present invention is to provide an antimicrobial composition comprising at least one selected from the group consisting of the strain, the culture solution of the culture solution and the dried product of the culture solution as an active ingredient.

또한, 본 발명은 상기 균주, 이의 배양액 상기 배양액의 농축액 및 상기 배양액의 건조물로 이루어지는 군에서 선택된 하나 이상을 활성성분으로 포함하는 생균활성제(probiotics)를 제공하는 것을 목적으로 한다.In addition, an object of the present invention is to provide a probiotics (probiotics) comprising at least one selected from the group consisting of the strain, its culture broth concentrate of the culture broth and the dried product of the culture broth as an active ingredient.

본 발명에 있어서, 배양물이란 특정 미생물을 배양배지 또는 배양액에서 배양한 것을 의미하며, 상기 배양물은 상기 특정 미생물을 포함하는 것일 수 있다. 상기 배양물은 그 제형이 한정되지 아니하고, 일 예로 액체 또는 고체일 수 있다. 이러한 측면에서, 배양액이란 액체배지에 특정 미생물을 접종하여 배양한 것을 의미한다. 또한, 본 발명에 있어서, 배양액의 농축액이란 상기 배양액을 농축한 것을 말하고, 배양액의 건조물이란 상기 배양액의 물기를 없앤 것 또는 제거한 것을 의미한다.In the present invention, the culture means that a specific microorganism is cultured in a culture medium or a culture medium, and the culture may include the specific microorganism. The culture is not limited in its formulation, and may be, for example, liquid or solid. In this aspect, the culture means the culture by inoculating a specific microorganism in a liquid medium. In addition, in this invention, the concentrated liquid of a culture liquid means the thing which concentrated the said culture liquid, and the dry matter of a culture liquid means that the water of the said culture liquid was removed or removed.

상기 배양배지란 동물세포나 식물세포 또는 세균 따위를 기르는 데 필요한 영양소가 들어 있는 고체 또는 액체를 의미한다. 상기 배지는 배양대상 즉, 배양체가 되는 미생물이나 세포가 필요로 하는 영양물질을 포함하는 것으로, 특수한 목적을 위한 물질이 추가로 첨가되어 혼합된 것일 수 있다. 상기 배지는 배양기 또는 배양액이라고도 불리우며, 천연배지, 합성배지 또는 선택배지를 모두 포함하는 개념이다.The culture medium means a solid or liquid containing nutrients necessary for growing animal cells, plant cells, or bacteria. The medium includes nutrients required by the microorganisms or cells to be cultured, that is, the culture, and may be added and mixed with a substance for a special purpose. The medium is also called an incubator or a culture medium, and is a concept that includes both natural medium, synthetic medium or selective medium.

본 발명에 있어서, 항균 조성물이란 항미생물제를 총칭하는 의미일 수 있고, 항균제, 방부제, 생물학적 보존제 또는 천연 보존제와 같은 의미일 수 있으며, 구체적으로 그람양성균, 그람음성균, 진균(효모 및 곰팡이)으로 이루어진 군에서 선택된 1 종 이상의 발육과 생활 기능을 저지 또는 억제할 수 있는 물질 즉, 항세균 및/또는 항진균 효력이 있는 물질을 의미한다.In the present invention, the antimicrobial composition may mean an antimicrobial agent generically, and may mean the same as an antimicrobial agent, an antiseptic agent, a biological preservative or a natural preservative, and specifically, it is composed of Gram-positive bacteria, Gram-negative bacteria, and fungi (yeast and mold). It means a substance capable of inhibiting or inhibiting one or more developmental and life functions selected from the group, that is, an antibacterial and / or antifungal substance.

본 발명에 있어서, 생균활성제란 사람과 가축의 장내 미생물 균총의 개선으로 건강에 유익한 효능을 갖는 생균제재를 의미한다. 미생물이 생균활성제로 기능하기 위해서는, 위장을 통과하는 과정에도 일정 균수가 생존하여야 하므로, 내산성 및 내담즙성이 있어야 하고, 장내 생존력이 좋아 섭취 후 일정기간 그 활성이 유지될 수 있어야 한다.In the present invention, the probiotic means a probiotic having a beneficial effect on health by improving the intestinal microflora of humans and livestock. In order for the microorganism to function as a probiotic, certain bacteria must survive the passage through the stomach, and therefore, should be acid and bile resistant, and the intestinal viability should be good to maintain its activity for a certain period after ingestion.

본 발명의 발명자는 기존 외국에서 동정된 유산균이 아닌 우리 유산균 특히, 우리나라의 대표적인 전통 발효식품인 김치로부터 생균활성제로 사용가능한 프로바이오틱 유산균을 동정하기 위하여 연구하던 중, 기존 우리나라에서 생균활성제로 보편적으로 사용되는 락토바실러스 람노서스 GG(Lactobacillus rhamnosus GG)와 비교하여, 내산성 및 내담즙성이 더 우수할 뿐만 아니라, 장내 부착능도 우수하고, 다양한 위해 미생물에 대한 항균 활성이 있으며, 락토바실러스 람노서스 GG와 대등한 면역활성 증진효과가 있는 균주인 F142-811을 분리하였고, 상기 균주를 동정하여 GRAS(Genrally regarded as safe) 미생물인 유산균에 속하는 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus)임을 확인하여 본 발명을 완성하였다.The inventor of the present invention, while studying to identify probiotic lactic acid bacteria that can be used as a probiotic activator from our conventional lactic acid bacteria, especially kimchi, which is a representative traditional fermented food in Korea, the conventional biocide in Korea Lactobacillus Lactobacillus Compared to rhamnosus GG), not only has better acid and bile resistance, but also has good intestinal adhesion, antimicrobial activity against various harmful microorganisms, and comparable immune activity enhancement effect with Lactobacillus rhamnosus GG. F142-811 were separated strain, and identified the strain GRAS (Genrally regarded as safe) Phedi O Lactococcus pento sake mouse strain (microorganism belonging to the lactic acid bacteria Pediococcus pentosaceus ) to complete the present invention.

이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 김치로부터 분리되고 위해 미생물에 대한 항균활성이 있는 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus), 보다 구체적으로는 페디오코커스 펜토사케우스 균주 F142-811(Pediococcus pentosaceus F142-811)에 관한 것이다.The present invention is isolated from kimchi and Pediococcus pentosakeus strain having an antimicrobial activity against harmful microorganisms ( Pediococcus pentosaceus ), more specifically Pediococcus pentosakeus strain F142-811 ( Pediococcus pentosaceus F142-811).

본 발명의 페디오코커스 펜토사케우스 균주 F142-811은 김치, 구체적으로 열무김치로부터 분리되었고, 식품 부패나 식중독 등과 관련된 위해 미생물에 대한 항균활성이 있으며, 하기와 같은 균학적 성질을 갖는 균주이다.Pediococcus pentosakeus strain F142-811 of the present invention has been isolated from kimchi, specifically, radish kimchi, has an antimicrobial activity against harmful microorganisms associated with food spoilage or food poisoning, and is a strain having the following microbial properties.

구체적으로, 상기 열무김치로부터 분리된 F142-811 균주는 그람 양성(Gram-positive)의 구균으로, 투명한 우유 색의 원형 콜로니를 형성하는 것으로 확인되었고, 용혈시험(Hemolysis)을 거친 결과 음성이고, LBS 배지에서 생육이 가능한 것으로 확인되었다. 또한, D-자일로스(D-Xylose), 수크로스(Sucrose), 트레할로스(Trehalose), 젠티오비오스(Gentiobiose) 및 D-타가토스(D-Tagatose) 등의 당을 이용하여 생육할 수 있는 즉, 당대사능이 있고, 락토스(lactose)는 이용하지 못하는 것으로 확인되었다.Specifically, the F142-811 strain isolated from the heat radish kimchi was identified as Gram-positive cocci, forming a circular milky-colored colony, and was negative as a result of a hemolysis test. It was confirmed that growth was possible in the medium. In addition, it can be grown using sugars, such as D-Xylose, Sucrose, Sucrose, Trehalose, Gentiobiose and D-Tagatose. It has been confirmed that there is a major action, lactose (lactose) is not available.

또한, 상기 F142-811 균주는 16S rDNA 염기서열 분석결과, 서열번호 3에 나타낸 바와 같이 총 1452 bp의 16S rDNA을 가지고, 상기 16S rDNA의 염기서열은 Pediococcus pentosaceus DSM20336T(AJ305321)와 99%의 서열상동성을 나타내여, 최종적으로 페디오코커스 펜토사케우스로 동정되어, 페디오코커스 펜토사케우스 균주 F142-811로 명명되었다.In addition, the F142-811 strain has a total of 1452 bp of 16S rDNA as shown in SEQ ID NO: 3, and the base sequence of the 16S rDNA is 99% sequenced with Pediococcus pentosaceus DSM20336T (AJ305321). It showed the same sex, finally identified as Pediococcus pentosakeus and named Pediococcus pentosakeus strain F142-811.

상기 페디오코커스 펜토사케우스 균주 F142-811(Pediococcus pentosaceus F142-811)은 대한민국 서울특별시 서대문구 홍제1동 361-221번지 유림빌딩 2층에 위치한 한국미생물보존센터에 2011년 2월 14일자로 기탁하여, 수탁번호 KFCC 11504P를 부여 받았다. Pediococcus pentosakeus strain F142-811 ( Pediococcus pentosaceus F142-811) was deposited on February 14, 2011 at the Korea Microorganism Conservation Center located on the 2nd floor of Yurim Building, 361-221, Hongje 1-dong, Seodaemun-gu, Seoul, Korea, and was given accession number KFCC 11504P.

상기 페디오코커스 펜토사케우스 균주는 바람직하게는 페디오코커스 펜토사케우스 균주 F142-811, 더욱 바람직하게는 김치로부터 분리되고 위해미생물에 대해 항균활성이 있으며, 기탁번호 KFCC 11504P를 갖는 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus KFCC 11504P)일 수 있다.The Pediococcus pentosakeus strain is preferably isolated from Pediococcus pentosakeus strain F142-811, more preferably kimchi and has antimicrobial activity against harmful microorganisms, Pediococcus pento with accession number KFCC 11504P Sakeus strain ( Pediococcus pentosaceu s KFCC 11504P).

상기 페디오코커스 펜토사케우스 균주 F142-811은 우수한 내산성 및 내담즙성을 가지고, 장내부착능도 우수하여, 생균활성제 또는 프로바이오틱 유산균(probiotics)으로 요구되는 사항을 만족하는 것으로 확인되었다.The Pediococcus pentosakeus strain F142-811 has excellent acid resistance and bile resistance, and is also excellent in intestinal adhesion, it was confirmed that satisfies the requirements of probiotics or probiotic lactic acid (probiotics).

구체적으로, 상기 페디오코커스 펜토사케우스 균주 F142-811은 산성환경인 pH 2.0으로 조정한 MRS 액체배지 및 소의 담즙액(oxgall)을 0.5% 함유시킨 MRS 액체배지를 이용하여 실험한 결과, 기존에 우수한 생균활성제로 보고되어 상업적으로 이용되고 있는 락토바실러스 람노서스 GG(Lactobacillus rhamnosus GG) 보다 우수하거나 대등한 내산성 및 내담즙성을 가지는 것으로 확인되었다.Specifically, the Pediococcus pentosakeus strain F142-811 was tested using an MRS liquid medium adjusted to pH 2.0, which is an acidic environment, and an MRS liquid medium containing 0.5% of bovine oxgall. Lactobacillus Lactobacillus , which has been reported to be an excellent probiotic and commercially available. rhamnosus GG) was found to have better or comparable acid and bile resistance.

또한, 상기 페디오코커스 펜토사케우스 균주 F142-811은 Caco-2 세포주, HT-29 세포주 및 galactose를 이용해 소장의 점액조성으로 유도된 galHT 세포주(galactose-induced HT-29 cell line)을 이용하여 장내부착능을 시험한 결과, 락토바실러스 람노서스 GG 보다 뛰어난 장내부착능을 갖는 것으로 확인되었다. 보다 구체적으로, Caco-2 세포주를 이용하여 실험한 결과, 상기 페디오코커스 펜토사케우스 균주 F142-811은 락토바실러스 람노서스 GG 보다 1.5배 우수한 부착율을 갖는 것으로 확인되었고, galHT 세포주를 이용한 경우에는 약 3.4배, HT-29 세포주를 이용한 경우 약 7.8배 정도 더 우수한 부착율을 갖는 것으로 확인되어, 실제로 상기 페디오코커스 펜토사케우스 균주 F142-811이 장내에 섭취된 경우, 소장 및 대장의 점액층에서 더 높은 부착가능성을 가지어, 생균활성제로 우수하게 활용될 수 있을 것으로 예상되었다.In addition, the Pediococcus pentosakeus strain F142-811 is a gut using a galHT cell line (galactose-induced HT-29 cell line) induced by the mucosa of the small intestine using a Caco-2 cell line, a HT-29 cell line and a galactose. As a result of testing the adhesion ability, it was confirmed that it has an intestinal adhesion ability superior to Lactobacillus rhamnosus GG. More specifically, using a Caco-2 cell line, the Pediococcus pentosakeus strain F142-811 was found to have an adhesion rate 1.5 times better than that of Lactobacillus rhamnosus GG. It was confirmed that the adhesion rate was about 7.8 times better when using the HT-29 cell line and about 3.4 times, and in fact, when the Pediococcus pentosakeus strain F142-811 was ingested in the intestine, the mucous layer of the small and large intestine It was expected that with higher adhesion, it could be well utilized as a probiotic.

또한, 상기 페디오코커스 펜토사케우스 균주 F142-811은 위해 미생물에 대한 항균 활성을 갖는다. 상기 위해 미생물은 식품과 관련하여 식품을 오염하여 부패의 원인이 되고, 식중독 등의 원인이 되는 미생물인 식품 오염 미생물 또는 식중독 원인균일 수 있고, 상기 식품 오염 미생물로 크게 바실러스 속(Bacillus sp.), 마이크로코커스 속(Micrococcus sp.), 슈도모나스 속(Pseudomonas sp.) 등이 있으며, 장염이나 식중독의 원인이 되는 상기 식중독 원인균은 살모넬라 속(Salmonella sp.), 비브리오 속(Vibrio sp.), 대장균(Escherichia coli) 등이 있다. 이 중, 마이크로코커스 속 균주는 그람 양성의 구균으로, 단백질 분해력이 강하고, 어패류, 유제품이나 면류의 식품의 오염의 원인으로 지목되며, 상기 마이크로코커스 류테우스 균주(Micrococcus leteus)는 가장 많이 발견되는 종으로 피부에서 분리되는 피부 상재균이다. 상기 살모넬라 속 균주는 식중독 등을 일으키는 위해미생물로, 특히 상기 살모넬라 티피뮤리움 균주(Salmonella typhymurium)는 장티푸스의 원인균으로 알려져 있다.In addition, the Pediococcus pentosakeus strain F142-811 has antimicrobial activity against harmful microorganisms. The harmful microorganisms may be a food contaminating microorganism or a food poisoning causative bacterium, which is a microorganism causing contamination by contaminating the food with respect to the food, and causing food poisoning, and the bacterium of Bacillus as the food contaminating microorganism. sp.), Micrococcus sp.), Pseudomonas sp.), and the food poisoning agent that causes enteritis or food poisoning is Salmonella genus ( Salmonella). sp.), Vibrio sp.), Escherichia coli ). Among them, strains of the genus Micrococcus are Gram-positive cocci, and have a high proteolytic ability, and are pointed to cause contamination of foods of seafood, dairy products or noodles, and the micrococcus luteus strain ( Micrococcus). leteus ) is the most common species and is a skin flora that is isolated from the skin. The strain of the genus Salmonella is a harmful microorganism causing food poisoning, in particular the Salmonella typhimurium strain ( Salmonella typhymurium ) is known as the causative agent of typhoid fever.

상기 페디오코커스 펜토사케우스 균주 F142-811은 바람직하게는 살모넬라 티피뮤리움 균주(Salmonella typhymurium), 마이크로코커스 류테우스 균주(Micrococcus leteus), 바실러스 서브틸리스 균주(Bacillus subtilis), 바실러스 세레우스 균주(Bacillus cereus), 비브리오 파라헤몰리티쿠스 균주(Vibrio parahaemoliticus) 및 대장균(Escherichia coli)에 대한 항균활성을 가지는 것일 수 있다.The Phedi O Lactococcus pento sake F142-811 mouse strain is preferably the strain Salmonella typhimurium (Salmonella typhymurium ), Micrococcus strain leteus ), Bacillus subtilis strains ( Bacillus subtilis), Bacillus cereus strains (Bacillus cereus ), Vibrio parahaemoliticus strains and Escherichia coli ) may have an antimicrobial activity.

또한, 상기 페디오코커스 펜토사케우스 균주 F142-811은 면역 증강 활성 또는 면역 개선 활성을 가지며, 구체적으로 면역세포로부터 사이토카인(cytokine) 중 IL-1β 및 IL-12의 분비를 촉진하고, NO 생성을 촉진하는 것으로 확인되었다.In addition, the Pediococcus pentosakeus strain F142-811 has immune enhancing activity or immune improving activity, specifically promotes the secretion of IL-1β and IL-12 in cytokines (cytokine) from immune cells, and produces NO. It has been confirmed to promote.

본 발명에 있어서, 사이토카인이란 면역세포 또는 백혈구가 자극에 의하여 분비되는 미량의 생물활성물질로, 면역세포, 백혈구, 조혈세포, 혈관구성세포, 신경세포 및 내분비세포 등 다양한 세포들에 작용하여 면역 반응 등의 다양한 반응을 유도하는 물질을 의미한다.In the present invention, the cytokine is a trace bioactive substance in which immune cells or leukocytes are secreted by stimulation, and acts on various cells such as immune cells, leukocytes, hematopoietic cells, angiogenesis cells, neurons and endocrine cells Means a substance that induces various reactions, such as a reaction.

일 예로, IL-12는 TH1(T helper cell type 1) 및 TH2(T helper cell type 2)의 면역조절기작에 대한 스위치 역할을 하는 사이토카인이다. 구체적으로, 염증반응을 유도하는 TH1 면역반응과 관련하여, 병원성 미생물이 감염되는 경우 등에 자연사멸세포를 활성화하여, 자연사멸세포에 의한 면역작용을 유도하거나 세포독성 T 세포를 활성화시킨다. 또한, IL-12는 알레르기를 일으키는 TH2 면역반응과 관련하여, 항알레르기 작용을 수행하며, 구체적으로 IL-4의 분비량을 감소시켜, 면역세포들이 분비하는 과도한 량의 IL-4 또는 IFN-gamma에 따른 알레르기 반응을 염증반응을 유도하는 Th1 면역반응으로 전환시킬 수 있다.For example, IL-12 is a cytokine that acts as a switch for immunomodulatory mechanisms of T helper cell type 1 (TH1) and TH helper cell type 2 (TH2). Specifically, in relation to the TH1 immune response, which induces an inflammatory response, natural apoptosis cells are activated when a pathogenic microorganism is infected, thereby inducing immune action by natural apoptosis cells or activating cytotoxic T cells. In addition, IL-12 performs an antiallergic effect in relation to the allergic TH2 immune response and specifically decreases the amount of IL-4 secreted by the excess amount of IL-4 or IFN-gamma secreted by immune cells. The allergic response can be converted into a Th1 immune response that induces an inflammatory response.

상기 확인된 사실은 상기 페디오코커스 펜토사케우스 균주 F142-811은 IL-4의 분비량을 감소시키는 IL-12의 분비를 촉진시켜 항 알레르기는 작용을 하고, 대식세포의 식균작용을 활성화시키며, cytotoxic T 세포의 면역작용을 활성화시켜 항암 작용을 수행하고, 위해 미생물에 감염되는 경우, 상기 위해 미생물 또는 병원성 미생물에 대한 방어에 관련된 사이토카인(cytokine)인 IL-12이나 IL-1β의 분비를 촉진하며 NO 생성을 촉진하여, 병원성 미생물에 대한 초기 면역 효과를 향상시킬 수 있을 것으로 예상된다.The confirmed fact that the Pediococcus pentosakeus strain F142-811 promotes the secretion of IL-12, which reduces the amount of IL-4 secretion, antiallergic, activates phagocytosis of macrophages, cytotoxic It activates the immune function of T cells to carry out anticancer activity and, when infected by harmful microorganisms, promotes the secretion of cytokines, IL-12 or IL-1β, which are involved in the defense against harmful or pathogenic microorganisms. It is anticipated that by promoting NO production, it is possible to enhance the initial immune effect against pathogenic microorganisms.

또한, 상기 페디오코커스 펜토사케우스 균주 F142-811은 적혈구와 함께 배양한 경우에도 용혈반응이 일어나지 않아 인체에는 무독하다는 것이 확인되었다.In addition, the Pediococcus pentosakeus strain F142-811 was found to be harmless to the human body because hemolysis did not occur even when incubated with red blood cells.

상기와 같은 결과에 의하면, 상기 페디오코커스 펜토사케우스 균주 F142-811은 위해 미생물에 대한 항균 활성을 가지고, 내산성 및 내담즙성이 우수하며, 장내부착능이 뛰어나고 면역 개선 효과를 가지며, 안전성도 확보되어, 항균 조성물의 유효성분 또는 생균활성제로 응용될 수 있다.According to the above results, the Pediococcus pentosakeus strain F142-811 has antimicrobial activity against harmful microorganisms, excellent acid resistance and bile resistance, excellent intestinal adhesion ability, immune improvement effect, and also secure safety It can be applied as an active ingredient or a probiotic of the antimicrobial composition.

이러한 측면에서, 본 발명은 상기 페디오코커스 펜토사케우스 균주 F142-811, 이의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물로 이루어진 군에서 선택된 1종 이상을 유효성분으로 포함하는 위해 미생물에 대한 항균 조성물에 관한 것이다.In this aspect, the present invention is an antimicrobial agent for harmful microorganisms comprising at least one selected from the group consisting of the Pediococcus pentosakeus strain F142-811, a culture thereof, a concentrate of the culture, the dried product of the culture as an active ingredient It relates to a composition.

상기 페디오코커스 펜토사케우스 균주 F142-811은 바람직하게는 기탁번호 KFCC 11504P를 갖는 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus KFCC 11504P)일 수 있다.The Phedi O Lactococcus pento sake F142-811 mouse strain is preferably Phedi O Lactococcus pento sake mouse strain with the accession number KFCC 11504P (Pediococcus pentosaceus KFCC 11504P).

상기 항균 조성물은 상기 위해 미생물에 대한 미생물 감염의 예방 및 개선용 조성물로 사용될 수 있고, 의약용 조성물이나 식품 조성물 등으로 응용될 수 있다.The antimicrobial composition may be used as a composition for preventing and improving microbial infections against the harmful microorganisms, and may be applied as a pharmaceutical composition or a food composition.

또한, 상기 페디오코커스 펜토사케우스 균주 F142-811 또는 상기 균주를 배양한 배양배지는 위해 미생물에 대한 항균활성을 갖는다. 상기 균주를 배양한 배양배지는 일 예로 상기 균주가 배양된 배양액일 수 있다.In addition, the Pediococcus pentosakeus strain F142-811 or the culture medium in which the strain is cultured has antimicrobial activity against harmful microorganisms. The culture medium in which the strain is cultured may be, for example, a culture medium in which the strain is cultured.

구체적으로, 상기 위해 미생물은 일 예로 식품 부패의 원인균인 마이크로코커스 속 균주(Micrococcus sp.), 바람직하게는 류테우스 균주(Micrococcus leteus), 식중독의 원인균인 살모넬라 속 균주(Salmonella sp.), 바람직하게는 살모넬라 티피뮤리움 균주(Salmonella typhimurium), 식품 또는 변패의 원인균인 바실러스 속 균주(Bacillus sp.), 바람직하게는 바실러스 서브틸리스 균주(Bacillus subtilis) 및 바실러스 세레우스 균주(Bacillus cereus), 장염의 원인이 되는 비브리오 속 균주(Vibrio sp.), 바람직하게는 비브리오 파라헤몰리티쿠스 균주(Vibrio parahaemoliticus) 및 설사, 장염 등을 일으키는 대장균(Escherichia coli)일 수 있다.Specifically, the harmful microorganism is a strain of the genus Micrococcus which is a cause of food decay, for example ( Micrococcus sp.), preferably acids Proteus strains (Micrococcus leteus), the cause of food poisoning in Salmonella strains (Salmonella sp.), preferably from Salmonella typhimurium strain (Salmonella typhimurium), the Bacillus strain causative agents of food or deterioration (Bacillus sp.), preferably from the Bacillus subtilis strain (Bacillus subtilis) and Bacillus cereus strains (Bacillus cereus ), Vibrio sp., which causes enteritis, preferably Vibrio parahaemoliticus strain, and Escherichia coli causing diarrhea and enteritis. It can be coli).

상기 항균조성물에 포함되는 상기 유효성분의 함량은 사용목적 및 사용방법 등을 고려하여 적절하게 선택될 수 있으며, 예를 들어 전제 조성물을 기준으로 0.01 내지 99 중량부, 바람직하게는 0.1 내지 90 중량부, 더욱 바람직하게는 1 내지 75 중량부일 수 있다. 상기 항균조성물에는 통상적으로 사용되는 첨가제를 더욱 포함할 수 있다. The content of the active ingredient included in the antimicrobial composition may be appropriately selected in consideration of the purpose of use and the method of use, for example, 0.01 to 99 parts by weight, preferably 0.1 to 90 parts by weight based on the total composition. More preferably 1 to 75 parts by weight. The antimicrobial composition may further include an additive commonly used.

또한, 본 발명은 상기 페디오코커스 펜토사케우스 균주 F142-811, 이의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물로 이루어진 군에서 선택된 1종 이상을 유효성분으로 포함하는 생균활성제를 제공한다.The present invention also provides a probiotic active agent comprising at least one selected from the group consisting of the Pediococcus pentosakeus strain F142-811, its culture solution, the concentrate of the culture solution, the dried product of the culture solution.

상기 페디오코커스 펜토사케우스 균주 F142-811은 바람직하게는 기탁번호 KFCC 11504P를 갖는 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus KFCC 11504P)일 수 있다.The Phedi O Lactococcus pento sake F142-811 mouse strain is preferably Phedi O Lactococcus pento sake mouse strain with the accession number KFCC 11504P (Pediococcus pentosaceus KFCC 11504P).

본 발명에서 생균활성제란 사람과 가축의 장내 미생물 균총의 개선으로 건강에 유익한 효능을 갖는 생균제재를 의미한다. 미생물이 생균활성제로 기능하기 위해서는, 장내 생존력이 좋아 섭취 후 일정기간 그 활성이 유지되어야 한다. 상기 페디오코커스 펜토사케우스 균주 F142-811 은 위해 미생물에 대한 항균활성을 나타낼 뿐만 아니라, 내산성이 뛰어나고, 소의 담즙액을 포함하는 인공담즙에 대한 높은 저항성을 나타내며, 적혈구와 함께 배양한 경우 용혈반응이 일어나지 않는 것으로부터 확인된 바와 같이 인체에 무독하므로, 생균활성제로 기능하기 위한 조건을 모두 만족한다.In the present invention, the probiotic means a probiotic having a beneficial effect on health by improving the intestinal microflora of humans and livestock. In order for the microorganism to function as a probiotic, the intestinal viability is good and its activity must be maintained for a certain period after ingestion. The Pediococcus pentosakeus strain F142-811 not only exhibits antimicrobial activity against harmful microorganisms, but also has excellent acid resistance and high resistance to artificial bile including bovine bile solution, and when hemoglobin reacts with red blood cells As it is confirmed that this does not occur, it is toxic to the human body, and thus satisfies all conditions for functioning as a probiotic.

상기 생균활성제에 포함되는 항균조성물의 함량은 사용목적 및 사용방법 등을 고려하여 적절하게 선택될 수 있으며, 바람직하게는 전제 조성물을 기준으로 0.01 중량부 내지 99 중량부, 더욱 바람직하게는 0.1 중량부 내지 90 중량부일 수 있다. 상기 생균활성제에는 통상적으로 사용되는 첨가제를 더욱 포함할 수 있다.The content of the antimicrobial composition included in the probiotic active agent may be appropriately selected in consideration of the purpose of use and the method of use, and preferably 0.01 part by weight to 99 parts by weight, more preferably 0.1 part by weight based on the total composition. To 90 parts by weight. The probiotic may further comprise an additive commonly used.

또한, 본 발명은 상기 생균활성제가 포함된 식품을 제공한다. 상기 생균활성제는 식품 부패 또는 변패의 원인균인 마이크로코커스 속 균주, 바람직하게는 마이크로코커스 류테우스 균주, 바실러스 속 균주, 바실러스 서브틸리스 균주 및 바실러스 세레우스 균주에 대한 항균활성을 가지므로 식품의 부패 또는 변패를 저지 또는 완화할 수 있으며, 식중독의 원인균인 살모넬라 속 균주, 살모넬라 타이피뮤리움 균주에 대한 항균활성을 가지므로, 식중독의 예방 또는 개선효과가 있다. 또한, 장염의 원인이 되는 비브리오 속 균주, 바람직하게는 비브리오 파라헤몰리티쿠스에 대한 항균활성을 가지므로 장염 예방 또는 완화 효과가 있을 수 있고, 설사, 장염 등을 일으키는 대장균에 대한 항균활성을 가지므로 설사 및 장염의 예방 또는 개선 효과가 있다. In addition, the present invention provides a food containing the probiotic. The probiotic has a microbial strain, which is a causative agent of food decay or decay, preferably micrococcus luteus strain, Bacillus sp. Strain, Bacillus subtilis strain and Bacillus cereus strain because it has an antimicrobial activity It can prevent or alleviate the deterioration, and has antibacterial activity against Salmonella spp., Salmonella typhimurium strain, which is a causative agent of food poisoning, and thus has an effect of preventing or improving food poisoning. In addition, the Vibrio genus strain, which is the cause of enteritis, preferably has antimicrobial activity against Vibrio parahemoliticus, and may have an anti-inflammatory or relieving effect on enteritis, and has an antimicrobial activity against E. coli causing diarrhea and enteritis. Therefore, it is effective in preventing or improving diarrhea and enteritis.

본 발명에서 식품이란 영양소를 한 가지 또는 그 이상 함유하고 있는 천연물 또는 가공품을 의미하며, 바람직하게는 어느 정도의 가공 공정을 거쳐 직접 먹을 수 있는 상태가 된 것을 의미하며 그 예로는 과일, 야채, 과일이나 야채의 건조제품이나 절단제품, 과일쥬스, 야채쥬스, 이들의 혼합쥬스 이거나 칩류, 면류, 축산가공식품, 수산가공식품, 유가공식품, 발효식품, 두류식품, 곡류식품, 미생물발효식품, 제과제빵, 양념류, 육가공류, 산성음료수, 감초류, 허브류 등이 있으나 이에 한정되는 것은 아니다.In the present invention, the food means a natural product or a processed product containing one or more nutrients, and preferably means a state in which it can be directly eaten through some processing process, for example, fruits, vegetables, and fruits. Dried or cut products of fruits, vegetables, fruit juices, vegetable juices, mixed juices or chips, noodles, livestock processed foods, fish processed foods, dairy foods, fermented foods, legumes foods, cereals, microbial fermented foods, confectionery , Seasonings, processed meats, acidic beverages, licorice, herbs, etc., but is not limited thereto.

본 발명의 식품은 지시된 비율로 필수 성분으로서 상기 생균활성제를 함유하는 외에는 다른 성분에는 특별한 제한이 없으며, 통상의 식품과 같이 여러 가지 향미제 또는 탄수화물 등을 추가 성분으로 함유할 수 있으나 이에 한정되는 것은 아니다. 상기의 생균활성제는 식품류, 음료, 건강음료, 껌, 차, 비타민 복합제, 건강 기능성 식품류의 제조시 원료 물질에 첨가되거나 조리된 식품에 적절히 혼합하는 방법으로 첨가될 수 있으며, 식품학적으로 허용 가능한 식품 보조 첨가제와 함께 첨가될 수 있다. 이 때, 식품 또는 음료 중의 상기 생균활성제의 양은 전체 식품 중량의 0.01 중량% 내지 90 중량%로 가할 수 있으며, 음료의 경우 100 mL를 기준으로 0.02 g 내지 20 g, 바람직하게는 0.5 g 내지 10 g의 비율로 가할 수 있다.The food of the present invention is not particularly limited to other ingredients except for containing the probiotic active agent as an essential ingredient in the indicated ratio, and may include various flavors or carbohydrates as additional ingredients, such as ordinary food, but is not limited thereto. It is not. The probiotic may be added to raw materials in the manufacture of foods, beverages, health drinks, gums, teas, vitamin complexes, and health functional foods, or by appropriate mixing with cooked foods, and food acceptable foods. It may be added together with auxiliary additives. At this time, the amount of the probiotic in the food or beverage may be added in an amount of 0.01% to 90% by weight of the total food weight, in the case of a beverage from 0.02 g to 20 g, preferably 0.5 g to 10 g based on 100 mL It can be added at the ratio of.

상기 식품은 일 예로 발효식품, 건강식품 또는 음료일 수 있다.The food may be, for example, fermented food, health food or beverage.

본 발명에서 발효식품이란 유산균이나 효모 등 미생물을 한 가지 또는 둘 이상 첨가하고 상기 미생물의 발효 작용을 이용하여 만든 식품을 의미하며, 상세하게는 식품 기재에 발효식품용 종균을 첨가하고 숙성시켜 제조하는 식품을 의미한다. 상기 발효식품으로는 주류, 빵류, 김치, 젖갈, 된장, 간장, 치즈, 버터, 요구르트 등 비살균 개방형 발효식품 모두가 포함된다. Fermented food in the present invention means a food made by adding one or two or more microorganisms, such as lactic acid bacteria or yeast, using the fermentation action of the microorganisms, and in detail to add the fermented food spawn to the food base and to prepare Means food. The fermented food includes all non-sterile open fermented foods, such as liquor, bread, kimchi, milk brown, miso, soy sauce, cheese, butter, yogurt.

또한, 상기 생균활성제는 발효식품용 종균으로 사용될 수 있으며, 바람직하게는 김치의 종균으로 사용될 수 있다. 이때 종균의 사용량은 발효식품의 종류 및 종균의 종류에 따라 적절히 조절하는 것이 좋다. 바람직하기로는 식품 주재료 100 중량을 기준으로 0.0001 내지 0.01 중량부(습윤 중량부)로 접종하는 것이다.In addition, the probiotic may be used as a seed for fermented food, preferably used as a seed of kimchi. At this time, the amount of spawn is preferably adjusted according to the type of fermented food and the type of spawn. Preferably, it is inoculated at 0.0001 to 0.01 part by weight (wet part by weight) based on 100 parts by weight of the food main ingredient.

본 발명에서 기능성 식품이란 식품에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 식품의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 식품군이나 식품 조성이 갖는 생체방어리듬조절, 질병방지와 회복 등에 관한 체조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 식품을 의미한다.In the present invention, the functional food refers to a food group which is imparted with added value to function and express the function of the food by using physical, biochemical, biotechnological techniques and the like, the regulation of the biological defense rhythm of the food composition, Means a food which is processed and designed so that the body control function regarding the body is sufficiently expressed to the living body.

본 발명에서 음료란 갈증을 해소하거나 맛을 즐기기 위하여 마시는 것의 총칭을 의미하고 주류, 청량음료, 물, 시럽, 차, 커피, 과실음료 등이 이에 해당되며 유산균 음료를 포함한다. 유산균 음료란 유산균을 배양하여 유산발효시킨 것에 살균수를 가해서 희석하고 당분, 향료 등을 가한 음료를 의미한다. 상기 음료는 지시된 비율로 필수 성분으로서 상기 생균활성제를 함유하는 외에는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.In the present invention, the drink refers to a generic term for drinking to quench thirst or enjoy the taste, and includes alcoholic beverages, soft drinks, water, syrup, tea, coffee, fruit drinks, and the like, and include lactic acid bacteria drinks. The lactic acid bacteria drink refers to a beverage in which lactic acid bacteria are cultured and lactic acid fermentation is added by diluting with sterilized water and adding sugar and flavoring. The beverage is not particularly limited to other ingredients except for containing the probiotic as an essential ingredient in the indicated ratio, and may contain various flavors or natural carbohydrates as additional ingredients, such as ordinary drinks.

이상 살펴본 바와 같이, 본 발명에 따른 페디오코커스 펜토사케우스 균주 F142-811(Pediococcus pentosaceus F142-811)은 내산성 및 내담즙성이 뛰어나고, 장내 세포에 대한 부착능도 우수하고, 다양한 위해 미생물, 구체적으로 살모넬라 티피뮤리움 균주, 마이크로코커스 류테우스 균주, 바실러스 서브틸리스 균주, 바실러스 세레우스 균주, 비브리오 파라헤몰리티쿠스 균주 및 대장균에 대한 항균활성을 가짐으로써 생균활성제로 활용할 수 있다.As described above, Pediococcus pentosaceus strain F142-811 ( Pediococcus pentosaceus F142-811) according to the present invention is excellent in acid resistance and bile resistance, excellent adhesion to intestinal cells, various harmful microorganisms, As an antimicrobial activity against Salmonella typhimurium strain, micrococcus luteus strain, Bacillus subtilis strain, Bacillus cereus strain, Vibrio parahemoliticus strain and E. coli can be used as a probiotic.

도 1은 본 발명의 일 실시예에 따른 페디오코커스 펜토사케우스 균주 F142-811의 전자현미경 촬영 사진이다.
도 2는 본 발명의 일 실시예에 따른 페디오코커스 펜토사케우스 균주 F142-811의 16S rRNA의 염기서열이다.
도 2는 본 발명의 일 실시예에 따른 페디오코커스 펜토사케우스 균주 F142-811의 16S rRNA의 염기서열을 기초로 한 다른 세균(bacteria)과의 계통발생론적 관계를 나타내는 그림이다.
도 3은 본 발명의 일 실시예에 따른 유산균의 Caco-2 세포주에 대한 부착능을 확인한 락토바실러스 람노서스 GG의 사진이다.
도 4는 본 발명의 일 실시예에 따른 유산균의 Caco-2 세포주에 대한 부착능을 확인한 사진으로, 도 4a는 비교예인 락토바실러스 람노서스 GG의 세포부착능을 확인한 사진이고, 도 4b는 페디오코커스 펜토사케우스 균주 F142-811의 세포부착능을 확인한 사진이다.
도 5는 본 발명의 일 실시예에 따른 페디오코커스 펜토사케우스 균주 F142-811과 락토바실러스 람노서스 GG의 IL-1β 생산량을 비교하여 나타낸 그래프로, 세로축은 분비된 IL-1β 생산량을 1mL 상등액 당 사이토카인의 양을 ng으로 표시한 것이고, 가로축은 각 균주의 첨가된 양을 log CFU/mL 즉, 상등액 1mL 당 포함된 유산균의 수를 log 단위로 표시한 것이다.
도 6은 본 발명의 일 실시예에 따른 페디오코커스 펜토사케우스 균주 F142-811과 다른 유산균의 IL-12 생산량을 비교하여 나타낸 그래프로, 세로축은 분비된 IL-12 생산량을 1mL 상등액 당 사이토카인의 양을 ng으로 표시한 것이고, 가로축은 각 균주의 첨가된 양을 log CFU/mL 즉, 상등액 1mL 당 포함된 유산균의 수를 log 단위로 표시한 것이다.
도 7은 본 발명의 일 실시예에 따른 페디오코커스 펜토사케우스 균주 F142-811과 다른 유산균의 NO 생산량을 비교하여 나타낸 그래프로, 세로축은 분비된 NO 생산량을 1mL 상등액 당 사이토카인의 양을 ng으로 표시한 것이고, 가로축은 각 균주의 첨가된 양을 log CFU/mL 즉, 상등액 1mL 당 포함된 유산균의 수를 log 단위로 표시한 것이다.
1 is an electron microscope photograph of the Pediococcus pentosakeus strain F142-811 according to an embodiment of the present invention.
2 is a nucleotide sequence of 16S rRNA of Pediococcus pentosakeus strain F142-811 according to an embodiment of the present invention.
Figure 2 is a diagram showing the phylogenetic relationship with other bacteria based on the nucleotide sequence of 16S rRNA of Pediococcus pentosakeus strain F142-811 according to an embodiment of the present invention.
Figure 3 is a photograph of Lactobacillus rhamnosus GG confirming the adhesion of the lactic acid bacteria to Caco-2 cell line according to an embodiment of the present invention.
Figure 4 is a photograph confirming the adhesion of the lactic acid bacteria to Caco-2 cell line according to an embodiment of the present invention, Figure 4a is a photograph confirming the cell adhesion of the Lactobacillus rhamnosus GG of a comparative example, Figure 4b is pedio It is a photograph confirming the cell adhesion ability of the caucus pentosakeus strain F142-811.
FIG. 5 is a graph showing the IL-1β production of Pediococcus pentosakeus strain F142-811 and Lactobacillus rhamnosus GG according to an embodiment of the present invention, and the vertical axis represents the secreted IL-1β production amount of 1 mL supernatant. FIG. The amount of sugar cytokines is expressed in ng, and the horizontal axis is the amount of each strain added in log CFU / mL, that is, the number of lactic acid bacteria contained per mL of the supernatant in log units.
Figure 6 is a graph showing the comparison of IL-12 production of Pediococcus pentosakeus strain F142-811 and other lactic acid bacteria according to an embodiment of the present invention, the vertical axis is the cytokine per 1 mL supernatant secreted IL-12 production The amount of is expressed in ng, the horizontal axis is the log CFU / mL of the added amount of each strain, that is, the number of lactic acid bacteria contained per mL of the supernatant in log units.
7 is a graph comparing NO production of Pediococcus pentosakeus strain F142-811 and other lactic acid bacteria according to an embodiment of the present invention, and the vertical axis represents the amount of cytokine per 1 mL supernatant secreted NO production. The horizontal axis shows log CFU / mL of the added amount of each strain, that is, the number of lactic acid bacteria contained per mL of the supernatant in log units.

이하 본 발명의 실시예를 기재한다. 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명이 하기 실시예에 한정되는 것은 아니다.
Hereinafter, examples of the present invention will be described. The following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

<< 실시예Example 1>  1> 유산균주의Lactic acid bacteria 분리 및 동정 Isolation and identification

1-1 1-1 유산균주의Lactic acid bacteria 분리 detach

열무김치의 가식부위와 액상부위를 1:1로 혼합하여 10g을 잰 뒤, 90mL의 멸균수에 넣고 마쇄하였다. 단계별희석(serial dilution)을 하여 MRS(+0.5% CaCO3) 고체배지에 분주하고 30℃에서 2일 동안 배양하였다. 생성된 콜로니 중 CaCO3에 대하여 투명환을 보인 균주를 선별하여 그람 염색과 카타라제 시험(catalase test)을 통해 유산균을 분리하였다.
The edible portion and the liquid portion of yeolmu kimchi were mixed 1: 1, weighed 10 g, and then ground in sterile water of 90 mL. Serial dilution was performed on MRS (+ 0.5% CaCO3) solid medium and incubated at 30 ° C. for 2 days. Among the colonies, strains showing transparent rings for CaCO3 were selected, and lactic acid bacteria were isolated through gram staining and catalase test.

1-2 1-2 유산균주의Lactic acid bacteria 동정 Sympathy

상기 실시예 1-1에서 분리된 유산균인 F142-811는 그람염색을 비롯한 형태학적 특성을 이용한 형태학적 분석, 당대사능을 포함한 생화학적 분석 및 16S rDNA 염기서열 분석을 통하여 동정하였다.F142-811, the lactic acid bacteria isolated in Example 1-1, was identified through morphological analysis using morphological characteristics including gram staining, biochemical analysis including glucose metabolism, and 16S rDNA sequence analysis.

상기 형태학적 특성에 대한 분석은 상기 실시예 1-1의 분리균주인 F142-811의 콜로니의 모양 및 색을 관찰하고, 상기 균주를 그람염색한 후에, 광학현미경(SEM)으로 모양을 관찰하였으며(도 1 참조), 용혈여부도 관찰하여 그 결과를 표 1 및 도 1에 나타내었다.Analysis of the morphological characteristics was observed the shape and color of the colony of F142-811, the isolated strain of Example 1-1, and after gram staining the strain, the shape was observed with an optical microscope (SEM) ( 1), hemolysis was also observed, and the results are shown in Table 1 and FIG. 1.

특 성Characteristics F142-811F142-811 SourceSource 열무김치Yeolmu kimchi 형태(Morphology, Shape)Morphology, Shape 구균coccus 그람염색(Gram-stain) 여부Gram-stain ++ 카탈라아제 시험(catalase test)Catalase test -- Acid production(pH)Acid production (pH) pH 4.01pH 4.01 HemolysisHemolysis -- 콜로니 색깔 및 투명도Colony color and transparency 투명한 우유 색Transparent milk color

상기 표 1에 나타낸 바와 같이, 상기 분리균주인 F142-811은 광학현미경 관찰 결과 구균 형태이고, 투명한 우유 색의 콜로니를 형성하며, 생육배지의 pH는 pH 4.01이었고, 용혈시험을 거친 결과 음성이었고, LBS 고체배지에서 생육이 가능한 것으로 확인되었다. As shown in Table 1, the isolated strain F142-811 is a coliform form as a result of optical microscopic observation, forms a transparent milky colony, the pH of the growing medium was pH 4.01, was negative after hemolysis test, It was confirmed that growth was possible in LBS solid medium.

또한, 상기 16S rDNA 염기서열 분석을 통한 동정을 수행하였다. 구체적으로, 상기 분리균주 F142-811로부터 16S ribosomal RNA를 추출한 후, 하기 표 2에 기재된 프라이머 쌍을 이용하여 PCR을 수행함으로써 16S rRNA 염기서열 분석을 수행하여, 상기 분리균주 F142-811의 16S rRNA로 총 1,452bp의 염기서열을 결정하였으며, 그 결과를 도 2 및 서열번호 3에 나타내었다.In addition, the identification was performed by the 16S rDNA sequencing. Specifically, after extracting 16S ribosomal RNA from the isolate strain F142-811, PCR was performed using the primer pairs shown in Table 2 below to perform 16S rRNA sequencing, to the 16S rRNA of the isolate strain F142-811. A total of 1,452 bp of nucleotide sequences were determined, and the results are shown in FIG. 2 and SEQ ID NO.

PrimersPrimers 서열(5'--> 3')Sequence (5 '-> 3') 서열번호SEQ ID NO: 27F27F AGAGTTTGATCCTGG CTCAGAGAGTTTGATCCTGG CTCAG 1One 1492R1492R GGTTACCTTGTTACGACTTGGTTACCTTGTTACGACTT 22

상기 수행한 염기서열을 기초로 염기서열의 검사는 3730 XL 염기서열분석기(Applied Biosystems, USA)를 사용하여 분석하였으며, CLUSTRAL W 프로그램을 이용하여 각 균주의 상동성을 비교하였다.Based on the performed nucleotide sequence, the nucleotide sequence was analyzed using a 3730 XL sequencer (Applied Biosystems, USA), and the homology of each strain was compared using the CLUSTRAL W program.

상기 16S rRNA 염기서열 분석을 통해 결정된 서열을 이용하여 상동성 검색을 실시한 결과를 기초로 다른 세균과의 계통발생론적 관계를 도 3에 나타내었다. 도 3에 나타낸 바와 같이, Pediococcus pentosaceus DSM20336T (AJ305321)에 대해 99%(1452/1569), Pediococcus stilesii LMG23082T(AJ305320)에 대해 98%(1452/1529)의 유사성을 나타냈다.The phylogenetic relationship with other bacteria is shown in FIG. 3 based on the results of the homology search using the sequences determined through the 16S rRNA sequencing. As shown in FIG. 3, Pediococcus 99% (1452/1569), Pediococcus to pentosaceus DSM20336T (AJ305321) 98% (1452/1529) similarity to stilesii LMG23082T (AJ305320).

또한, 당 대사능을 검토하여 수행하였으며, 16S rDNA 염기서열 분석결과 가장 유사성이 높은 Pediococcus pentosaceus DSM20336T(AJ305321)을 비교예로 하여, 그 결과를 하기 표 3에 나타내었다. 하기 표 3에 기재된 +은 양성 반응을 의미하고, -는 음성 반응을 의미한다.In addition, the sugar metabolism was reviewed and performed, and Pediococcus had the highest similarity as a result of 16S rDNA sequencing. Using pentosaceus DSM20336T (AJ305321) as a comparative example, the results are shown in Table 3 below. + In Table 3 means a positive reaction, and-means a negative reaction.

F142-811F142-811 DSM 20336 DSM 20336 F142-811F142-811 DSM 20336 DSM 20336 GlycerolGlycerol -- SalicinSalicin ++ ErythritolErythritol -- CellobioseCellobiose ++ D-ArabinoseD-Arabinose -- MaltoseMaltose ++ ++ L-ArabinoseL-Arabinose ++ ++ LactoseLactose -- ++ RiboseRibose ++ ++ MelibioseMelibiose -- D-XyloseD-Xylose ++ DD SucroseSucrose ++ L-XyloseL-Xylose -- TrehaloseTrehalose ++ AdonitolAdonitol -- InulinInulin DD MD-XylosideMD-Xyloside -- MelezitoseMelezitose -- -- GalactoseGalactose ++ ++ RaffinoseRaffinose -- GlucoseGlucose ++ AmidonAmidon -- FructoseFructose ++ GlycogenGlycogen -- MannoseMannose ++ XylitolXylitol -- SorboseSorbose -- GentiobioseGentiobiose ++ RhamnoseRhamnose -- D-TuranoseD-Turanose -- DulcitolDulcitol -- D-LyxoseD-Lyxose -- InositolInositol -- D-TagatoseD-Tagatose ++ MannitolMannitol -- -- D-FucoseD-Fucose -- SorbitolSorbitol -- L-FucoseL-Fucose -- α Methyl-D-mannosideα Methyl-D-mannoside -- D-ArabitolD-Arabitol -- α Methyl-D-glucosideα Methyl-D-glucoside -- L-ArabitolL-Arabitol -- N Acetyl glucosamineN Acetyl glucosamine ++ GluconateGluconate -- AmygdalinAmygdalin ++ 2 keto-gluconate2 keto-gluconate -- ArbutinArbutin ++ 5 keto-gluconate5 keto-gluconate -- EsculinEsulin ++

상기 표 3에 나타낸 바와 같이, 상기 분리균주인 Pediococcus pentosaceus DSM20336T와 상당히 유사한 당대사능을 나타내었으나, 상기 F142-811는 D-xylose를 이용하는 반면, lactose는 이용하지 못한다는 점에서 구분되었다.As shown in Table 3, the isolated strain Pediococcus eoteuna exhibit substantially similar contemporary saneung and pentosaceus DSM20336T, the F142-811 was divided in that, while using the D-xylose, lactose does not use.

상기 분석 결과, F142-811 균주는 Pediococcus pentosaceus 로 동정되었고, 상기 균주를 2011년 2월 14일에 대한민국 서울특별시 서대문구 홍제1동 361-221번지 유림빌딩 2층에 위치한 한국미생물보존센터에 기탁하여 수탁번호 KFCC 11504P를 부여 받았다.
As a result of the analysis, F142-811 strain is Pediococcus The strain was identified as pentosaceus , and the strain was deposited on February 14, 2011, at the Korea Microorganism Conservation Center located at 2F, Yurim Building, 361-221, Hongje 1-dong, Seodaemun-gu, Seoul, Korea, and was given accession number KFCC 11504P.

<< 실시예Example 2> 위해 미생물에 대한 항균 활성 측정 2> Determination of antimicrobial activity against harmful microorganisms

상기 실시예 1에서 동정된 페디오코커스 펜토사케우스 균주 F142-811의 항균활성의 확인은 하기 표 4에 기재한 지시 균주 각각에 대한 spot-array 실험을 통하여 수행하였다. 구체적인 실험방법은 하기와 같다.Confirmation of the antimicrobial activity of the Pediococcus pentosakeus strain F142-811 identified in Example 1 was performed through a spot-array experiment for each of the indicator strains described in Table 4 below. The specific experimental method is as follows.

상기 페디오코커스 펜토사케우스 균주 F142-811을 MRS 액체배지에 접종 후, 30℃에서 24시간 동안 배양하였다. 상기 배양한 균체를 원심분리를 통해 회수하고, 멸균수로 OD600값을 1.0으로 조절하여, MRS 고체배지에 10μl를 점적하였다. 약 2시간 동안 건조시켜 위해 미생물에 대한 특정배지로 형성된 0.5% agar를 포함한 top agar 배지에 하기 표 4에 기재된 위해 미생물을 0.1% 접종하여 현탁시킨 것을 상기 고체배지에 도말하였다. 상기 위해 미생물을 유산균의 생육온도에서 16시간 동안 배양하여 유산균 점적 주변으로 생긴 투명환 즉, 저해환의 지름을 측정하였으며, 그 결과를 상기 표 4에 기재하였다.The Pediococcus pentosakeus strain F142-811 was inoculated in MRS liquid medium and incubated at 30 ° C. for 24 hours. The cultured cells were recovered by centrifugation, OD 600 was adjusted to 1.0 with sterile water, and 10 μl was added to the MRS solid medium. The solid medium was inoculated with 0.1% inoculation of the harmful microorganisms described in Table 4 below in a top agar medium containing 0.5% agar formed with a specific medium for harmful microorganisms by drying for about 2 hours. The harmful microorganisms were cultured for 16 hours at the growth temperature of the lactic acid bacteria, and the diameters of the transparent rings, that is, the inhibitory rings formed around the lactic acid bacteria droplets were measured, and the results are shown in Table 4 above.

상기 표 4의 항균활성 표기와 관련하여 '+++'는 성장 저해 정도가 강함을 의미, '++'는 성장 저해 정도가 중간임을 의미, '+'는 성장 저해 정도가 약간 있음을 의미, '-'는 성장을 저해하지 않음을 의미한다.In relation to the antimicrobial activity of Table 4, '+++' means a strong growth inhibition, '++' means a moderate growth inhibition, '+' means a slight growth inhibition, '-' Means not to inhibit growth.

위해 미생물To microorganisms F142-811의 항균활성Antimicrobial Activity of F142-811 Bacillus cereus ATCC 27348 Bacillus cereus ATCC 27348 ++ Bacillus subtilis ATCC 6633 Bacillus subtilis ATCC 6633 ++++ Salmonella typhymurium KCTC 2515 Salmonella typhymurium KCTC 2515 ++++ Micrococcus luteus ATCC 13513 Micrococcus luteus ATCC 13513 ++++++ Lactobacillus plantarum ATCC 8014 Lactobacillus plantarum ATCC 8014 -- Listeria monocytogenes ATCC 19113 Listeria monocytogenes ATCC 19113 -- Vibrio parahaemoliticus ATCC 27969 Vibrio parahaemoliticus ATCC 27969 ++ Escherichia coli ATCC 25922 Escherichia coli ATCC 25922 ++

상기 표 4에 나타낸 바와 같이, 페디오코커스 펜토사케우스 균주 F142-811는 Lactobacillus plantarumListeria monocytogenes를 제외한 나머지 균주들에 대해 항균 능력을 나타냈으며, 특히 Micrococcus luteus에 대한 항균력이 높음이 확인되었다.As shown in Table 4, Pediococcus pentosakeus strains F142-811 are Lactobacillus plantarum and Listeria Except for monocytogenes , the other strains showed antibacterial activity, especially Micrococcus High antimicrobial activity against luteus was confirmed.

상기한 결과는 식품의 제조 및 가공 등의 이용에 있어서 유산균체나 그 배양여액을 이용하여 통조림식품에서의 포자 형성균을 제어하거나 발효유, 발효알콜음료, 유제품 등 여러 가지 식품 및 사료에 천연보존제로 사용함으로써 저장성 향상뿐만 아니라 열 처리량 감소에 의한 영양적 가치, 맛 및 조직감을 향상시킬 수 있고, 저온성 균, 병원성 균 및 부패미생물의 제어에도 사용될 수 있을 것으로 예상되었다.
The above results indicate that spore forming bacteria in canned foods are controlled by using lactic acid bacteria or its culture filtrate in the manufacture and processing of foods, or used as natural preservatives in various foods and feeds such as fermented milk, fermented alcoholic beverage and dairy products. As a result, it is expected to improve nutritional value, taste, and texture by reducing heat throughput, as well as to control storage of low temperature bacteria, pathogenic bacteria, and rot microorganisms.

<< 실시예Example 3>  3> 페디오코커스Pediocaucus 펜토사케우스Pentosakeus 균주 F142-811의  Of strain F142-811 프로바이오틱Probiotic 이용 가능성 Availability

구강을 통하여 섭취된 균이 최종 목적 부위인 장에 도달하기 위해서는 강산성의 위액을 통과하여 생존해야 한다. 따라서 김치로부터 분리한 페디오코커스 펜토사케우스 균주 F142-811에 대하여 내산성 시험을 수행하였다. 또한, 페디오코커스 펜토사케우스 균주 F142-811가 위를 거쳐 장에 도달하기 위해서는 그 전에 췌장과 십이지장을 통과하게 되는데, 이 부위에서는 담즙액이 분비된다. 따라서 최종적으로 장내로 들어오기 위해서는 담즙액에 대한 내성 또한 갖추어야 할 중요한 특성이다. 따라서, 페디오코커스 펜토사케우스 균주 F142-811에 대하여 내담즙성 시험을 수행하였다. 또한, 페디오코커스 펜토사케우스 균주 F142-811가 장에 도달하여, 프로바이오틱 미생물로 작용하기 위해서는 장 내에 오랜 시간 동안 존재하여야 하므로, 장내 부착성에 관한 시험을 수행하였다.
The bacteria ingested through the oral cavity must survive through strong acidic gastric juice to reach the final target intestine. Therefore, the acid resistance test was performed on the Pediococcus pentosakeus strain F142-811 isolated from kimchi. In addition, the Pediococcus pentosakeus strain F142-811 passes through the pancreas and duodenum before it reaches the intestine through the stomach, where bile fluid is secreted. Therefore, in order to finally enter the intestine is an important characteristic that must also have resistance to bile juice. Therefore, a bile resistance test was performed on Pediococcus pentosakeus strain F142-811. In addition, since the Pediococcus pentosakeus strain F142-811 reaches the intestine and must be present in the intestine for a long time in order to function as a probiotic microorganism, a test for intestinal adhesion was performed.

3-1. 3-1. 내산성Acid resistance  And 내담즙성My bile

상기 실시예 1의 페디오코커스 펜토사케우스 균주 F142-811의 내산성 및 내담즙성 시험 각각은 본 배양이 완료된 상기 페디오코커스 펜토사케우스 균주 F142-811의 균체를 회수하여 동량의 pH2.0으로 조절된 MRS 액체배지와 황소의 담즙(oxgall)이 0.5% 함유된 배지를 이용하여 수행하였다. The acid resistance and bile resistance test of the Pediococcus pentosakeus strain F142-811 of Example 1 was recovered to the same amount of pH 2.0 by recovering the cells of the Pediococcus pentosakeus strain F142-811 after the main culture was completed. Controlled MRS broth and bull's bile (oxgall) was performed using a medium containing 0.5%.

상기 내담즙성의 측정은 구체적으로 전배양을 거친 상기 페디오코커스 펜토사케우스 균주 F142-811를 MRS 5ml에 2.5×106 CFU/ml이 되게 접종한 후, 30℃에서 24시간 배양하고, 상기 배양액 5ml를 원심분리하여 상기 페디오코커스 펜토사케우스 균주 F142-811를 회수한 다음, 멸균수에 2번 세척하고, 상기 각각의 배지에 접종하고 30℃에서 24시간 배양한 후, 단계별 희석을 통해 생균수를 측정하는 방법으로 수행하였으며, 상기 실험을 각각 3번씩 반복하여 측정하였고, 상기 각각의 측정값의 평균값을 하기 표 5에 나타내었다.Specifically, the measurement of the biliary resistance was inoculated to 2.5 × 10 6 CFU / ml of the Pediococcus pentosakeus strain F142-811, which had been pre-cultured to 5 ml of MRS, and then cultured at 30 ° C. for 24 hours, and the culture solution After centrifuging 5ml to recover the Pediococcus pentosakeus strain F142-811, and then washed twice in sterile water, inoculated in each medium and incubated for 24 hours at 30 ℃, live bacteria through stepwise dilution The number was measured by the method, and the experiment was repeated three times each, and the average value of each measured value is shown in Table 5 below.

또한, 상기 페디오코커스 펜토사케우스 균주 F142-811의 비교예로, 프로바이오틱 미생물로 확인된 락토바실러스 람노서스 GG(L. rhamnosus GG)의 내담즙성을 확인하여 비교하였다. 상기 생균수는 실험에서의 오차를 줄이기 위해, 페디오코커스 펜토사케우스 균주 F142-811와 락토바실러스 람노서스 GG를 각각 3번씩 배양하여 측정하였고, 상기 각각의 측정값의 평균값을 하기 표 5에 나타내었다. 하기 표 5에 기재된 값은 생존된 즉, 측정된 유산균의 수를 log CFU/well로 나타낸 값이다.In addition, as a comparative example of the Pediococcus pentosakeus strain F142-811, the bile resistance of L. rhamnosus GG ( L. rhamnosus GG) identified as a probiotic microorganism was confirmed and compared. The viable cell number was measured by incubating the Pediococcus pentosakeus strain F142-811 and Lactobacillus rhamnosus GG three times each to reduce the error in the experiment, the average value of each measured value is shown in Table 5 below. It was. The values listed in Table 5 below represent the number of surviving, i.e., measured, log CFU / well.

Strain nameStrain name No treatmentNo treatment Viability(pH 2.5)Viability (pH 2.5) 0.5% oxgall treatment0.5% oxgall treatment L. rhamnosus GG L. rhamnosus GG 10.04510.045 4.9914.991 8.8758.875 P. pentosaceus F142-811 P. pentosaceus F142-811 9.9649.964 5.0795.079 8.7788.778

상기 표 5에 나타낸 바와 같이, 페디오코커스 펜토사케우스 균주 F142-811는 락토바실러스 람노서스 GG와 비교하여 내산성 및 내담즙성이 뛰어났다. 보다 구체적으로, 아무런 처리를 하지 않은 경우 본 발명의 페디오코커스 펜토사케우스 균주 F142-811는 락토바실러스 람노서스 GG에 비하여 균체수가 약간 적게 확인되었으나, 내산성 또는 내담즙성 실험을 위하여 pH2.0으로 조절된 MRS 액체배지와 황소의 담즙이 0.5% 함유된 배지를 이용하여 배양한 결과, 배양 뒤에 오히려 균체수가 많은 것으로 확인되어, 기존에 생균활성제로 사용되는 락토바실러스 람노서스 GG에 비해 내산성 및 내담즙성이 우수한 것으로 확인되었다.
As shown in Table 5, Pediococcus pentosakeus strain F142-811 was superior in acid resistance and bile resistance compared to Lactobacillus rhamnosus GG. More specifically, if no treatment, pediococcus pentosakeus strain F142-811 of the present invention was confirmed to have a slightly smaller cell number than Lactobacillus rhamnosus GG, but to pH 2.0 for acid or bile resistance test When cultured using a medium containing 0.5% of the bile lysed MRS liquid medium and ox bile, it was found that the number of cells after the incubation was rather high, compared to the conventional Lactobacillus rhamnosus GG used as a probiotic. It was confirmed that the property was excellent.

3-2. 장내 3-2. Intestines 부착능Attachment

상기 실시예 1의 페디오코커스 펜토사케우스 균주 F142-811의 장내 부착능을 Caco-2, HT-29 및 갈락토스를 이용해 소장의 점액조성으로 유도된 galHT(galactose-induced HT-29 cell line)를 이용하여 측정하였다. Intestinal adhesion of the Pediococcus pentosakeus strain F142-811 of Example 1 using galcose, HT-29 and galactose galHT (galactose-induced HT-29 cell line) induced by the mucus composition of the small intestine It measured using.

보다 구체적으로, 상기 페디오코커스 펜토사케우스 균주 F142-811를 배양한 후, 원심분리를 통해 회수하고, 상기 배양된 페디오코커스 펜토사케우스 균주 F142-811의 농도를 OD600값을 1.0으로 조절하였다. 상기 농도를 조절한 균주 100μl를 췌장 세포(colon cell) 즉, 상기 Caco-2, HT-29 또는 갈락토스에 의해 소장의 점액조성으로 유도된 galHT이 배양된 24 well plate의 각 well에 넣고 1시간 동안 배양하였다. More specifically, after culturing the Pediococcus pentosakeus strain F142-811, it is recovered by centrifugation, and the concentration of the cultured Pediococcus pentosakeus strain F142-811 was adjusted to an OD600 value of 1.0. . 100 μl of the adjusted strain was added to each well of a 24 well plate in which gallon cells, ie, galCo induced by mucosa composition of the small intestine by Caco-2, HT-29 or galactose, were cultured. Incubated.

상기 plate에 배양한 후, PBS로 3번 세척하고, 0.1% TritonX 100을 사용하여 상기 췌장 세포 및 유산균을 well plate 바닥에서 떼어내고 일정 수준으로 희석 후, 생균수를 측정하였다. 비교예로는 장내 부착능이 우수한 것으로 확인된 락토바실러스 람노서스 GG(L. rhamnosus GG)와 장내 부착능이 없는 것으로 확인된 대조예(negative control)인 락토바실러스 아시도필러스를 사용하였으며, 상기와 동일한 방법으로 생균수를 측정하여, 부착능을 확인하였다.After incubation in the plate, washed three times with PBS, using a 0.1% TritonX 100 to remove the pancreatic cells and lactic acid at the bottom of the well plate and diluted to a certain level, the number of viable cells was measured. As a comparative example, L. rhamnosus GG (L. rhamnosus GG), which was found to have excellent intestinal adhesion, and Lactobacillus asidophilus, a comparative control (negative control), which were found to have no intestinal adhesion, were used. The viable cell count was measured by the method, and the adhesion ability was confirmed.

상기 부착능을 확인한 결과를 하기 표 6 및 표 7과 도 4에 나타내었다. 하기 표 6 및 하기 표 7에 기재된 부착세포는 세포주 당 부착세포 즉, 해당 세포주 당 부착된 유산균의 수를 나타낸 것으로, 부착된 유산균의 수를 나타낸 단위는 log CFU/well이며, 부착율은 초기세포수에 대한 부착세포수를 나타낸 것이다. The results of confirming the adhesion capacity is shown in Table 6 and Table 7 and FIG. The adherent cells described in Table 6 and Table 7 below show the number of adherent cells per cell line, that is, the number of lactic acid bacteria attached per cell line. It shows the adherent cell number against the number.

초기 측정치Initial measurement 세포주 당 부착세포수Number of adherent cells per cell line 부착율Adhesion rate L. rhamnsosus GG L. rhamnsosus GG 8.3243±0.52558.3243 ± 0.5255 5.6288±0.24755.6288 ± 0.2475 1.2912±0.21531.2912 ± 0.2153 L. L. acidophilusacidophilus 7.2715±0.73857.2715 ± 0.7385 3.3880±0.66843.3880 ± 0.6684 0.0118±0.01370.0118 ± 0.0137 F142-811F142-811 8.3111±0.08008.3111 ± 0.0800 5.696±0.21665.696 ± 0.2166 1.9666±0.91811.9666 ± 0.9181

HT-29HT-29 Gal HTGal ht 초기 세포수Initial cell count 세포주 당 부착세포수Number of adherent cells per cell line 부착율Adhesion rate 초기 세포수Initial cell count 세포주 당 부착세포수 Number of adherent cells per cell line 부착율Adhesion rate L. rhamnsosus GG L. rhamnsosus GG 7.9938
±0.2744
7.9938
± 0.2744
4.8745
±0.5702
4.8745
± 0.5702
0.0784
±0.0268
0.0784
± 0.0268
7.9212
±0.6000
7.9212
± 0.6000
5.4327
±0.2739
5.4327
± 0.2739
0.4357
±0.0741
0.4357
± 0.0741
L. L. acidophilusacidophilus 6.7285
±0.6630
6.7285
± 0.6630
2.3211
±0.9482
2.3211
± 0.9482
0.0007
±0.0011
0.0007
± 0.0011
7.1774
±0.4524
7.1774
± 0.4524
2.1809
±0.4752
2.1809
± 0.4752
0.0003
±0.0000
0.0003
± 0.0000
F142-811F142-811 8.5141±0.00008.5141 ± 0.0000 5.3174±0.05485.3174 ± 0.0548 0.2735±0.03330.2735 ± 0.0333 8.2699±0.03938.2699 ± 0.0393 6.1037±0.34316.1037 ± 0.3431 3.4177±0.02703.4177 ± 0.0270

상기 표 6 및 도 3 및 4에 나타낸 바와 같이, Caco-2에 대한 부착율은 상기 페디오코커스 펜토사케우스 균주 F142-811가 락토바실러스 람노서스 GG 보다 1.5배 정도 높았고, galHT 및 HT-29에 대해서는 락토바실러스 람노서스 GG 보다 각각 3.4배 및 7.8배 정도 높은 것으로 확인되어, 소장 및 대장 점액층에서의 부착가능성이 현저하게 우수한 것으로 확인되었다.]As shown in Table 6 and FIGS. 3 and 4, the adhesion rate to Caco-2 was about 1.5 times higher than that of the Pediococcus pentosakeus strain F142-811 than Lactobacillus rhamnosus GG, and galHT and HT-29 It was confirmed that Lactobacillus rhamnosus GG is 3.4 times higher and 7.8 times higher, respectively, and the adhesion in the small intestine and large intestine mucosa is remarkably excellent.]

상기 결과로부터, 본 발명의 균주인 페디오코커스 펜토사케우스 균주 F142-811는 내산성 및 내담즙성이 우수하여, 경구섭취 시 다량의 생균이 장내에 도착할 수 있는 것은 물로, 장내에 부착하여 활동할 수 있으므로, 프로바이오틱 미생물 또는 생균활성제로 유용하게 사용할 수 있는 것으로 확인되었다.
From the above results, pediococcus pentosakeus strain F142-811, which is a strain of the present invention, is excellent in acid resistance and bile resistance, and a large amount of live bacteria can arrive in the intestine by oral ingestion, which can be attached and act in the intestine. Therefore, it was confirmed that it can be usefully used as a probiotic microorganism or a probiotic.

<< 실시예Example 4>  4> 페디오코커스Pediocaucus 펜토사케우스Pentosakeus 균주 F142-811의 면역증강 활성 측정 Determination of immunopotentiation activity of strain F142-811

상기 생균활성제로 이용가능한 페디오코커스 펜토사케우스 균주 F142-811가 면역증강 활성이 있는지 여부를 확인하기 위하여, 상기 균주가 사이토카인, 보다 구체적으로 IL-1β 및 IL-12의 분비에 미치는 영향을 확인하였다. 상기 IL-1β 및 IL-12는 병원성 미생물에 대한 방어에 관련된 사이토카인(cytokine)이다. 또한, 병원성 미생물에 대한 면역세포의 멸균 활성과 관련하여, NO 분비량을 측정하였다.In order to determine whether the Pediococcus pentosakeus strain F142-811 available as the probiotic has immunopotentiating activity, the effect of the strain on the secretion of cytokines, more specifically IL-1β and IL-12 Confirmed. The IL-1β and IL-12 are cytokines involved in the defense against pathogenic microorganisms. In addition, in relation to the sterilizing activity of immune cells against pathogenic microorganisms, the amount of NO secretion was measured.

상기 실험은 한국세포주은행(KCLB)에서 분양받은 male mouse macrophage인 RAW264.7 세포주(cell line)를 10% FBS(Fetal Bovine Serum), 1mM sodkum pyruvate, 100IU penicillin/streptomycin, 10mM HEPES가 첨가된 DMEM high glucose(Hyclone, USA)에서 37℃ 및 5% CO2의 조건으로 2일마다 동일한 조성의 배지로 바꿔주면서 confluent state까지 배양하였다.In the experiment, RAW264.7 cell line, a male mouse macrophage distributed by KCLB, was added to DMEM high containing 10% FBS (Fetal Bovine Serum), 1 mM sodkum pyruvate, 100 IU penicillin / streptomycin, and 10 mM HEPES. In the glucose (Hyclone, USA) was changed to medium of the same composition every 2 days under conditions of 37 ℃ and 5% CO 2 and incubated to confluent state.

상기 RAW264.7 세포주를 24 well plate(Falcon CO., USA)에 각 well 당 5 X 105 cells/mL로 분주한 후, 95% 이상 생육하여 단층을 구성하도록 배양하였고, 유산균체를 혼합하기 전 PBS(pH 7.4)로 세척하였다. MRS 액체배지에 배양된 유산균 현탁액을 12,000 rpm의 조건으로 5분간 원심분리를 수행하여 균체를 회수한 후, PBS(pH 7.4)로 세척하였다. 상기 PBS로 세척한 균체를 OD600값이 1.0이 되도록 항생제가 없는 RPMI 배지에 현탁하였다. 상기 유산균 현탁액 100 μl를 항생제가 없는 RPMI 배지 0.9 ml와 혼합하고, 이를 단층을 형성한 RAW264.7 세포주와 함께 24시간 동안 37℃ 및 5% CO2의 조건으로 배양하였다.The RAW264.7 cell line was dispensed at 5 X 10 5 cells / mL per well in a 24 well plate (Falcon CO., USA), and then grown to 95% or more to form a monolayer, before mixing the lactic acid cells. Wash with PBS pH 7.4. The lactic acid bacteria suspension incubated in MRS liquid medium was centrifuged for 5 minutes under the condition of 12,000 rpm to recover the cells, and then washed with PBS (pH 7.4). The cells washed with PBS were suspended in RPMI medium without antibiotics so that the OD 600 value was 1.0. 100 μl of the lactic acid bacteria suspension was mixed with 0.9 ml of antibiotic-free RPMI medium and incubated with a monolayered RAW264.7 cell line at 37 ° C. and 5% CO 2 for 24 hours.

상기 배양한 배양액으로부터 상등액만을 수득하였다. 상기 상등액에 대해 12,000 rpm의 조건으로 5분간 원심분리를 수행하여 유산균을 제거한 후, 상등액을 회수하였다. 상기 균체를 제거한 상등액 중에 분비된 사이토카인(cytokine)의 함량은 ELISA kit(Enogen, USA)를 이용하여 측정하였으며, 그 결과를 도 5 내지 도 7에 나타내었다.Only the supernatant was obtained from the culture medium. After removing the lactic acid bacteria by centrifugation for 5 minutes under conditions of 12,000 rpm to the supernatant, the supernatant was recovered. The content of cytokines secreted in the supernatant from which the cells were removed was measured using an ELISA kit (Enogen, USA), and the results are shown in FIGS. 5 to 7.

상기 도 5 내지 도 7에 나타낸 바와 같이, 상기 페디오코커스 펜토사케우스 균주 F142-811은 사이토카인 중 IL-1β와 IL-12에 대해서 생균활성제로 기존에 보고된 락토바실러스 람노서스 GG와 유사수준의 분비 양상을 나타냈다.As shown in FIG. 5 to FIG. 7, the Pediococcus pentosakeus strain F142-811 is similar to Lactobacillus rhamnosus GG previously reported as a probiotic for IL-1β and IL-12 in cytokines. The secretion aspect was shown.

한국미생물보존센터(국내)Korea Microbial Conservation Center (Domestic) KFCC11504PKFCC11504P 2011021420110214

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (5)

김치로부터 분리되고, 살모넬라 티피뮤리움 균주(Salmonella typhymurium), 마이크로코커스 류테우스 균주(Micrococcus leteus), 바실러스 서브틸리스 균주(Bacillus subtilis), 바실러스 세레우스 균주(Bacillus cereus), 비브리오 파라헤몰리티쿠스 균주(Vibrio parahaemoliticus) 및 대장균(Escherichia coli)에 대해 항균활성을 가지며, 내산성 및 내담즙성을 가지는 기탁번호 KFCC 11504P를 갖는 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus KFCC 11504P).It is separated from Kimchi, Salmonella typhimurium strain (Salmonella typhymurium ), Micrococcus strain leteus ), Bacillus subtilis strains ( Bacillus subtilis), Bacillus cereus strains (Bacillus cereus), Vibrio para Molly Tee hee Syracuse strain (Vibrio parahaemoliticus ) and Escherichia coli) Phedi O Lactococcus pento sake mouse strain has an antibacterial activity, having an accession number of KFCC 11504P having acid resistance and resistance to biliary for (Pediococcus pentosaceus KFCC 11504P). 제1항에 있어서,
상기 페디오코커스 펜토사케우스 균주는 D-자일로스(D-Xylose), 수크로스(Sucrose), 트레할로스(Trehalose), 젠티오비오스(Gentiobiose) 및 D-타가토스(D-Tagatose)에 대한 당대사능을 가지고, 서열번호 3의 염기서열을 갖는 16S rRNA를 갖는 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus KFCC 11504P).
The method of claim 1,
The Pediococcus pentosakeus strains have the present-day capabilities for D-Xylose, Sucrose, Sucrose, Trehalose, Genentiobiose and D-Tagatose. Pediococcus pentosakeus strain having a 16S rRNA having a nucleotide sequence of SEQ ID NO: 3 pentosaceus KFCC 11504P).
제2항에 있어서,
상기 페디오코커스 펜토사케우스 균주는 면역세포로부터 인터루킨-1β 및 인터루킨-12(Interleukin-12, IL-12)의 분비를 촉진시킬 수 있는 페디오코커스 펜토사케우스 균주(Pediococcus pentosaceus KFCC 11504P).
The method of claim 2,
The Phedi O Lactococcus pento sake mouse strain from interleukin immune cells -1β and interleukin -12 (Interleukin-12, IL- 12) Phedi O Lactococcus pento sake mouse strain (Pediococcus capable of promoting the secretion of pentosaceus KFCC 11504P).
제1항의 균주, 상기 균주의 배양액, 상기 배양액의 농축액 및 상기 배양액의 건조물로 이루어지는 군에서 선택되는 1종 이상을 유효성분으로 포함하는 항균조성물.The antimicrobial composition comprising at least one selected from the group consisting of the strain of claim 1, the culture solution of the strain, the concentrate solution of the culture solution and the dried product of the culture solution. 제1항의 균주, 상기 균주의 배양액, 상기 배양액의 농축액 및 상기 배양액의 건조물로 이루어지는 군에서 선택되는 1종 이상을 유효성분으로 포함하는 생균 활성제.Probiotic active agent comprising at least one member selected from the group consisting of the strain of claim 1, the culture medium of the strain, the concentrated solution of the culture medium and the dried product of the culture solution.
KR1020110055349A 2011-06-08 2011-06-08 Lactic acid bacterium separated from kimchii and uses thereof KR101194795B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110055349A KR101194795B1 (en) 2011-06-08 2011-06-08 Lactic acid bacterium separated from kimchii and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110055349A KR101194795B1 (en) 2011-06-08 2011-06-08 Lactic acid bacterium separated from kimchii and uses thereof

Publications (1)

Publication Number Publication Date
KR101194795B1 true KR101194795B1 (en) 2012-10-25

Family

ID=47288755

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110055349A KR101194795B1 (en) 2011-06-08 2011-06-08 Lactic acid bacterium separated from kimchii and uses thereof

Country Status (1)

Country Link
KR (1) KR101194795B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190070673A (en) * 2017-12-13 2019-06-21 대한민국(환경부 국립생물자원관장) Pediococcus pentosaceus having antibacterial activity and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100991456B1 (en) 2008-06-24 2010-11-04 목포대학교산학협력단 Lactic acid bacterium separated from kimchii and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100991456B1 (en) 2008-06-24 2010-11-04 목포대학교산학협력단 Lactic acid bacterium separated from kimchii and uses thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190070673A (en) * 2017-12-13 2019-06-21 대한민국(환경부 국립생물자원관장) Pediococcus pentosaceus having antibacterial activity and uses thereof
KR102052047B1 (en) * 2017-12-13 2019-12-04 대한민국(환경부 국립생물자원관장) Pediococcus pentosaceus having antibacterial activity and uses thereof

Similar Documents

Publication Publication Date Title
KR100911115B1 (en) Novel lactic acid bacteria having acid resistance, bile-salt resistance and anti-bacterial effect and composition containing the same
US10251920B2 (en) Bacteria isolated from fresh honey or the honey producing tract of honey bees
KR101836862B1 (en) Novel lactobacillus classified as lactobacillus plantarum, and use thereof
KR101124056B1 (en) Planted origine Lactobacillus plantarum DSR CK10, DSR M2 to keep freshness and use thereof
WO2013155468A2 (en) Microbial strains and their use in animals
KR101271379B1 (en) Lactic acid bacterium having immunoregulatory activity derived from moromi for wine fermentation
KR102032703B1 (en) Method for producing aronia fermentation product using Lactobacillus plantarum MIFI-SY3 strain
Asghar et al. Selection, characterisation and evaluation of potential probiotic Lactobacillus spp. isolated from poultry droppings
KR20080109585A (en) Novel plant origin lactic acid bacteria having acid resistance, bile salt-resistance, salt-resistance and anti-bacterial effect and composition containing the same
KR101381547B1 (en) Novel Leuconostoc mesenteroides from kimchi with inhibiting activities on pathogenic microorganism and use thereof
KR101005747B1 (en) Lactic acid bacterium separated from kimchii and uses thereof
KR100991456B1 (en) Lactic acid bacterium separated from kimchii and uses thereof
KR102155849B1 (en) Lactobacillus plantarum SRCM102369 strain having antimicrobial activity against pathogenic microorganism and lactic acid production ability and uses thereof
KR101580616B1 (en) Bacillus methylotrophicus C14 strain having acid-resistance, bile acid-resistance and antimicrobial activity and uses thereof
KR101834231B1 (en) Vegetable Lactobacillus plantarum DSR KF15 having Activities on Antimicrobial And Antifungal for keeping freshness and Use Thereof
KR101566989B1 (en) Lactic acid bacterium having activity of lowering blood cholesterol level separated from kimchii and uses thereof
KR100864006B1 (en) Lactic acid bacteria separated from kimchi and uses thereof
JP2019187251A (en) Method for producing fermentation product and fermentation product
KR101194798B1 (en) Lactic acid bacterium separated from kimchii and uses thereof
KR100763037B1 (en) Novel lactobacillus rhamnosus strain and uses thereof
KR101302465B1 (en) Lactic acid bacterium separated from kimchii and fermented food using the strain
KR100945310B1 (en) Lactic acid bacteria separated from kimchi and ?-aminobutyric acid produced thereby
KR101194795B1 (en) Lactic acid bacterium separated from kimchii and uses thereof
KR20100076540A (en) Plant media, plant excipient composition and preparation method for powder fermented by plant origin lactic acid bacteria using the same
Lavanya et al. Isolation and characterization of probiotic bacteria from the soil samples of the coastal areas of (Gudur division, Nellore Dt.) for utilization in Shrimp farming

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20151002

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20161018

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20171020

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20180928

Year of fee payment: 7