KR101186264B1 - A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom - Google Patents

Abstract

The present invention relates to a composition for the prophylaxis or treatment of diseases or rhinovirus infectious diseases mediated by IL-6, including a mountain extract or compounds isolated therefrom. By including 3-glucoside-7-rhamnoside as an active ingredient, it is possible to specifically inhibit the IL-6-induced signaling system and to prevent and treat IL-6-mediated diseases. The present invention relates to a composition capable of preventing and treating an infectious disease.

Hawthorn Extract, Quecetin 3-Glucoside-7-Rhamnoside, Inflammatory Disease, Rhinovirus, IL-6

Description

Composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom}

The present invention includes a quince extract or Quecetin 3-glucoside-7-rhamnoside isolated from it as an active ingredient, specifically inhibiting the signaling system induced by IL-6 and mediated by IL-6. For preventing or treating a disease or rhinovirus infectious disease mediated by IL-6, which includes a berry extract or a compound isolated therefrom that can prevent and treat a disease, as well as prevent and treat infectious diseases of rhinoviruses. Relates to a composition

Human rhinovirus (HRV) is known to be the most common asthma exacerbation factor, and human rhinoviruses are also known to be present in the bronchial tissues of many stable asthmatic patients.

As a result of bronchial mucosal biopsy specimens from asthmatic and non-asthmatic patients, the incidence of human rhinoviruses in the lower respiratory tract tissues was significantly higher in the asthma group than in the asthma group. There is also a report that correlates with clinical severity.

Human rhinovirus positive patients are known to have symptoms such as decreased lung function, increased numbers of eosinophils and lymphocytes, and infiltration of eosinophils in the bronchial mucosa. Asthma patients with stable asthma symptoms and no clinical signs of upper respiratory tract infections also show that human rhinoviruses are involved in chronic inflammation of the lower respiratory tract.

Bronchial mucosa samples were taken from 30 asthma patients (7 of them, aspirin-sensitive asthma) and 23 controls, and analyzed using in situ reverse transcription polymerase chain reaction (RT-PCR). The control group was 22%, whereas the asthma group was 73%. There was a statistically significant difference (P <0.001) between the two groups. In this test, the staining pattern of the specimen was divided into exactly two types. The staining range is limited to the mucosal surface and is a 'confined' form with distinctly outlined spots and a 'diffuse' form that appears throughout the sample and is not limited to some.

In addition, human rhinovirus positive cells appeared not only in the mucosal epidermis but also in the subdermal layer. There was a relationship between positive human rhinoviruses, the number of white blood cells in peripheral blood, and the number of polymorphic nuclear lymphocytes, respectively. On the other hand, there was an inverse relationship between the signal score of human rhinovirus and the lymphocyte count in peripheral blood. Human rhinoviruses can cause asthma attacks, pneumonia, sinusitis and otitis media in addition to cold symptoms.

Recently, a genetic map of human rhinoviruses has been reported. Co-working with the University of Wisconsin-Madison, the University of Maryland, and the Craig Venter Institute, the researchers completed a genetic map of 99 variants of human rhinoviruses. Human rhinoviruses have been found to be surprisingly complex, with two strains in the body infecting one patient at the same time, exchanging genetic material in the patient's body to create a completely new strain. As a result, human rhinoviruses can be divided into A, B, and C groups, among which C group has been reported to penetrate to the lung end. There are so many strains of the virus that it is difficult to make a vaccine against each strain, but the fact that the virus's internal components are so similar regardless of the strain suggests the possibility of developing cold medicines targeting common factors (Science, Felmanberg, February 12, 2009).

Hippophae rhamnoides is a plant of the family Liliaceae, a shrub that resembles a willow tree and grows female and female separately. It grows in various regions within 2-69 degrees east longitude and 27-69 degrees north latitude. Mountain hawthorn is commonly known as Seabuckthorn, grows up to 2.5m in height, and leaves are narrow in width and silver underside. Fruits are ball-shaped, orangeish yellow, about 8mm in diameter. It is found in the sand dunes along the eastern and southeastern coasts of England, and is also prevalent in mountainous regions in Europe and Asia. It is a plant that lives in low temperature and barren areas such as China's Inner Mongolia and Russia's Siberia and Canada's backcountry.

The pharmacological activity of plant-derived flavonoids and glycated flavonoids is well known ( Journal of antimicrobial chemotherapy , LC Chiang, W. Chiang, MC Liu and CC Lin, Vol. 52, pp 194-198, 2003). Flavonoids have antiviral effects against herpes and adenoviruses, and biflavonoid compounds such as robustaflavones have been reported to have inhibitory effects against influenza viruses ( Planta Medica , Vol. 65, pp 120-125). However, the antiviral effect was not excellent.

By various researchers Many studies have been conducted on the active ingredient of mountain hawthorn. In particular, the quantitative and qualitative analysis of the content of various natural batamines (A, B, C, E, P, K) in the hawthorn fruit were analyzed, and the contents of various amino acids and various useful metals were analyzed. In addition, research on the content of various nutrients and physical properties related to fruit as a basic data for the use of the fruit of the coriander ( J. Agric. Food Chem. , Vol . 47, pp 3480 ~ 3488). And mainly in China, the hawthorn Hippophae rhamnoides ssp. sinensis 15 species, Hippophae rhamnoides ssp. yunnanensis 7 species, Hippophae rhamnoides ssp. wolongensis 5 species, Hippophae rhamnoides ssp. stellatopilosa 4, Hippophae rhamnoides ssp. Flavonoids derived from three tibetana species were classified into 12 flavonoids by HPLC standardization and reported their diversity ( J. of Chromatography A , Chu Chen, 1154, pp 250-259). In addition, we analyzed the content of 12 flavonoids isolated from various hawthorn trees growing in various regions, especially in China. Quercetin 3-O-sophoroside-7-rhamnoside and quenoside were compared. Cetine 3-O-Lutinoside, Quecetin 3-O-Glucoside, Quecetin, Camperol 3-O-Sophoroside-7-Rhamnoside, Camperol 7-O-Rhamnoside, Camphorol, Isolehaminetin , Isorhamnetine 3-O-sophoroside-7-rhamnoside, isorhamnetine 3-O-lutinoside, isorhamnetine 3-O-glucoside, isorhamnetine 3-O-glucoside-7-rhamnoside Reported on.

Cytokines are polypeptides or glycoproteins involved in cell proliferation, differentiation, activation, etc. secreted by various kinds of cells in vivo and play an important role in immune and inflammatory responses. Symptoms of various autoimmune diseases vary widely, but one of the common etiologies is the production of several cytokines that regulate immune responses, tissue damage and recovery. The expression of inflammatory cytokines IL-1α, IL-β, TNFα, IL-6, IL-12 is increased in lesion tissue of inflammatory diseases. In addition, TNFα, IL-1, IL-6, IL-10, IFNα, IFNγ are increased in the serum of lupus patients, and TNFα, IL-1, IL-2, IL-6 in the salivary glands of patients with Shegran syndrome. , IL-10, TGFβ expression has been reported.

In particular, IL-6 is a cytokine that is important in representative inflammatory diseases, autoimmune diseases and cancer cells, and performs various functions in various organs. IL-6 is known to be expressed in many cell types and is typically involved in various biological functions such as immune response, inflammation, hematopoietic process, cell proliferation and differentiation (Naka et al. 2002). The action of IL-6 is mediated by receptors. Two types of receptors, IL-6R-specific receptors, IL-6R and gp130, a common receptor of the IL-6 family, act as a complex receptor for IL-6. IL-6 first binds to IL-6R, and the complex of IL-6 and IL-6R in turn binds to two gp130s to form an active receptor complex that initiates signaling into cells (Hirano et al. 1997). . Janus Kinases 2 (JAK2) is activated by transphosphorylation. Activated JAK2 phosphorylates several tyrosine residues in the receptor cytoplasmic domains, which are signal transducers and STAT3 with SH ₂ or other phosphotyrosine binding motifs. It acts as a docking site for proteins in the cytoplasm, such as activators of transcription. STAT3, which binds to the cytoplasmic region of the receptor, is phosphorylated by JAK2 and then released from the receptor. Activated STAT3s bind to each other in the cytoplasm to form a homodimer or heterodimer and then enter the nucleus to bind to the recognition sequence of the target gene to increase transcription. , DE, et al., Nat Rev Mol Cell Biol , 2002, 3, 651-62, Darnell, JE, Jr, Science , 1997, 277, 1630-1635).

In particular, STAT3, an intermediary messenger of the IL-6 signaling pathway, includes myeloma, breast carcinoma, prostate cancer, brain tumor, head and neck carcinoma, melanoma, leukemia and lymphoma, especially chronic myeloid leukemia and multiple myeloma Has been reported to be involved in several types of cancer (Niu et al . , Cancer Res. , 1999, 59, 5059-5063). Cells derived from both rat and human prostate cancer have been found to have structurally activated STAT3, which has been shown to affect some acute leukemias (Gouilleux-Gruart, V. et al., Leuk . Lymphoma , 1997, 28, 83-88) and It has been shown to be structurally activated in T cell lymphoma (Yu, CL et al., J. Immunol ., 1997, 159, 5206-5210). Interestingly, STAT3 has been shown to be structurally phosphorylated on serine residues in chronic lymphocytic leukemia (Frank, DA et al . , J. Clin. Invest. , 1997, 100, 3140-3148). STAT3 has been shown to be structurally active in myeloma tumor cells, in both myeloid mononuclear cells and cultures from patients with multiple myeloma. These cells are resistant to Fas-mediated cell death and express high levels of Bcl-xL. STAT3 signaling has been shown to be essential for the survival of myeloma tumor cells by conferring resistance to apoptosis (Catlett-Falcone, R. et al., Immunity , 1999, 10, 105-115).

Accordingly, the present inventors have tried to develop an agent capable of effectively inhibiting viral infection diseases as well as inhibiting the IL-6 signaling system. As a result, the extract of hawthorn or quercetin 3-glucoside-7-rhamno isolated therefrom It was confirmed that the side compound can effectively prevent and treat such diseases, and completed the present invention.

The present invention includes an extract of hawthorn or quercetin 3-glucoside-7-rhamnoside isolated from the extract as an active ingredient, specifically inhibiting the signaling system induced by IL-6 and mediated by IL-6. It is an object of the present invention to provide a composition for preventing or treating a disease, as well as for preventing or treating an infectious disease of rhinoviruses, and for preventing or treating an IL-6-mediated disease or rhinovirus infectious disease.

In one aspect, the present invention provides a composition for the prevention or treatment of diseases mediated by IL-6, including an extract of Hippophae rhamnoides .

The hawthorn extract of the present invention may preferably be an extract of hawthorn fruit or leaves, but is not limited thereto.

In the present invention, the hawthorn extract may be extracted with water, methanol, ethanol, lower alcohols such as C ₁ to C ₄ or a mixed solvent thereof. Preferably the extract is extracted with ethanol, most preferably the extract is 10 to 100% ethanol extract.

In addition, the extract of the present invention may include any one or more of the extract obtained by the extraction treatment, the dilution or concentrate of the extract, the dried product obtained by drying the extract, and these modifiers or purified products.

As another aspect, the present invention is a disease mediated by IL-6 comprising a quercetin 3-O-glucoside-7-rhamniside represented by the following formula (1) as an active ingredient It provides a composition for the prevention or treatment of.

The quercetin 3-glucoside-7-rhamnoside compound of the present invention is preferably obtained by extracting, separating and purifying from a hawthorn, but is not limited thereto. That is, the compound may be obtained by extraction, separation and purification from other raw materials, may be prepared by a known synthesis method, or may be used as a commercial reagent.

The hawthorn extract and quercetin 3-glucoside-7-rhamnoside of the present invention have activity to inhibit IL-6 signaling system.

IL-6 is a cytokine that is important in representative inflammatory diseases, autoimmune diseases and cancer cells, and performs various functions in various organs. IL-6 is known to be expressed in many cell types and is typically involved in various biological functions such as immune response, inflammation, hematopoietic process, cell proliferation and differentiation.

The hawthorn extract and quercetin 3-glucoside-7-rhamnoside have the activity of inhibiting the signaling system of IL-6, and thus are effective in preventing and treating diseases mediated by IL-6.

The IL-6-mediated disease of the present invention may be an inflammatory disease, an autoimmune disease and cancer, specifically, asthma, psoriasis, atopy, osteoporosis, lupus, Crohn's disease, vascular stenosis, cancer metastasis, transplant rejection, arthritis, Alzheimer's disease , Myeloma, breast carcinoma, prostate cancer, brain tumor, head and neck carcinoma, melanoma, leukemia, multiple myeloma. However, the present invention is not limited thereto, and diseases related to inflammatory diseases, autoimmune diseases or cancers, which are commonly known, may be included in the scope of the present invention.

As another aspect, the present invention provides a composition for preventing or treating viral infectious diseases, particularly rhinovirus infectious diseases, which can inhibit the proliferation of rhinoviruses, by including the extract of the hawthorn.

As another aspect, the present invention provides a composition for the prevention and treatment of rhinovirus infectious diseases by using quercetin 3-glucoside-7-rhamnoside as an active ingredient.

The effective dose of the quercetin 3-glucoside-7-rhamnoside of the present invention is generally 1 to 100 mg / day, preferably 5 to 20 mg / day, per kg of adult patient. Dosage levels for a particular patient may vary as appropriate depending on gender, age, health condition, diet, time of administration, method of administration, drug mixture and severity of disease. Thus, the dosage amounts are not intended to limit the scope of the invention in any manner.

The composition comprising the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention may be a pharmaceutical composition.

In the present invention, the quercetin 3-glucoside-7-rhamside compound can be used in the form of a pharmaceutically acceptable salt, and includes all salts, hydrates and solvates prepared by conventional methods.

Salts are useful as acid addition salts formed by pharmaceutically acceptable free acids. Acid addition salts are prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent (eg, methanol, ethanol, acetone or acetonitrile). Equivalent molar amounts of the compound and acid or alcohol (eg, glycol monomethylether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.

In this case, inorganic acids and organic acids may be used as the free acid, and hydrochloric acid, bromic acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. may be used as the inorganic acid, and citric acid, acetic acid, lactic acid, tartaric acid ( tartaric acid), maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, methanesulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, galtuuronic acid, Embon acid, glutamic acid or aspartic acid, etc. can be used, but it is not limited to these.

In addition, bases can be used to make pharmaceutically acceptable metal salts. Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and then evaporating and drying the filtrate. In this case, as the metal salt, it is particularly suitable to prepare sodium, potassium or calcium salt, but is not limited thereto. Corresponding silver salts can also be obtained by reacting alkali or alkaline earth metal salts with a suitable silver salt (eg, silver nitrate).

The pharmaceutical composition according to the present invention may be administered in various oral or parenteral dosage forms at the time of clinical administration, and when formulated, diluents and excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. To use.

Solid form preparations for oral administration include tablets, troches, lozenges, aqueous or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs, and the like. Binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin for preparation in formulations such as tablets and capsules; Excipients such as dicalcium phosphate; Disintegrants such as corn starch or sweet potato starch; Lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax. In the case of capsule formulations, in addition to the substances mentioned above, they contain a liquid carrier such as fatty oil.

Parenteral administration may also be subcutaneous, intravenous, intramuscular or intrathoracic infusion. In order to formulate into a parenteral formulation, the compound of Formula 1 is prepared as a solution or suspension by mixing a stabilizer, a buffer, a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized agent, a suppository, and the like, and an ampoule. Formulated in unit dosage form as a vial. As the non-aqueous solvent and suspending agent, vegetable oils such as propylene glycol, polyethylene glycol and olive oil, injectable esters such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

The composition comprising the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention may be a food composition.

Ingredients commonly added in food production include, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. Examples of the carbohydrates described above include monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, oligosaccharides, etc.) and polysaccharides (eg, dextrins, cyclodextrins). And other sugars such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents (e.g., stevia extracts such as taumartin, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (e.g., saccharin, aspartame, etc.) can be used.

In another aspect, the present invention provides a method for separating and purifying quercetin 3-glucoside-7-rhamnoside from a hawthorn. Specifically, the separation and purification method is as follows.

First, an ethanol extract is prepared from the hawthorn, and concentrated under reduced pressure to obtain a fraction. And chromatography is performed on the fraction using methanol as a solvent to obtain an active fraction having an IL-6 signaling system inhibitory activity. Finally, the active fraction is separated by high performance liquid chromatography to obtain quercetin 3-glucoside-7-rhamnoside.

Therefore, the composition of the present invention includes a hawthorn extract or quercetin 3-glucoside-7-rhamnoside isolated from the extract as an active ingredient, thereby signaling as an important mediator of inflammatory diseases, autoimmune diseases or cancer. By inhibiting the binding of the acting IL-6 receptor has the effect of preventing and treating diseases mediated by IL-6.

In addition, the composition of the present invention includes the extract of the hawthorn or quercetin 3-glucoside-7-rhamnoside isolated from the active ingredient, there is an effect that can prevent and treat infectious diseases of rhinoviruses.

In addition, since the composition of the present invention is a low-molecular compound rather than a protein, there is an effect that the usability in the pharmaceutical industry is greater than that of the neutralizing antibody of the protein used as a conventional medicine.

The terms and words used in the present specification and claims should not be construed as limited to ordinary or dictionary terms and the inventor may appropriately define the concept of the term in order to best describe its invention It should be construed as meaning and concept consistent with the technical idea of the present invention.

Therefore, the embodiments described in this specification and the configurations shown in the drawings are merely the most preferred embodiments of the present invention and do not represent all the technical ideas of the present invention. Therefore, It is to be understood that equivalents and modifications are possible.

Hereinafter, the present invention will be described in more detail based on the following examples, but the present invention is not limited thereto.

Example 1 Isolation and Purification of Quecetin 3-Glucoside-7-Rhamnoside

4L of 100% ethanol was added to 1 kg of dried hawthorn fruit, and extracted for 72 hours at room temperature where light was blocked to prepare an ethanol extract, and then concentrated under reduced pressure to obtain a fraction. Actually, when extracting the active substance for animal experiments, the extract was extracted for 72 hours in a cool dark place using 95% alcohol, and then concentrated under reduced pressure.

In order to separate the pure active substance, the concentrated fractions were dissolved in methanol, and then chromatographed using methanol as a solvent in Sephadex LH-20. Then, an active fraction having an activity that inhibits IL-6 signaling system was collected and concentrated under reduced pressure.

The active fraction was subjected to high performance liquid chromatography (column: C18, flow rate: 1.5 mL / min, 220 nm detection) using a water-methanol (40% methanol) eluting solvent. At this time, the active fraction was separated for 17 minutes in the holding time, and dried under reduced pressure to obtain 998 mg of the compound represented by the formula (1).

Example 2 Physicochemical Characterization of Quecetin 3-Glucoside-7-Rhamnoside

In Example 1, the physical and chemical properties of the purely separated and purified compounds were analyzed. In order to measure the molecular weight of the compound, ESI-MS (electrospray ionization mass spectrometry, Fisons VG Quattro 400 mass spectrometer, USA) was used, and nuclear magnetic resonance (NMR) method was used to identify the structure.

As a result of analyzing the property, molecular weight, molecular formula and mass of the compound, the properties of the compound according to the present invention are attached to the container in a thin film form, and the mass spectrometry (M + H) ⁺ of the compound is Measured at 611 m / z, (M + Na) ⁺ was measured at 633 m / z molecular weight of the compound represented by the formula (1) was confirmed as 610, the molecular formula was estimated to C ₂₇ H ₃ 0O ₁₆ (Fig. 1).

The compound was dissolved in DMSO d- 6, placed in a 5 mm NMR tube, and hydrogen and carbon nuclear magnetic resonance were measured. The peak of each solvent was measured as an internal standard or based on the peak of TMS (tetramethylsilane).

Hydrogen nuclear magnetic resonance spectra (FIG. 2), carbon nuclear magnetic resonance spectra (FIG. 3), DEPT spectra (FIG. 4) were analyzed to examine the structure of the compound.The compound was quercetin 3-glucoside-7-rhamnoside. (As identified by Romani A. et al 2000, J. Agric Food. Chem 48 (9) 4091-4096).

Example 3 Assay of IL-6 Inhibitory Activity of Sanjay Extract and Quecetin 3-Glucoside-7-Rhamnoside

pSTAT3-TA-Luc plasmid (Clontech, Palo Alto, Calif.) was used as template. STAT3 DNA binding using oligonucleotides [AGAGGGTAAC GGTACC GTGCTTCCCGAA CGTTGCTTCC (containing Kpn I site)] and oligonucleotides [GTACGCAAGG CTCGAG CTACGTTCGGGAAGCAACGTTC (containing Xho I site)] as forward and reverse primers, respectively. The sequence was amplified with a thermocycler.

The amplified PCR product was cloned, isolated and inserted into the Kpn I / Xho I site of the pSTAT3-TA-Luc plasmid. And a pSTAT3-TA-Luc6 construct was prepared that enables enhanced STAT3 reporter gene assay over pSTAT-3-TA-Luc, including at least eight copies of the STAT3 DNA binding sequence.

IL-6 reactive STAT3 reporter gene analysis was performed on HepG2 cells (ATCC; HB-8065) with 10% Fotal Bovine Serum (FBS) (v / v), kanamycin sulfate (60.0 mg / l) and sodium bicarbonate (NaHCO _3). ) Using a DMEM culture medium containing 2.0g / l, it was incubated at 37 ℃ 5% CO ₂ conditions. HepG2 cells were dispensed at 5 × 10 ⁴ cells / well in 96 well plates and grown to 80% fusion. Subsequently, it was exchanged with 50 µl of serum-free medium, and a mixture of 0.1 µg pSTAT3-TA-Luc6 construct and 0.3 µl lipofectamin reagent was added to each well and reacted for 3 hours to generate pSTAT3-TA-Luc6 construct. Was transfected (infection of cells of the isolated nucleic acid).

Thereafter, the medium was changed to 200 µl of clean culture medium and incubated for 24 hours to complete the transient transfection. Transfected cells were cultured under 1% BSA / DMEM under nutritional deficiency (serum starvation), treated with hawthorn extract or quercetin 3-glucoside-7-rhamnoside for 1 hour, and then IL-3 was added to Time incubation. Rinse with PBS, add 50 μl of lysis buffer (promega luciferase assay system) and stir for 1 minute. Then, 30-100 μl of luciferase assay (promega luciferase assay system) was added thereto and measured in 5 minutes with a luminometer.

Table 1 below shows the degree of inhibition of IL-6 mediated luciferase at different concentrations of quercetin 3-glucoside-7-rhamnoside (100, 30, 10, 3 or 1 μg / ml).

Test substance Concentration (µg / ml) Average (RLU) ± Standard deviation (stdv) % Suppression
Quercetin 3-glucoside-7-rhamnoside 100 13922.12 26.9 56.37 30 19528.98 993.5 35.56 10 22723.56 1133.5 23.71 3 25679.02 284.3 12.75 One 29048.29 1830.0 0.24

As can be seen from Table 1, when treated with quercetin 3-glucoside-7-rhamnoside extracted from the hawthorn, the compound inhibited IL-6 mediated luciferase concentration-dependently at each concentration, according to the calculation The concentration of the compound that inhibited 50% was 43.37 μg / ml.

Example 4 Evaluation of Viral Proliferation Inhibitory Activity of the Extract of Hawthorn and Quercetin 3-Glucoside-7-Rhamnoside

Rhinovirus (rhinovirus) was used to measure the virus proliferation inhibitory effect on the hawthorn extract or quercetin 3-glucoside-7-rhamnoside obtained in Example 1.

The rhinoviruses were infected with HeLa cells to proliferate. HeLa cells were cultured in a 37 ° C. incubator using MEM medium medium containing 10% of pediatric serum. The medium used for virus growth and antiviral activity was culture medium containing 20 mM MgCl ₂ in 1% serum.

2 × 10 ⁴ HeLa cells were placed in each well of a 96 well plate and incubated for 24 hours. After 24 hours, the culture supernatant of each well was removed, and rhinovirus infection solution titrated with TCID ₅₀ was added to each well.

Then, test substances were administered to each well such that the final concentration was 100, 10, 1 or 0.1 µg / ml, respectively. Viral proliferation inhibition for each sample was measured after 48 hours by the SRB assay (Choi et al., 2009). 100 μl of 70% acetone was added to each well, and then left at −20 ° C. for 1 hour and washed several times with distilled water. After drying at room temperature, 100 μl of 0.4% (w / v) sulforhodamine B (SRB) solution dissolved in 1% (v / v) acetic acid was added and stained for 30 minutes. SRB stains that did not bind to cells were washed several times with 1% (v / v) acetic acid and then dried again. 100 μl of 10 mM Tris solution (pH 10.5) was added to each well to sufficiently dissolve the dye bound to the cells, and the absorbance was measured at 562 nm.

Each treatment group was labeled as a group not treated with virus (A), a group treated only with test substance (B), a group treated with virus only (C), and a group treated with a virus and test substance (D). Comparative cell growth rate (%) (Equation 1) and proliferative inhibitory activity (%) for virus (Equation 2) were calculated for the samples. At this time, as the test material, the ethanol extract of the hawthorn, quercetin 3-glucoside-7-rhamnoside, quercetin, rutin, quercetin 3-rhamnoside, quercetin 3-glucoside, genistin, and ribavirin were used.

The values calculated from the mean and standard deviation of the three experimental results under the same conditions are presented. The cytotoxicity of the test material was compared with cells of wells without test material at concentrations of 100, 10, 1 or 0.1 μg / ml.

Table 2 below shows the experimental results of the virus growth inhibitory ability (HRV3 virus in the HeLa cell line) of the hawthorn extract or quercetin 3-glucoside-7-rhamnoside.

Test substance CC ₅₀ ^a IC ₅₀ ^b TI ^c Hawthorn Ethanol Extract > 100 3.35 ± 3.08 > 29.85 Quercetin 3-glucoside-7-rhamnoside > 100 0.53 ± 0.12 > 188.68 Quercetin > 100 ND ^d - Routine > 100 ND ^d - Quercetin 3-Rhamnoside > 100 ND ^d - Quercetin 3-glucoside > 100 ND ^d - Jennysteen > 100 91.55 ± 0.88 > 1.09 Ribavirin > 100 86.34 ± 4.09 > 1.16

[Note] The IC ₅₀ results are the average of three replicates of independent experiments.

     a: Sample concentration (/ ml) to reduce HeLa cells by 50%.

b: cell lesions 50% reduction in sample concentration (CPE) (/ ml).

c: antiviral activity = CC ₅₀ / IC ₅₀ .

d: means that the IC ₅₀ value is not measured within the concentration of the test substance for this experiment due to the maximum inhibition rate of 50% or less.

As can be seen from Table 2, in order to determine the virus growth inhibitory effect by the extract of the hawthorn and quercetin 3-glucoside-7-rhamnoside separated from it during the propagation culture of rhinoviruses infected with HeLa cells As a result of processing the samples by concentration, the virus growth inhibitory ability was measured.As a result, more than 25 times more of the active substance, Quercetin 3-glucoside-7-rhamno, was extracted from the extract of the hawthorn than Genistin and Ribavirin. Said showed more than 180-fold virus growth inhibition.

Example 5 Acute Toxicity Test of Oral Administration of Cypress Extract and Quecetin 3-Glucoside-7-Rhamnoside on Experimental Mice

SD rats used in this test had a temperature of 23 ± 3 ° C, a relative humidity of 50 ± 10%, an illumination time of 12 hours (6 am to 6 pm), a ventilation frequency of 10 to 20 times / hour and an illuminance of 150 The animal was bred in the laboratory animal building of Korea Research Institute of Bioscience and Biotechnology, set at ~ 300 lux. The test subjects all wore working clothes, hoods, masks and gloves that had been autoclaved (121 ° C., 20 minutes).

The rats were housed in polycarbonate shoeboxes (260W × 410L × 200Hmm) during the purifying and quarantine periods, and one by one in wire cages (205W × 350L × 175Hmm) during the administration and observation periods. During the trial period, breeding boxes were identified by labeling with test and animal numbers.

Six-week-old SPF rats were divided into five rats per group, and the dose of 10 mg / kg was determined by suspending the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention in a 0.5% methylcellulose solution. Single oral administration. After administration, mortality, clinical symptoms, and changes in body weight were observed. Hematological and hematological examinations were performed. Necropsy was performed to visually observe abdominal and thoracic organ abnormalities.

As a result, remarkable clinical symptoms or no dead animals were observed in the animal treated with the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention. In addition, no toxic changes were observed in body weight changes, blood tests, blood biochemical tests, and autopsy findings.

The quercetin 3-glucoside-7-rhamnoside compound administered showed no toxicity change to 10 mg / kg in rats, and the minimum lethal dose (LD ₅₀ ) for oral administration was determined to be 10 mg / kg or more.

Although the present invention has been shown and described with reference to the preferred embodiments as described above, it is not limited to the above embodiments and those skilled in the art without departing from the spirit of the present invention. Various changes and modifications will be possible.

1 is a molecular weight spectrum of quercetin 3-glucoside-7-rhamnoside according to the present invention.

Figure 2 shows the hydrogen nuclear magnetic resonance spectrum (DMSO d- 6, 300MHz) of the quercetin 3-glucoside-7-rhamnoside according to the present invention.

Figure 3 shows the carbon nuclear magnetic resonance spectrum (DMSO d- 6, 75MHz) of the quercetin 3-glucoside-7-rhamnoside according to the present invention.

Figure 4 shows the DEPT spectrum (DMSO d- 6, 75 MHz) of quercetin 3-glucoside-7-rhamnoside according to the present invention.

<110> Korea Research Institute of Bioscience and Biotechnology <120> A composition for diseases mediated by IL-6 or rhinovirus          infectious diseases comprising an extract of Hippophae rhamnoides          or a compound isolated therefrom <130> PA090147 / KR <160> 2 <170> Kopatentin 1.71 <210> 1 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for STAT3 <400> 1 agagggtaac ggtaccgtgc ttcccgaacg ttgcttcc 38 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for STAT3 <400> 2 gtacgcaagg ctcgagctac gttcgggaag caacgttc 38  

Claims (22)

Pharmaceutical composition for the prevention or treatment of inflammatory diseases, autoimmune diseases or cancer comprising the extract of Hippophae rhamnoides . The method of claim 1, The extract is a ethanol extract pharmaceutical composition. The method of claim 1, The extract is a pharmaceutical composition having an activity that inhibits IL-6 signaling system. delete The method of claim 1, The inflammatory disease, autoimmune disease or cancer is asthma, psoriasis, atopy, osteoporosis, lupus, Crohn's disease, vascular stenosis, cancer metastasis, transplant rejection, arthritis, Alzheimer's, myeloma, breast carcinoma, prostate cancer, brain tumor, head and neck cancer, melanoma , Leukemia, multiple myeloma. delete Food composition for the prevention or improvement of inflammatory diseases, autoimmune diseases or cancer comprising an extract of Hippophae rhamnoides . A pharmaceutical composition for preventing or treating inflammatory diseases, autoimmune diseases or cancer comprising quercetin 3-glucoside-7-rhamnoside represented by the following Formula 1 as an active ingredient. [Formula 1]

9. The method of claim 8, Wherein the quercetin 3-glucoside-7-rhamside is isolated from a hawthorn. delete 9. The method of claim 8, The inflammatory disease, autoimmune disease or cancer is asthma, psoriasis, atopy, osteoporosis, lupus, Crohn's disease, vascular stenosis, cancer metastasis, transplant rejection, arthritis, Alzheimer's, myeloma, breast carcinoma, prostate cancer, brain tumor, head and neck cancer, melanoma , Leukemia, multiple myeloma. delete Food composition for the prevention or improvement of inflammatory diseases, autoimmune diseases or cancer comprising quercetin 3-glucoside-7-rhamnoside represented by the formula (1) as an active ingredient. [Formula 1]

delete delete delete delete delete delete delete delete Preparing an ethanol extract from the hawthorn, and concentrating under reduced pressure to obtain a fraction; Chromatographing the fractions using methanol as a solvent to obtain an active fraction having an IL-6 signaling system inhibitory activity; And Separating the active fraction by high-performance liquid chromatography to obtain the quercetin 3-glucoside-7-rhamnoside comprising the step of separating the quercetin 3-glucoside-7-rhamnoside from the mountain.

Images