KR101186264B1 - A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom - Google Patents
A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom Download PDFInfo
- Publication number
- KR101186264B1 KR101186264B1 KR1020090052446A KR20090052446A KR101186264B1 KR 101186264 B1 KR101186264 B1 KR 101186264B1 KR 1020090052446 A KR1020090052446 A KR 1020090052446A KR 20090052446 A KR20090052446 A KR 20090052446A KR 101186264 B1 KR101186264 B1 KR 101186264B1
- Authority
- KR
- South Korea
- Prior art keywords
- extract
- glucoside
- cancer
- quercetin
- rhamnoside
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
Abstract
본 발명은 산자나무 추출물 또는 이로부터 분리된 화합물을 포함하는 IL-6으로 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물에 관한 것으로, 보다 자세하게는 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함함으로써, 특이적으로 IL-6에 의해 유도되는 신호전달체계를 저해하여 IL-6으로 매개되는 질환을 예방하고 치료할 수 있음은 물론, 라이노바이러스의 감염성 질환을 예방하고 치료할 수 있는 조성물에 관한 것이다.The present invention relates to a composition for the prophylaxis or treatment of diseases or rhinovirus infectious diseases mediated by IL-6, including a mountain extract or compounds isolated therefrom. By including 3-glucoside-7-rhamnoside as an active ingredient, it is possible to specifically inhibit the IL-6-induced signaling system and to prevent and treat IL-6-mediated diseases. The present invention relates to a composition capable of preventing and treating an infectious disease.
산자나무 추출물, 퀘세틴 3-글루코사이드-7-람노사이드, 염증질환, 라이노바이러스, IL-6 Hawthorn Extract, Quecetin 3-Glucoside-7-Rhamnoside, Inflammatory Disease, Rhinovirus, IL-6
Description
본 발명은 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함함으로써, 특이적으로 IL-6에 의해 유도되는 신호전달체계를 저해하여 IL-6으로 매개되는 질환을 예방하고 치료할 수 있음은 물론, 라이노바이러스의 감염성 질환을 예방하고 치료할 수 있는 산자나무 추출물 또는 이로부터 분리된 화합물을 포함하는 IL-6으로 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물에 관한 것이다 The present invention includes a quince extract or Quecetin 3-glucoside-7-rhamnoside isolated from it as an active ingredient, specifically inhibiting the signaling system induced by IL-6 and mediated by IL-6. For preventing or treating a disease or rhinovirus infectious disease mediated by IL-6, which includes a berry extract or a compound isolated therefrom that can prevent and treat a disease, as well as prevent and treat infectious diseases of rhinoviruses. Relates to a composition
인간 라이노바이러스(HRV)는 가장 일반적인 천식 악화 인자로 알려져 있으며, 많은 수의 안정된 천식 환자의 기관지 조직에도 인간 라이노바이러스가 존재하 는 것으로 알려져 있다.Human rhinovirus (HRV) is known to be the most common asthma exacerbation factor, and human rhinoviruses are also known to be present in the bronchial tissues of many stable asthmatic patients.
천식 환자와 비천식 환자 각각에서 기관지 점막 생검 표본을 채취하여 비교한 결과, 하기도 조직에서 인간 라이노바이러스가 발견되는 빈도는 비천식군에 비해 천식군에서 유의하게 높았으며, 인간 라이노바이러스의 존재와 천식의 임상적 중증도에도 상관관계가 있다는 보고가 있다.As a result of bronchial mucosal biopsy specimens from asthmatic and non-asthmatic patients, the incidence of human rhinoviruses in the lower respiratory tract tissues was significantly higher in the asthma group than in the asthma group. There is also a report that correlates with clinical severity.
인간 라이노바이러스 양성 환자는 폐기능 저하, 호산구와 림프구수 증가, 기관지 점막에 호산구가 침윤되는 등의 증상이 나타나는 것으로 알려져 있다. 천식증상이 안정되어 있고 상기도 감염의 임상적 징후가 나타나지 않은 천식 환자도 인간 라이노바이러스가 하기도의 만성 염증에 관여하고 있음을 보여준다.Human rhinovirus positive patients are known to have symptoms such as decreased lung function, increased numbers of eosinophils and lymphocytes, and infiltration of eosinophils in the bronchial mucosa. Asthma patients with stable asthma symptoms and no clinical signs of upper respiratory tract infections also show that human rhinoviruses are involved in chronic inflammation of the lower respiratory tract.
천식군 30례(이 중, 아스피린 감수성 천식 7례)와 대조군 23례에서 기관지 점막 표본을 채취하고, 정밀도 높은 검사법인 in situ 역전사 폴리머레이스 연쇄반응(RT-PCR)을 이용하여 분석한 결과, 감염률은 대조군이 22%인데 비해 천식군은 73%로 양쪽군 사이에 통계학적으로 유의차(P<0.001)가 나타났다. 이 검사법에서는 표본의 염색 패턴이 정확히 2종류로 나뉘었다. 염색 범위가 점막 표면에 한정되고 윤곽이 뚜렷한 점 모양인 '국한'형과 표본 전체에 나타나고 일부에 한정되지 않는 '확산'형이다.Bronchial mucosa samples were taken from 30 asthma patients (7 of them, aspirin-sensitive asthma) and 23 controls, and analyzed using in situ reverse transcription polymerase chain reaction (RT-PCR). The control group was 22%, whereas the asthma group was 73%. There was a statistically significant difference (P <0.001) between the two groups. In this test, the staining pattern of the specimen was divided into exactly two types. The staining range is limited to the mucosal surface and is a 'confined' form with distinctly outlined spots and a 'diffuse' form that appears throughout the sample and is not limited to some.
또한, 인간 라이노바이러스 양성 세포는 점막 표피 뿐만 아니라, 표피 아래 층에도 나타났다. 인간 라이노바이러스 양성과 말초혈중의 많은 백혈구의 수, 많은 다형 핵림프구의 수 사이에 각각 관련성이 나타났다. 한편, 인간 라이노바이러스의 시그널 점수와 말초혈중 림프구수에는 반비례 관계가 나타났다. 인간 라이노바이러 스는 감기증세 외에 천식발작, 폐렴, 축농증, 중이염을 일으키기도 한다.In addition, human rhinovirus positive cells appeared not only in the mucosal epidermis but also in the subdermal layer. There was a relationship between positive human rhinoviruses, the number of white blood cells in peripheral blood, and the number of polymorphic nuclear lymphocytes, respectively. On the other hand, there was an inverse relationship between the signal score of human rhinovirus and the lymphocyte count in peripheral blood. Human rhinoviruses can cause asthma attacks, pneumonia, sinusitis and otitis media in addition to cold symptoms.
최근 인간 라이노바이러스의 유전자지도가 완성되었다고 보고되었다. 미국 위슨콘신 대학 메디슨, 메릴랜드대학, 크레이그 벤터연구소가 공동연구한 결실로 인간 라이노바이러스 99종의 변종의 유전자 지도를 완성하였다. 인간 라이노바이러스는 체내에서 2개의 변종이 동시에 한 환자를 감염시켜 환자의 체내에서 유전물질을 서로 교환하여 완전히 새로운 변종을 만드는 등 의외로 복잡하다는 것을 알아내었다. 결국 인간 라이노바이러스는 크게 A, B, C 그룹으로 나눌 수 있고, 그 중에서 C 그룹은 폐 말단까지 침투한다고 보고되었다. 바이러스 변종이 너무 많아 변종 하나하나에 대한 백신을 만드는 것은 어렵지만, 바이러스 내부성분은 변종에 관계없이 너무 비슷하다는 사실을 밝혀 공통적인 요인을 타겟으로 감기치료제의 개발가능성을 시사하였다(사이언스, 펠먼버그, 2009. 2. 12).Recently, a genetic map of human rhinoviruses has been reported. Co-working with the University of Wisconsin-Madison, the University of Maryland, and the Craig Venter Institute, the researchers completed a genetic map of 99 variants of human rhinoviruses. Human rhinoviruses have been found to be surprisingly complex, with two strains in the body infecting one patient at the same time, exchanging genetic material in the patient's body to create a completely new strain. As a result, human rhinoviruses can be divided into A, B, and C groups, among which C group has been reported to penetrate to the lung end. There are so many strains of the virus that it is difficult to make a vaccine against each strain, but the fact that the virus's internal components are so similar regardless of the strain suggests the possibility of developing cold medicines targeting common factors (Science, Felmanberg, February 12, 2009).
산자나무(Hippophae rhamnoides)는 보리수과의 식물로서, 버드나무를 닮은 관목으로 암수가 따로 자란다. 동경 2-69도와 북위 27-69도 내의 여러 지역에서 자생하는데, 산자나무는 일반명으로 씨벅턴(Seabuckthorn)으로 불리고, 키가 2.5m까지 자라며, 잎은 너비가 좁고 아랫면이 은색이다. 열매는 공 모양이고 오렌지 빛이 도는 노란색이며 지름이 8㎜ 정도이다. 영국 동부와 남동부 해안의 모래언덕에 많으며, 유럽과 아시아의 산악지대에도 널리 퍼져 있다. 중국의 내몽고지역과 러시아의 시베리아지역 캐나다의 오지 등 저온이며 척박한 지역에서도 서식하는 식물이다. Hippophae rhamnoides is a plant of the family Liliaceae, a shrub that resembles a willow tree and grows female and female separately. It grows in various regions within 2-69 degrees east longitude and 27-69 degrees north latitude. Mountain hawthorn is commonly known as Seabuckthorn, grows up to 2.5m in height, and leaves are narrow in width and silver underside. Fruits are ball-shaped, orangeish yellow, about 8mm in diameter. It is found in the sand dunes along the eastern and southeastern coasts of England, and is also prevalent in mountainous regions in Europe and Asia. It is a plant that lives in low temperature and barren areas such as China's Inner Mongolia and Russia's Siberia and Canada's backcountry.
식물 유래 플라보노이드나 당화 플라보노이드의 약리 활성에 대해서는 많이 알려져 있다(Journal of antimicrobial chemotherapy, L. C. Chiang, W. Chiang, M. C. Liu and C. C. Lin, Vol. 52, pp 194~198, 2003). 플라보노이드는 헤르페스 바이러스나 아데노바이러스 등에 대하여 항바이러스 효과가 있으며, 로부스타플라본(robustaflavone) 등과 같은 바이플라보노이드계 화합물는 인플루엔자 바이러스 등에 저해 효과가 있는 것으로 보고되고 있으나(Planta Medica, Vol. 65, pp 120~125), 항바이러스 효과가 탁월하게 나타나지는 않았다.The pharmacological activity of plant-derived flavonoids and glycated flavonoids is well known ( Journal of antimicrobial chemotherapy , LC Chiang, W. Chiang, MC Liu and CC Lin, Vol. 52, pp 194-198, 2003). Flavonoids have antiviral effects against herpes and adenoviruses, and biflavonoid compounds such as robustaflavones have been reported to have inhibitory effects against influenza viruses ( Planta Medica , Vol. 65, pp 120-125). However, the antiviral effect was not excellent.
여러 연구자들에 의하여 산자나무의 유효성분에 관련된 연구가 많이 진행되어 왔다. 특히, 산자나무 열매에서 각종 천연 바타민(A, B, C, E, P, K)의 함량을 정량?정성분석하였으며, 각종 아미노산들의 함량 및 각종 유용금속류의 함유량을 분석하였다. 또한, 각종 영양소의 함유량에 관한 연구와 산자나무 열매를 식품으로 이용하기 위한 기초자료로 열매관련 물성 연구가 진행되었다(J. Agric. Food Chem., Vol.47, pp 3480~3488). 그리고 중국을 중심으로 하여, 산자나무 Hippophae rhamnoides ssp. sinensis 15종, Hippophae rhamnoides ssp. yunnanensis 7종, Hippophae rhamnoides ssp. wolongensis 5종, Hippophae rhamnoides ssp. stellatopilosa 4종, Hippophae rhamnoides ssp. tibetana 3종에서 유래한 여러 가지 플라보노이드들을 HPLC 표준화작업에 의해 12종의 플라보노이드로 분류하여 이들의 다양성을 보고 하였다(J. of Chromatography A, Chu Chen, 1154, pp 250~259). 그리고 중국을 중심으로 여러 지역에서 자생하고 있는 각종 산자나무들로부터 성분 분리연구를 수행하여 분리된 12종의 플라보노이드들의 함량을 비교하였으며, 퀘세틴 3-O-소포로사이드-7-람노사이드, 퀘세틴 3-O-루티노사이 드, 퀘세틴 3-O-글루코사이드, 퀘세틴, 캄페롤 3-O-소포로사이드-7-람노사이드, 캄페롤 7-O-람노사이드, 캄페롤, 이소르함네틴, 이소르함네틴 3-O-소포로사이드-7-람노사이드, 이소르함네틴 3-O-루티노사이드, 이소르함네틴 3-O-글루코사이드, 이소르함네틴 3-O-글루코사이드-7-람노사이드에 대하여 보고 하였다.By various researchers Many studies have been conducted on the active ingredient of mountain hawthorn. In particular, the quantitative and qualitative analysis of the content of various natural batamines (A, B, C, E, P, K) in the hawthorn fruit were analyzed, and the contents of various amino acids and various useful metals were analyzed. In addition, research on the content of various nutrients and physical properties related to fruit as a basic data for the use of the fruit of the coriander ( J. Agric. Food Chem. , Vol . 47, pp 3480 ~ 3488). And mainly in China, the hawthorn Hippophae rhamnoides ssp. sinensis 15 species, Hippophae rhamnoides ssp. yunnanensis 7 species, Hippophae rhamnoides ssp. wolongensis 5 species, Hippophae rhamnoides ssp. stellatopilosa 4, Hippophae rhamnoides ssp. Flavonoids derived from three tibetana species were classified into 12 flavonoids by HPLC standardization and reported their diversity ( J. of Chromatography A , Chu Chen, 1154, pp 250-259). In addition, we analyzed the content of 12 flavonoids isolated from various hawthorn trees growing in various regions, especially in China. Quercetin 3-O-sophoroside-7-rhamnoside and quenoside were compared. Cetine 3-O-Lutinoside, Quecetin 3-O-Glucoside, Quecetin, Camperol 3-O-Sophoroside-7-Rhamnoside, Camperol 7-O-Rhamnoside, Camphorol, Isolehaminetin , Isorhamnetine 3-O-sophoroside-7-rhamnoside, isorhamnetine 3-O-lutinoside, isorhamnetine 3-O-glucoside, isorhamnetine 3-O-glucoside-7-rhamnoside Reported on.
사이토카인은 생체 내 여러 종류의 세포에서 분비하여 세포 증식, 분화, 활성화 등에 관여하는 폴리펩타이드나 글리코프로테인으로 면역 및 염증반응에 중요한 역할을 한다. 여러 종류의 자가 면역질환들의 증상은 무척 다양하지만 병인기전의 공통점 중의 하나로 면역 반응이나 조직의 손상, 회복을 조절하는 여러 사이토카인의 생성을 들 수 있다. 염증성 질병의 병변조직에서 염증성 사이토카인인 IL-1α, IL-β, TNFα, IL-6, IL-12 등의 발현이 증가 되어 있다. 또한, 루푸스 환자의 혈청에서는 TNFα, IL-1, IL-6, IL-10, IFNα, IFNγ 등이 증가되어있으며, 쉐그랜 증후군 환자의 타액선에서도 TNFα, IL-1, IL-2, IL-6, IL-10, TGFβ의 발현이 보고되었다.Cytokines are polypeptides or glycoproteins involved in cell proliferation, differentiation, activation, etc. secreted by various kinds of cells in vivo and play an important role in immune and inflammatory responses. Symptoms of various autoimmune diseases vary widely, but one of the common etiologies is the production of several cytokines that regulate immune responses, tissue damage and recovery. The expression of inflammatory cytokines IL-1α, IL-β, TNFα, IL-6, IL-12 is increased in lesion tissue of inflammatory diseases. In addition, TNFα, IL-1, IL-6, IL-10, IFNα, IFNγ are increased in the serum of lupus patients, and TNFα, IL-1, IL-2, IL-6 in the salivary glands of patients with Shegran syndrome. , IL-10, TGFβ expression has been reported.
특히, IL-6는 대표적인 염증성 질환, 자가 면역질환 및 암세포에서도 중요하게 관여하는 사이토카인으로 여러 장기에서 다양한 기능을 수행한다. IL-6는 많은 세포 종류에서 발현됨이 알려져 있으며, 대표적으로 면역반응, 염증, 조혈과정, 세포의 증식 및 분화 등 다양한 생물학적 기능에 관련되어 있다(Naka 등 2002). IL-6의 작용은 수용체에 의하여 매개되는데 2가지 종류의 수용체, 즉 IL-6에 특이한 수용체인 IL-6R과 IL-6 패밀리의 공통수용체인 gp130가 IL-6의 복합수용체로서 작용한다. IL-6은 먼저 IL-6R과 결합하게 되고, IL-6과 IL-6R의 복합체는 다시 2개의 gp130과 결합하여 활성의 수용체 복합체를 형성하여 세포 내로의 신호전달을 개시한다(Hirano 등 1997). 야누스 키나제 2(Janus Kinases 2, JAK2)는 인산전이(transphosphorylation)에 의하여 활성화된다. 활성화된 JAK2에 의해 수용체 세포질 영역(cytoplasmic domains)의 여러 티로신 잔유물(tyrosine residues)이 인산화(phosphorylation)되고, 이것은 SH2나 다른 포스포티로신 바인딩 모티프(phosphotyrosine binding motif)를 가지고 있는 STAT3(signal transducers and activators of transcription 3)와 같은 세포질 내 단백질의 도킹 사이트(docking site) 역할을 하게 된다. 수용체의 세포질 영역에 결합한 STAT3는 JAK2에 의해 인산화된 후 수용체에서 떨어져 나온다. 활성화된 STAT3들은 세포질 내에 서로 결합하여 호모다이머(homodimer) 또는 헤테로다이머(heterodimer)를 이룬 후 핵(nucleus) 내로 들어가 타겟 유전자의 인식 서열(recognition sequence)에 결합하여 전사(transcription)를 증가시킨다(Levy, D.E., 등, Nat Rev Mol Cell Biol, 2002, 3, 651-62, Darnell, J.E., J.r., Science, 1997, 277, 1630-1635).In particular, IL-6 is a cytokine that is important in representative inflammatory diseases, autoimmune diseases and cancer cells, and performs various functions in various organs. IL-6 is known to be expressed in many cell types and is typically involved in various biological functions such as immune response, inflammation, hematopoietic process, cell proliferation and differentiation (Naka et al. 2002). The action of IL-6 is mediated by receptors. Two types of receptors, IL-6R-specific receptors, IL-6R and gp130, a common receptor of the IL-6 family, act as a complex receptor for IL-6. IL-6 first binds to IL-6R, and the complex of IL-6 and IL-6R in turn binds to two gp130s to form an active receptor complex that initiates signaling into cells (Hirano et al. 1997). . Janus Kinases 2 (JAK2) is activated by transphosphorylation. Activated JAK2 phosphorylates several tyrosine residues in the receptor cytoplasmic domains, which are signal transducers and STAT3 with SH 2 or other phosphotyrosine binding motifs. It acts as a docking site for proteins in the cytoplasm, such as activators of transcription. STAT3, which binds to the cytoplasmic region of the receptor, is phosphorylated by JAK2 and then released from the receptor. Activated STAT3s bind to each other in the cytoplasm to form a homodimer or heterodimer and then enter the nucleus to bind to the recognition sequence of the target gene to increase transcription. , DE, et al., Nat Rev Mol Cell Biol , 2002, 3, 651-62, Darnell, JE, Jr, Science , 1997, 277, 1630-1635).
특히, IL-6 시그날링 패쓰웨이(signaling pathway)의 중간 매간 전달자인 STAT3는 골수종, 유방 암종, 전립선 암, 뇌 종양, 두경부 암종, 흑색종, 백혈병 및 림프종, 특히 만성 골수성 백혈병 및 다발성 골수종을 포함하여 여러 형태의 암에 관여하는 것으로 보고되었다(Niu 등, Cancer Res., 1999, 59, 5059-5063). 쥐 및 인간의 전립선 암 양쪽에서 유래된 세포들은 구조적으로 활성화된 STAT3을 갖는 것으로 밝혀졌으며, STAT3는 일부 급성 백혈병(Gouilleux-Gruart, V. 등, Leuk.Lymphoma, 1997, 28, 83-88) 및 T 세포 림프종(Yu,C.L.등, J.Immunol., 1997, 159, 5206-5210)에서 구조적으로 활성화되는 것으로 밝혀졌다. 흥미롭게도, STAT3은 만성 림프성 백혈병에서 세린 잔기 위에 구조적으로 인산화 되는 것으로 밝혀졌다(Frank,D.A. 등, J.Clin.Invest., 1997, 100, 3140-3148). STAT3은 다발성 골수종을 가진 환자로부터의 골수 단핵 세포 및 배양액 양쪽 모두에서, 골수종 종양 세포에서 구조적으로 활성인 것으로 밝혀졌다. 이러한 세포는 Fas-매개 세포고사에 내성이고 높은 수준의 Bcl-xL을 발현한다. STAT3 시그날링은 세포고사에 대한 내성을 부여함으로써 골수종 종양 세포의 생존을 위해 필수적인 것으로 밝혀졌다(Catlett-Falcone,R. 등, Immunity, 1999, 10, 105-115).In particular, STAT3, an intermediary messenger of the IL-6 signaling pathway, includes myeloma, breast carcinoma, prostate cancer, brain tumor, head and neck carcinoma, melanoma, leukemia and lymphoma, especially chronic myeloid leukemia and multiple myeloma Has been reported to be involved in several types of cancer (Niu et al . , Cancer Res. , 1999, 59, 5059-5063). Cells derived from both rat and human prostate cancer have been found to have structurally activated STAT3, which has been shown to affect some acute leukemias (Gouilleux-Gruart, V. et al., Leuk . Lymphoma , 1997, 28, 83-88) and It has been shown to be structurally activated in T cell lymphoma (Yu, CL et al., J. Immunol ., 1997, 159, 5206-5210). Interestingly, STAT3 has been shown to be structurally phosphorylated on serine residues in chronic lymphocytic leukemia (Frank, DA et al . , J. Clin. Invest. , 1997, 100, 3140-3148). STAT3 has been shown to be structurally active in myeloma tumor cells, in both myeloid mononuclear cells and cultures from patients with multiple myeloma. These cells are resistant to Fas-mediated cell death and express high levels of Bcl-xL. STAT3 signaling has been shown to be essential for the survival of myeloma tumor cells by conferring resistance to apoptosis (Catlett-Falcone, R. et al., Immunity , 1999, 10, 105-115).
이에, 본 발명자는 IL-6 신호전달체계를 저해함은 물론, 바이러스 감염 질환을 효과적으로 치료할 수 있는 제제를 개발하기 위해 노력한 결과, 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드 화합물이 상기와 같은 질환을 효과적으로 예방 및 치료할 수 있음을 확인하고 본 발명을 완성하였다.Accordingly, the present inventors have tried to develop an agent capable of effectively inhibiting viral infection diseases as well as inhibiting the IL-6 signaling system. As a result, the extract of hawthorn or quercetin 3-glucoside-7-rhamno isolated therefrom It was confirmed that the side compound can effectively prevent and treat such diseases, and completed the present invention.
본 발명은 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함함으로써, 특이적으로 IL-6에 의해 유도되는 신호전달체계를 저해하여 IL-6에 의해 매개되는 질환을 예방하고 치료할 수 있음은 물론, 라이노바이러스의 감염성 질환을 예방하고 치료할 수 있는 IL-6으로 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물을 제공함에 본 발명의 목적이 있다.The present invention includes an extract of hawthorn or quercetin 3-glucoside-7-rhamnoside isolated from the extract as an active ingredient, specifically inhibiting the signaling system induced by IL-6 and mediated by IL-6. It is an object of the present invention to provide a composition for preventing or treating a disease, as well as for preventing or treating an infectious disease of rhinoviruses, and for preventing or treating an IL-6-mediated disease or rhinovirus infectious disease.
하나의 양태로서, 본 발명은 산자나무(Hippophae rhamnoides) 추출물을 포함하는 IL-6으로 매개되는 질환의 예방 또는 치료용 조성물을 제공한다.In one aspect, the present invention provides a composition for the prevention or treatment of diseases mediated by IL-6, including an extract of Hippophae rhamnoides .
본 발명의 상기 산자나무 추출물은 바람직하게 산자나무 열매 또는 잎의 추출물일 수 있으며, 이에 제한되는 것은 아니다.The hawthorn extract of the present invention may preferably be an extract of hawthorn fruit or leaves, but is not limited thereto.
본 발명에서, 상기 산자나무 추출물은 물, 메탄올, 에탄올, 부탄올과 같은 C1 내지 C4의 저급알콜 또는 이들의 혼합용매로 추출한 것일 수 있다. 바람직하게는 상기 산자나무 추출물은 에탄올로 추출한 것이며, 가장 바람직하게는 상기 산자나무 추출물은 10 내지 100% 에탄올 추출물이다.In the present invention, the hawthorn extract may be extracted with water, methanol, ethanol, lower alcohols such as C 1 to C 4 or a mixed solvent thereof. Preferably the extract is extracted with ethanol, most preferably the extract is 10 to 100% ethanol extract.
또한, 본 발명의 상기 추출물은 추출처리에 의해 얻어지는 추출액, 추출액의 희석액 또는 농축액, 추출액을 건조하여 얻어지는 건조물 및 이들 조정제물 또는 정제물 중 어느 하나 이상을 포함할 수 있다.In addition, the extract of the present invention may include any one or more of the extract obtained by the extraction treatment, the dilution or concentrate of the extract, the dried product obtained by drying the extract, and these modifiers or purified products.
다른 하나의 양태로서, 본 발명은 하기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드(quercetin 3-O-glucoside-7-rhamniside)를 유효성분으로 포함하는 IL-6으로 매개되는 질환의 예방 또는 치료용 조성물을 제공한다.As another aspect, the present invention is a disease mediated by IL-6 comprising a quercetin 3-O-glucoside-7-rhamniside represented by the following formula (1) as an active ingredient It provides a composition for the prevention or treatment of.
본 발명의 퀘세틴 3-글루코사이드-7-람노사이드 화합물은 산자나무로부터 추출?분리?정제하여 얻는 것이 바람직하지만, 이에 제한되지는 않는다. 즉, 상기 화합물은 다른 원료로부터 추출?분리?정제하여 얻을 수도 있으며, 공지의 합성방법으로 제조될 수도 있고, 시판되는 시약으로도 사용할 수 있다.The quercetin 3-glucoside-7-rhamnoside compound of the present invention is preferably obtained by extracting, separating and purifying from a hawthorn, but is not limited thereto. That is, the compound may be obtained by extraction, separation and purification from other raw materials, may be prepared by a known synthesis method, or may be used as a commercial reagent.
본 발명의 상기 산자나무 추출물 및 퀘세틴 3-글루코사이드-7-람노사이드는 IL-6 신호전달체계를 저해하는 활성을 갖는다.The hawthorn extract and quercetin 3-glucoside-7-rhamnoside of the present invention have activity to inhibit IL-6 signaling system.
IL-6는 대표적인 염증성 질환, 자가 면역질환 및 암세포에서도 중요하게 관여하는 사이토카인으로 여러 장기에서 다양한 기능을 수행한다. IL-6는 많은 세포 종류에서 발현됨이 알려져 있으며, 대표적으로 면역반응, 염증, 조혈과정, 세포의 증식 및 분화 등 다양한 생물학적 기능에 관련되어 있다.IL-6 is a cytokine that is important in representative inflammatory diseases, autoimmune diseases and cancer cells, and performs various functions in various organs. IL-6 is known to be expressed in many cell types and is typically involved in various biological functions such as immune response, inflammation, hematopoietic process, cell proliferation and differentiation.
상기 상기 산자나무 추출물 및 퀘세틴 3-글루코사이드-7-람노사이드는 이러한 IL-6의 신호전달체계를 저해하는 활성을 갖음으로써, IL-6으로 매개되는 질환의 예방 및 치료하는데 효과가 있다.The hawthorn extract and quercetin 3-glucoside-7-rhamnoside have the activity of inhibiting the signaling system of IL-6, and thus are effective in preventing and treating diseases mediated by IL-6.
본 발명의 상기 IL-6으로 매개되는 질환은 염증성질환, 자가면역질환 및 암일 수 있으며, 구체적으로는 천식, 건선, 아토피, 골다공증, 루푸스, 크론씨병, 혈관협착, 암전이, 이식거부, 관절염, 알쯔하이머, 골수종, 유방암종, 전립선암, 뇌종양, 두경부암종, 흑색종, 백혈병, 다발성 골수종 중 어느 하나 이상일 수 있다. 그러나 이에 한정하는 것은 아니고, 통상적으로 주지된 염증성질환, 자가면역질환 또는 암에 관련된 질환들도 본 발명의 범위에 포함될 수 있다.The IL-6-mediated disease of the present invention may be an inflammatory disease, an autoimmune disease and cancer, specifically, asthma, psoriasis, atopy, osteoporosis, lupus, Crohn's disease, vascular stenosis, cancer metastasis, transplant rejection, arthritis, Alzheimer's disease , Myeloma, breast carcinoma, prostate cancer, brain tumor, head and neck carcinoma, melanoma, leukemia, multiple myeloma. However, the present invention is not limited thereto, and diseases related to inflammatory diseases, autoimmune diseases or cancers, which are commonly known, may be included in the scope of the present invention.
또 다른 하나의 양태로서, 본 발명은 상기 산자나무 추출물을 포함함으로써, 바이러스 감염성 질환, 특히 라이노바이러스의 증식을 억제할 수 있는 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물을 제공한다.As another aspect, the present invention provides a composition for preventing or treating viral infectious diseases, particularly rhinovirus infectious diseases, which can inhibit the proliferation of rhinoviruses, by including the extract of the hawthorn.
또 다른 하나의 양태로서, 본 발명은 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 함으로써, 라이노바이러스 감염성 질환의 예방 및 치료를 위한 조성물을 제공한다.As another aspect, the present invention provides a composition for the prevention and treatment of rhinovirus infectious diseases by using quercetin 3-glucoside-7-rhamnoside as an active ingredient.
본 발명의 상기 퀘세틴 3-글루코사이드-7-람노사이드의 유효용량은 일반적으로 성인환자 체중 1kg 당 1 내지 100mg/일이고, 바람직하게는 5 내지 20mg/일이다. 특정 환자에 대한 투여용량 수준은 성별, 연령, 건강상태, 식이, 투여시간, 투여방법, 약제혼합 및 질환의 중증도에 따라 적절하게 변화될 수 있다. 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.The effective dose of the quercetin 3-glucoside-7-rhamnoside of the present invention is generally 1 to 100 mg / day, preferably 5 to 20 mg / day, per kg of adult patient. Dosage levels for a particular patient may vary as appropriate depending on gender, age, health condition, diet, time of administration, method of administration, drug mixture and severity of disease. Thus, the dosage amounts are not intended to limit the scope of the invention in any manner.
본 발명의 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 포함하는 조성물은 약제학적 조성물일 수 있다.The composition comprising the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention may be a pharmaceutical composition.
본 발명에서, 상기 퀘세틴 3-글루코사이드-7-람노사이드 화합물은 약학적으로 허용 가능한 염의 형태도로 사용될 수 있으며, 통상의 방법에 의해 제조되는 모든 염, 수화물 및 용매화물이 포함된다.In the present invention, the quercetin 3-glucoside-7-rhamside compound can be used in the form of a pharmaceutically acceptable salt, and includes all salts, hydrates and solvates prepared by conventional methods.
염으로는 약학적으로 허용가능한 유리산(free acid)에 의해 형성된 산부가염이 유용하다. 산 부가염은 통상의 방법, 예를 들어 화합물을 과량의 산 수용액에 용해시키고, 이 염을 수혼화성 유기 용매(예를 들어, 메탄올, 에탄올, 아세톤 또는 아세토니트릴)를 사용하여 침전시켜서 제조한다. 동 몰량의 화합물 및 물 중의 산 또는 알콜(예를 들어, 글리콜 모노메틸에테르)을 가열하고, 이어서 상기 혼합물을 증발시켜 건조시키거나, 또는 석출된 염을 흡인 여과시킬 수 있다.Salts are useful as acid addition salts formed by pharmaceutically acceptable free acids. Acid addition salts are prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent (eg, methanol, ethanol, acetone or acetonitrile). Equivalent molar amounts of the compound and acid or alcohol (eg, glycol monomethylether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.
이때, 유리산으로는 무기산과 유기산을 사용할 수 있는데, 무기산으로는 염산, 브롬산, 인산, 황산, 질산, 주석산 등을 사용할 수 있고, 유기산으로는 구연산(citric acid), 초산, 젖산, 주석산(tartaric acid), 말레인산, 푸마르산(fumaric acid), 포름산, 프로피온산(propionic acid), 옥살산, 트리플루오로아 세트산, 벤조산, 글루콘산, 메탄술폰산, 글리콜산, 숙신산, 4-톨루엔술폰산, 갈룩투론산, 엠본산, 글루탐산 또는 아스파르트산 등을 사용할 수 있으며, 이들에 제한되지 않는다.In this case, inorganic acids and organic acids may be used as the free acid, and hydrochloric acid, bromic acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. may be used as the inorganic acid, and citric acid, acetic acid, lactic acid, tartaric acid ( tartaric acid), maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, methanesulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, galtuuronic acid, Embon acid, glutamic acid or aspartic acid, etc. can be used, but it is not limited to these.
또한, 염기를 사용하여 약학적으로 허용가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들어 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해시키고, 비용해 화합물 염을 여과한 후 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하나 이들에 제한되는 것은 아니다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은염(예를 들어, 질산은)과 반응시켜 얻을 수 있다.In addition, bases can be used to make pharmaceutically acceptable metal salts. Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and then evaporating and drying the filtrate. In this case, as the metal salt, it is particularly suitable to prepare sodium, potassium or calcium salt, but is not limited thereto. Corresponding silver salts can also be obtained by reacting alkali or alkaline earth metal salts with a suitable silver salt (eg, silver nitrate).
본 발명에 따른 약제 조성물은 임상 투여시에 경구 또는 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제 및 계면활성제 등의 희석제 및 부형제를 사용하여 조제한다.The pharmaceutical composition according to the present invention may be administered in various oral or parenteral dosage forms at the time of clinical administration, and when formulated, diluents and excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. To use.
경구투여를 위한 고형제제에는 정제, 트로키제(troches), 로렌지(lozenge), 수용성 또는 유성현탁액, 조제분말 또는 과립, 에멀젼, 하드 또는 소프트 캡슐, 시럽 또는 엘릭실제(elixirs) 등이 포함된다. 정제 및 캡슐 등의 제형으로 제제하기 위해 락토오스, 사카로오스, 솔비톨, 만니톨, 전분, 아밀로펙틴, 셀룰로오스 또는 젤라틴과 같은 결합제; 디칼슘 포스페이트와 같은 부형제; 옥수수 전분 또는 고구마 전분과 같은 붕괴제; 스테아린산 마그네슘, 스테아린산 칼슘,스테아릴푸마르산 나트륨 또는 폴리에틸렌글리콜 왁스와 같은 윤활유가 함유된다. 캡슐 제형의 경우, 상기에서 언급한 물질 이외에도 지방유와 같은 액체 담체를 함유한다.Solid form preparations for oral administration include tablets, troches, lozenges, aqueous or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs, and the like. Binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin for preparation in formulations such as tablets and capsules; Excipients such as dicalcium phosphate; Disintegrants such as corn starch or sweet potato starch; Lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax. In the case of capsule formulations, in addition to the substances mentioned above, they contain a liquid carrier such as fatty oil.
또한, 비경구 투여는 피하주사, 정맥주사, 근육 내 주사 또는 흉부 내주사 주입방식일 수 있다. 비경구 투여용 제형으로 제제화하기 위해서, 상기 화학식 1의 화합물을 안정제, 완충제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제 등을 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플이나 바이알의 단위 투여형으로 제제한다. 비수성용제 및 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜 및 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.Parenteral administration may also be subcutaneous, intravenous, intramuscular or intrathoracic infusion. In order to formulate into a parenteral formulation, the compound of Formula 1 is prepared as a solution or suspension by mixing a stabilizer, a buffer, a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized agent, a suppository, and the like, and an ampoule. Formulated in unit dosage form as a vial. As the non-aqueous solvent and suspending agent, vegetable oils such as propylene glycol, polyethylene glycol and olive oil, injectable esters such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
본 발명의 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 포함하는 조성물은 식품 조성물일 수 있다.The composition comprising the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention may be a food composition.
식품 제조 시에 통상적으로 첨가되는 성분은 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드(예를 들어, 포도당, 과당 등), 디사카라이드(예를 들어, 말토스, 슈크로스, 올리고당 등) 및 폴리사카라이드(예를 들어, 덱스트린, 사이클로덱스트린 등)와 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연 향미제(예를 들어, 타우마틴, 레바우디오시드 A, 글리시르히진 등과 같은 스테비아 추출물) 및 합성 향미제(예를 들어, 사카린, 아스파르탐 등)를 사용할 수 있다.Ingredients commonly added in food production include, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. Examples of the carbohydrates described above include monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, oligosaccharides, etc.) and polysaccharides (eg, dextrins, cyclodextrins). And other sugars such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents (e.g., stevia extracts such as taumartin, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (e.g., saccharin, aspartame, etc.) can be used.
또 다른 하나의 양태로서, 본 발명은 산자나무로부터 퀘세틴 3-글루코사이드-7-람노사이드를 분리?정제하는 방법을 제공한다. 분리?정제하는 방법은 구체적으로 다음과 같다.In another aspect, the present invention provides a method for separating and purifying quercetin 3-glucoside-7-rhamnoside from a hawthorn. Specifically, the separation and purification method is as follows.
우선, 산자나무로부터 에탄올 추출물을 제조하고, 감압농축하여 분획물을 수득한다. 그리고 상기 분획물에 대해 메탄올을 용매로 사용하여 크로마토그래피를 수행함으로써 IL-6 신호전달체계 저해활성을 갖는 활성분획을 수득한다. 마지막으로 상기 활성분획을 고속액체크로마토그래피로 분리하여 퀘세틴 3-글루코사이드-7-람노사이드를 얻는다.First, an ethanol extract is prepared from the hawthorn, and concentrated under reduced pressure to obtain a fraction. And chromatography is performed on the fraction using methanol as a solvent to obtain an active fraction having an IL-6 signaling system inhibitory activity. Finally, the active fraction is separated by high performance liquid chromatography to obtain quercetin 3-glucoside-7-rhamnoside.
따라서, 본 발명의 조성물은 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함함으로써, 염증성질환, 자가면역질환 또는 암을 유발하는 신호전달과정을 중요한 매개자로 작용하는 IL-6 수용체의 결합을 억제하여 IL-6으로 매개되는 질환을 예방하고 치료할 수 있는 효과가 있다.Therefore, the composition of the present invention includes a hawthorn extract or quercetin 3-glucoside-7-rhamnoside isolated from the extract as an active ingredient, thereby signaling as an important mediator of inflammatory diseases, autoimmune diseases or cancer. By inhibiting the binding of the acting IL-6 receptor has the effect of preventing and treating diseases mediated by IL-6.
또한, 본 발명의 조성물은 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함함으로써, 라이노바이러스의 감염성 질환을 예방하고 치료할 수 있는 효과가 있다.In addition, the composition of the present invention includes the extract of the hawthorn or quercetin 3-glucoside-7-rhamnoside isolated from the active ingredient, there is an effect that can prevent and treat infectious diseases of rhinoviruses.
또한, 본 발명의 조성물은 단백질이 아닌 저분자 화합물이기 때문에, 기존의 의약품으로 사용되는 단백질의 중화항체보다 의약산업에 이용성이 크다는 효과가 있다.In addition, since the composition of the present invention is a low-molecular compound rather than a protein, there is an effect that the usability in the pharmaceutical industry is greater than that of the neutralizing antibody of the protein used as a conventional medicine.
본 명세서 및 청구범위에 사용된 용어나 단어는 통상적이거나 사전적인 의미로 한정해서 해석되어서는 아니되며, 발명자는 그 자신의 발명을 가장 최선의 방법으로 설명하기 위해 용어의 개념을 적절하게 정의할 수 있다는 원칙에 입각하여 본 발명의 기술적 사상에 부합하는 의미와 개념으로 해석되어야만 한다.The terms and words used in the present specification and claims should not be construed as limited to ordinary or dictionary terms and the inventor may appropriately define the concept of the term in order to best describe its invention It should be construed as meaning and concept consistent with the technical idea of the present invention.
따라서, 본 명세서에 기재된 실시예와 도면에 도시된 구성은 본 발명의 가장 바람직한 일 실시예에 불과할 뿐이고 본 발명의 기술적 사상을 모두 대변하는 것은 아니므로, 본 출원시점에 있어서 이들을 대체할 수 있는 다양한 균등물과 변형예들이 있을 수 있음을 이해하여야 한다.Therefore, the embodiments described in this specification and the configurations shown in the drawings are merely the most preferred embodiments of the present invention and do not represent all the technical ideas of the present invention. Therefore, It is to be understood that equivalents and modifications are possible.
이하, 본 발명은 다음 실시예에 의거하여 더욱 상세히 설명하겠는바, 본 발명이 이에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail based on the following examples, but the present invention is not limited thereto.
실시예 1 : 퀘세틴 3-글루코사이드-7-람노사이드의 분리 및 정제Example 1 Isolation and Purification of Quecetin 3-Glucoside-7-Rhamnoside
건조시킨 산자나무 열매 1kg에 100% 에탄올 4L를 가하고, 빛이 차단된 실온에서 72시간 동안 추출하여 에탄올 추출물을 제조한 후, 이를 감압농축하여 분획물을 수득하였다. 실제로 동물실험을 하기 위한 활성물질을 추출할 때에는 95% 주정을 이용하여 서늘하고 어두운 장소에서 72시간 동안 추출한 후, 감압농축하여 실험에 사용하였다.4L of 100% ethanol was added to 1 kg of dried hawthorn fruit, and extracted for 72 hours at room temperature where light was blocked to prepare an ethanol extract, and then concentrated under reduced pressure to obtain a fraction. Actually, when extracting the active substance for animal experiments, the extract was extracted for 72 hours in a cool dark place using 95% alcohol, and then concentrated under reduced pressure.
순수한 활성물질을 분리하기 위하여, 상기 농축된 분획물을 메탄올에 용해시 킨 후, 세파덱스 LH-20(sephadex LH-20)에 메탄올을 용매로 사용하여 크로마토그래피를 수행하였다. 그런 다음 IL-6 신호전달체계를 저해하는 활성을 갖는 활성분획을 모아 감압농축하였다.In order to separate the pure active substance, the concentrated fractions were dissolved in methanol, and then chromatographed using methanol as a solvent in Sephadex LH-20. Then, an active fraction having an activity that inhibits IL-6 signaling system was collected and concentrated under reduced pressure.
상기 활성분획을 물-메탄올(40% 메탄올) 용출용매를 이용하여 고속 액체 크로마토그래피(컬럼: C18, 유속: 1.5㎖/분, 220nm 검출)를 수행하였다. 이때, 유지시간 17분대에 활성분획을 분리하고, 감압건조하여 화학식 1로 표시되는 화합물 998㎎을 얻었다.The active fraction was subjected to high performance liquid chromatography (column: C18, flow rate: 1.5 mL / min, 220 nm detection) using a water-methanol (40% methanol) eluting solvent. At this time, the active fraction was separated for 17 minutes in the holding time, and dried under reduced pressure to obtain 998 mg of the compound represented by the formula (1).
실시예 2 : 퀘세틴 3-글루코사이드-7-람노사이드의 이화학적 특성 분석Example 2 Physicochemical Characterization of Quecetin 3-Glucoside-7-Rhamnoside
상기 실시예 1에서 순수하게 분리?정제된 화합물의 이화학적인 특성을 분석하였다. 상기 화합물의 분자량을 측정하기 위하여 ESI-MS(electrospray ionization mass spectrometry, Fisons VG Quattro 400 mass spectrometer, USA)를 이용하였으며, 구조를 규명하기 위하여 핵자기공명(NMR) 방법을 이용하였다.In Example 1, the physical and chemical properties of the purely separated and purified compounds were analyzed. In order to measure the molecular weight of the compound, ESI-MS (electrospray ionization mass spectrometry,
상기 화합물에 대하여 물질의 성상, 분자량, 분자식 및 질량을 분석한 결과, 본 발명에 따른 화합물의 이화학적인 특성으로 성상은 용기에 박막형태로 붙어있고, 화합물의 질량분석치(M+H)+는 611m/z로 측정되었으며, (M+Na)+는 633m/z로 측정되어 화학식 1로 표시되는 화합물의 분자량은 610으로 확인되었으며, 분자식은 C27H30O16로 추정되었다(도 1).As a result of analyzing the property, molecular weight, molecular formula and mass of the compound, the properties of the compound according to the present invention are attached to the container in a thin film form, and the mass spectrometry (M + H) + of the compound is Measured at 611 m / z, (M + Na) + was measured at 633 m / z molecular weight of the compound represented by the formula (1) was confirmed as 610, the molecular formula was estimated to C 27 H 3 0O 16 (Fig. 1).
상기 화합물을 DMSO d-6에 녹여 5㎜의 NMR 튜브 내에 넣고, 수소 및 탄소 핵 자기공명을 측정하였다. 각 용매의 피이크를 내부 표준물질로 하거나 TMS (tetramethylsilane)의 피이크를 기준으로 하여 측정하였다.The compound was dissolved in DMSO d- 6, placed in a 5 mm NMR tube, and hydrogen and carbon nuclear magnetic resonance were measured. The peak of each solvent was measured as an internal standard or based on the peak of TMS (tetramethylsilane).
수소 핵자기공명 스펙트럼(도 2), 탄소 핵자기공명 스펙트럼(도 3), DEPT 스펙트럼(도 4)을 분석하여 상기 화합물의 구조를 조사한 결과, 상기 화합물은 퀘세틴 3-글루코사이드-7-람노사이드(Romani A. et al 2000, J. Agric Food. Chem 48(9) 4091-4096에서 규명)와 일치하였다.Hydrogen nuclear magnetic resonance spectra (FIG. 2), carbon nuclear magnetic resonance spectra (FIG. 3), DEPT spectra (FIG. 4) were analyzed to examine the structure of the compound.The compound was quercetin 3-glucoside-7-rhamnoside. (As identified by Romani A. et al 2000, J. Agric Food. Chem 48 (9) 4091-4096).
실시예 3 : 산자나무 추출물 및 퀘세틴 3-글루코사이드-7-람노사이드의 IL-6 저해활성 검정Example 3 Assay of IL-6 Inhibitory Activity of Sanjay Extract and Quecetin 3-Glucoside-7-Rhamnoside
pSTAT3-TA-Luc 플라스미드(Clontech, Palo Alto, CA)를 주형으로 사용하였다. 올리고뉴클레오티드[AGAGGGTAACGGTACCGTGCTTCCCGAA CGTTGCTTCC(Kpn I 사이트 함유)]와 올리고뉴클레오티드[GTACGCAAGG CTCGAGCTACGTTCGGGAAGCAACGTTC(Xho I 사이트 함유)]를 각각 정방향 프라이머(forward primer)와 역방향 프라이머(reverse primer)로 사용하여, STAT3 DNA 바인딩 시퀀스를 써모싸이클러(thermocycler)로 증폭하였다.pSTAT3-TA-Luc plasmid (Clontech, Palo Alto, Calif.) was used as template. STAT3 DNA binding using oligonucleotides [AGAGGGTAAC GGTACC GTGCTTCCCGAA CGTTGCTTCC (containing Kpn I site)] and oligonucleotides [GTACGCAAGG CTCGAG CTACGTTCGGGAAGCAACGTTC (containing Xho I site)] as forward and reverse primers, respectively. The sequence was amplified with a thermocycler.
증폭한 PCR 생성물을 클로닝하고, 분리한 다음 pSTAT3-TA-Luc 플라스미드의 Kpn I/Xho I 사이트에 삽입하였다. 그리고 적어도 8개의 STAT3 DNA 바인딩 시퀀스 카피를 포함하여 pSTAT-3-TA-Luc보다 향상된 STAT3 리포터 유전자 분석(reporter gene assay)을 가능하게 하는 pSTAT3-TA-Luc6 컨스트럭트(construct)를 제조하였다.The amplified PCR product was cloned, isolated and inserted into the Kpn I / Xho I site of the pSTAT3-TA-Luc plasmid. And a pSTAT3-TA-Luc6 construct was prepared that enables enhanced STAT3 reporter gene assay over pSTAT-3-TA-Luc, including at least eight copies of the STAT3 DNA binding sequence.
IL-6 반응성 STAT3 리포터 유전자 분석은 HepG2 세포(ATCC;HB-8065)에 10% FBS(Foetal Bovine Serum)(v/v), 카나마이신 설페이트(kanamycin sulfate) 60.0㎎/ℓ 및 탄산수소나트륨(NaHCO3) 2.0g/ℓ가 포함된 DMEM 배양액을 사용하여, 37℃에서 5% CO2의 조건으로 배양하였다. 96웰 플레이트에 5×104셀/웰로 HepG2 세포를 분주하여 80% 융합되도록 키웠다. 이후 무혈청 배지 50㎕로 교환하고, 0.1㎍ pSTAT3-TA-Luc6 컨스트럭트와 0.3㎕ 리포펙타민(lipofectamin reagent)의 혼합액을 각 웰에 첨가하여 3시간 반응시킴으로써 pSTAT3-TA-Luc6 컨스트럭트를 트랜스펙션(분리된 핵산의 세포에의 감염)시켰다.IL-6 reactive STAT3 reporter gene analysis was performed on HepG2 cells (ATCC; HB-8065) with 10% Fotal Bovine Serum (FBS) (v / v), kanamycin sulfate (60.0 mg / l) and sodium bicarbonate (NaHCO 3). ) Using a DMEM culture medium containing 2.0g / l, it was incubated at 37
이후, 배지를 깨끗한 배양배지 200㎕로 바꾸어 24시간 배양하여 일시적인 트렌스펙션을 마무리하였다. 트렌스펙션된 세포를 1% BSA/DMEM으로 영양이 부족한 상태에서 배양(serum starvation)하고, 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 1시간 처리한 후 IL-6를 첨가하여 3시간 배양하였다. PBS로 씻어내고, 라이시스 버퍼(promega luciferase assay system) 50㎕를 넣고, 1분간 교반해주었다. 그리고 여기에 30 내지 100㎕의 루시페라아제 물질(promega luciferase assay system)을 넣고 루미노미터(luminometer)로 5분 안에 측정하였다.Thereafter, the medium was changed to 200 µl of clean culture medium and incubated for 24 hours to complete the transient transfection. Transfected cells were cultured under 1% BSA / DMEM under nutritional deficiency (serum starvation), treated with hawthorn extract or quercetin 3-glucoside-7-rhamnoside for 1 hour, and then IL-3 was added to Time incubation. Rinse with PBS, add 50 μl of lysis buffer (promega luciferase assay system) and stir for 1 minute. Then, 30-100 μl of luciferase assay (promega luciferase assay system) was added thereto and measured in 5 minutes with a luminometer.
하기 표 1에 퀘세틴 3-글루코사이드-7-람노사이드의 각기 다른 농도(100, 30, 10, 3 또는 1㎍/㎖)에 대해 IL-6 매개성 루시페라아제가 저해되는 정도를 나타내었다.Table 1 below shows the degree of inhibition of IL-6 mediated luciferase at different concentrations of quercetin 3-glucoside-7-rhamnoside (100, 30, 10, 3 or 1 μg / ml).
퀘세틴 3-글루코사이드-7-람노사이드
Quercetin 3-glucoside-7-
상기 표 1을 통해 확인할 수 있듯이, 산자나무에서 추출한 퀘세틴 3-글루코사이드-7-람노사이드를 처리한 경우, 상기 화합물은 각 농도에서 농도 의존적으로 IL-6 매개성 루시페라아제를 저해하였으며, 계산에 의하면 50% 저해하는 상기 화합물의 농도는 43.37㎍/㎖이었다.As can be seen from Table 1, when treated with quercetin 3-glucoside-7-rhamnoside extracted from the hawthorn, the compound inhibited IL-6 mediated luciferase concentration-dependently at each concentration, according to the calculation The concentration of the compound that inhibited 50% was 43.37 μg / ml.
실시예 4 : 산자나무 추출물 및 퀘세틴 3-글루코사이드-7-람노사이드의 바이러스 증식 억제능 평가Example 4 Evaluation of Viral Proliferation Inhibitory Activity of the Extract of Hawthorn and Quercetin 3-Glucoside-7-Rhamnoside
상기 실시예 1에서 얻은 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드에 대한 바이러스 증식억제능을 측정하기 위해 라이노바이러스(rhinovirus)를 사용하였다.Rhinovirus (rhinovirus) was used to measure the virus proliferation inhibitory effect on the hawthorn extract or quercetin 3-glucoside-7-rhamnoside obtained in Example 1.
라이노바이러스를 HeLa 세포에 감염시켜 증식배양시켰는데, HeLa 세포는 소아태아혈청이 10% 포함된 MEM medium 배지를 사용하여, 37℃ 배양기에서 배양하였다. 그리고 바이러스 증식배양 및 항바이러스능 측정에 사용된 배지는 1% 혈청에 20mM의 MgCl2가 포함된 배양배지를 사용하였다.The rhinoviruses were infected with HeLa cells to proliferate. HeLa cells were cultured in a 37 ° C. incubator using MEM medium medium containing 10% of pediatric serum. The medium used for virus growth and antiviral activity was culture medium containing 20 mM MgCl 2 in 1% serum.
HeLa 세포 2×104개를 96웰 플레이트의 각 웰에 넣고 24시간 배양하였다. 24시간 후에 각 웰의 배양 상등액을 제거하고, TCID50으로 적정된 라이노바이러스 감염용액을 각 웰에 첨가하였다.2 × 10 4 HeLa cells were placed in each well of a 96 well plate and incubated for 24 hours. After 24 hours, the culture supernatant of each well was removed, and rhinovirus infection solution titrated with TCID 50 was added to each well.
그런 다음, 각각 최종농도가 100, 10, 1 또는 0.1㎍/㎖가 되도록 각 웰에 시험물질을 투여하였다. 각 시료에 대한 바이러스 증식 억제능은 48시간 후에 살아있는 세포를 SRB 분석법(Choi 등, 2009)으로 측정하였다. 각 웰에 70% 아세톤을 100㎕씩 첨가한 후, 1시간 동안 -20℃에 방치하고 증류수로 수회 세척하였다. 실온에서 건조시킨 후, 1%(v/v) 아세트산에 녹인 0.4%(w/v) SRB(sulforhodamine B) 용액 100㎕를 첨가해 30분 동안 염색시켰다. 세포와 결합하지 않은 SRB 염색액은 1%(v/v) 아세트산으로 수회 세척한 다음 다시 건조시켰다. 10mM 트리스 용액(pH 10.5) 100㎕를 각 웰에 가하여 세포와 결합되어 있는 염색제를 충분히 녹인 후 562nm에서 흡광도를 측정하였다.Then, test substances were administered to each well such that the final concentration was 100, 10, 1 or 0.1 µg / ml, respectively. Viral proliferation inhibition for each sample was measured after 48 hours by the SRB assay (Choi et al., 2009). 100 μl of 70% acetone was added to each well, and then left at −20 ° C. for 1 hour and washed several times with distilled water. After drying at room temperature, 100 μl of 0.4% (w / v) sulforhodamine B (SRB) solution dissolved in 1% (v / v) acetic acid was added and stained for 30 minutes. SRB stains that did not bind to cells were washed several times with 1% (v / v) acetic acid and then dried again. 100 μl of 10 mM Tris solution (pH 10.5) was added to each well to sufficiently dissolve the dye bound to the cells, and the absorbance was measured at 562 nm.
각 처리군은 바이러스를 처리하지 않은 군(A), 시험물질만 처리한 군(B), 바이러스만 처리한 군(C), 바이러스와 시험물질을 같이 처리한 군(D)으로 표기하였으며, 각각의 시료에 대한 비교 세포 성장률(%)(수학식 1)과 바이러스에 대한 증식억제능(%)(수학식 2)을 계산하였다. 이때, 시험물질로는 산자나무 에탄올 추출물, 퀘세틴 3-글루코사이드-7-람노사이드, 퀘세틴, 루틴, 퀘세틴 3-람노사이드, 퀘세틴 3-글루코사이드, 제니스틴, 리바비린을 사용하였다.Each treatment group was labeled as a group not treated with virus (A), a group treated only with test substance (B), a group treated with virus only (C), and a group treated with a virus and test substance (D). Comparative cell growth rate (%) (Equation 1) and proliferative inhibitory activity (%) for virus (Equation 2) were calculated for the samples. At this time, as the test material, the ethanol extract of the hawthorn, quercetin 3-glucoside-7-rhamnoside, quercetin, rutin, quercetin 3-rhamnoside, quercetin 3-glucoside, genistin, and ribavirin were used.
동일한 조건에서 수행한 세번의 실험결과 수치에 대한 평균과 표준편차로 계산한 값을 제시하였다. 시험물질의 세포독성능은 100, 10, 1 또는 0.1㎍/㎖의 농도에서 시험물질을 가하지 않은 웰의 세포와 비교하였다.The values calculated from the mean and standard deviation of the three experimental results under the same conditions are presented. The cytotoxicity of the test material was compared with cells of wells without test material at concentrations of 100, 10, 1 or 0.1 μg / ml.
하기 표 2에 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드의 바이러스 증식 억제능(HeLa 세포주 내의 HRV3 바이러스)에 관한 실험결과를 나타내었다.Table 2 below shows the experimental results of the virus growth inhibitory ability (HRV3 virus in the HeLa cell line) of the hawthorn extract or quercetin 3-glucoside-7-rhamnoside.
[주] IC50 결과는 독립적인 실험으로 세번 반복하여 얻은 평균치임.[Note] The IC 50 results are the average of three replicates of independent experiments.
a : HeLa 세포를 50% 줄이는 시료의 농도(/㎖)임. a: Sample concentration (/ ml) to reduce HeLa cells by 50%.
b : 세포 병변을 50% 줄이는 시료의 농도(CPE)(/㎖)임.b:
c : 항 바이러스능 = CC50 / IC50임. c: antiviral activity = CC 50 / IC 50 .
d : 50% 이하의 최대 억제율로 인하여 본 실험에 대한 상기 시험물질의 농도 내에서 IC50 값이 측정되지 않음을 의미함.d: means that the IC 50 value is not measured within the concentration of the test substance for this experiment due to the maximum inhibition rate of 50% or less.
상기 표 2를 통해 확인할 수 있듯이, 산자나무 추출물과 이로부터 분리?정제된 퀘세틴 3-글루코사이드-7-람노사이드에 의한 바이러스 증식 억제능을 측정하기 위하여 라이노바이러스를 HeLa 세포에 감염시켜서 증식 배양하는 중에 시료를 농도별로 처리하여 바이러스 증식 억제능을 측정한 결과, 비교약제로 사용한 제니스틴(Genistin)과 리바비린(Ribavirin)보다 산자나무 추출물에서 25배 이상, 순수 분리된 활성물질 퀘세틴 3-글루코사이드-7-람노사이드는 180배 이상의 바이러스 증식 억제능이 나타났다.As can be seen from Table 2, in order to determine the virus growth inhibitory effect by the extract of the hawthorn and quercetin 3-glucoside-7-rhamnoside separated from it during the propagation culture of rhinoviruses infected with HeLa cells As a result of processing the samples by concentration, the virus growth inhibitory ability was measured.As a result, more than 25 times more of the active substance, Quercetin 3-glucoside-7-rhamno, was extracted from the extract of the hawthorn than Genistin and Ribavirin. Said showed more than 180-fold virus growth inhibition.
실시예 5 : 산자나무 추출물 및 퀘세틴 3-글루코사이드-7-람노사이드의 실험용 생쥐에 대한 경구투여 급성독성 시험Example 5 Acute Toxicity Test of Oral Administration of Cypress Extract and Quecetin 3-Glucoside-7-Rhamnoside on Experimental Mice
본 시험에 사용된 SD계 랫트(rat)는 온도 23±3℃, 상대습도 50±10%, 조명시간 12시간(오전 6시~오후 6시), 환기횟수 10~20회/시간 및 조도 150~300룩스(Lux)로 설정된 한국생명공학연구원 실험동물동에서 사육되었다. 시험 실시자들은 모두 고압증기멸균(121℃, 20분)된 작업복, 두건, 마스크 및 장갑 등을 착용하고 작업하였다.SD rats used in this test had a temperature of 23 ± 3 ° C, a relative humidity of 50 ± 10%, an illumination time of 12 hours (6 am to 6 pm), a ventilation frequency of 10 to 20 times / hour and an illuminance of 150 The animal was bred in the laboratory animal building of Korea Research Institute of Bioscience and Biotechnology, set at ~ 300 lux. The test subjects all wore working clothes, hoods, masks and gloves that had been autoclaved (121 ° C., 20 minutes).
랫트는 순화, 검역기간 동안에는 폴리카보네이트제 구두통형 사육상자(260W×410L×200H㎜)에 수용되었으며, 투여 및 관찰기간 중에는 와이어사육상자(205W×350L×175H㎜)에 한마리씩 수용되었다. 시험기간 중 사육상자는 시험번호 및 동물번호를 기입한 라벨지를 붙여 식별하였다.The rats were housed in polycarbonate shoeboxes (260W × 410L × 200Hmm) during the purifying and quarantine periods, and one by one in wire cages (205W × 350L × 175Hmm) during the administration and observation periods. During the trial period, breeding boxes were identified by labeling with test and animal numbers.
6주령의 특정병원성부재(SPF) SD계 랫트를 군당 다섯마리로 나누어, 본 발명의 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 0.5% 메틸셀룰로오즈 용액에 현탁하여 10mg/kg의 용량으로 단회 경구투여 하였다. 투여 후, 동물의 폐사여부, 임상증상, 체중변화를 관찰하였고, 혈액학적 검사와 혈액생화학적 검사를 실시하였으며, 부검하여 육안으로 복강장기와 흉강장기의 이상여부를 관찰하였다.Six-week-old SPF rats were divided into five rats per group, and the dose of 10 mg / kg was determined by suspending the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention in a 0.5% methylcellulose solution. Single oral administration. After administration, mortality, clinical symptoms, and changes in body weight were observed. Hematological and hematological examinations were performed. Necropsy was performed to visually observe abdominal and thoracic organ abnormalities.
그 결과, 본 발명의 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 투여한 동물에서는 주목할 만한 임상증상이 나타나거나 폐사된 동물은 관찰되지 않았다. 또한, 체중변화, 혈액검사, 혈액생화학적 검사, 부검소견 등에서도 독성변화는 관찰되지 않았다.As a result, remarkable clinical symptoms or no dead animals were observed in the animal treated with the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention. In addition, no toxic changes were observed in body weight changes, blood tests, blood biochemical tests, and autopsy findings.
투여한 상기 퀘세틴 3-글루코사이드-7-람노사이드 화합물은 랫트에서 10mg/kg까지 독성변화를 나타내지 않았으며, 경구 투여 최소 치사량(LD50)은 10mg/kg 이상으로 판단되었다.The quercetin 3-glucoside-7-rhamnoside compound administered showed no toxicity change to 10 mg / kg in rats, and the minimum lethal dose (LD 50 ) for oral administration was determined to be 10 mg / kg or more.
본 발명은 이상에서 살펴본 바와 같이 바람직한 실시예를 들어 도시하고 설명하였으나, 상기한 실시예에 한정되지 아니하며 본 발명의 정신을 벗어나지 않는 범위 내에서 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자에 의해 다양한 변경과 수정이 가능할 것이다.Although the present invention has been shown and described with reference to the preferred embodiments as described above, it is not limited to the above embodiments and those skilled in the art without departing from the spirit of the present invention. Various changes and modifications will be possible.
도 1은 본 발명에 따른 퀘세틴 3-글루코사이드-7-람노사이드의 분자량측정 스펙트럼이다.1 is a molecular weight spectrum of quercetin 3-glucoside-7-rhamnoside according to the present invention.
도 2는 본 발명에 따른 퀘세틴 3-글루코사이드-7-람노사이드의 수소핵자기공명 스펙트럼(DMSO d-6, 300MHz)을 나타낸 것이다.Figure 2 shows the hydrogen nuclear magnetic resonance spectrum (DMSO d- 6, 300MHz) of the quercetin 3-glucoside-7-rhamnoside according to the present invention.
도 3은 본 발명에 따른 퀘세틴 3-글루코사이드-7-람노사이드의 탄소핵자기공명 스펙트럼(DMSO d-6, 75MHz)을 나타낸 것이다.Figure 3 shows the carbon nuclear magnetic resonance spectrum (DMSO d- 6, 75MHz) of the quercetin 3-glucoside-7-rhamnoside according to the present invention.
도 4는 본 발명에 따른 퀘세틴 3-글루코사이드-7-람노사이드의 DEPT 스펙트럼(DMSO d-6, 75MHz)을 나타낸 것이다.Figure 4 shows the DEPT spectrum (DMSO d- 6, 75 MHz) of quercetin 3-glucoside-7-rhamnoside according to the present invention.
<110> Korea Research Institute of Bioscience and Biotechnology <120> A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom <130> PA090147/KR <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for STAT3 <400> 1 agagggtaac ggtaccgtgc ttcccgaacg ttgcttcc 38 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for STAT3 <400> 2 gtacgcaagg ctcgagctac gttcgggaag caacgttc 38 <110> Korea Research Institute of Bioscience and Biotechnology <120> A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom <130> PA090147 / KR <160> 2 <170> Kopatentin 1.71 <210> 1 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for STAT3 <400> 1 agagggtaac ggtaccgtgc ttcccgaacg ttgcttcc 38 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for STAT3 <400> 2 gtacgcaagg ctcgagctac gttcgggaag caacgttc 38
Claims (22)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020090052446A KR101186264B1 (en) | 2009-06-12 | 2009-06-12 | A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom |
PCT/KR2010/003791 WO2010143919A2 (en) | 2009-06-12 | 2010-06-11 | Method and composition for preventing or treating il-6-mediated diseases or rhinovirus infections |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020090052446A KR101186264B1 (en) | 2009-06-12 | 2009-06-12 | A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020120039996A Division KR101220519B1 (en) | 2012-04-17 | 2012-04-17 | A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20100133747A KR20100133747A (en) | 2010-12-22 |
KR101186264B1 true KR101186264B1 (en) | 2012-09-27 |
Family
ID=43309391
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020090052446A KR101186264B1 (en) | 2009-06-12 | 2009-06-12 | A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR101186264B1 (en) |
WO (1) | WO2010143919A2 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101334348B1 (en) * | 2011-12-21 | 2013-11-29 | 한국생명공학연구원 | Flavonoid Comprising Anti-Virus Activity |
IT202000026566A1 (en) * | 2020-11-06 | 2022-05-06 | Herbal E Antioxidant Derivatives Srl Ed In Forma Abbreviata H&Ad Srl | COMBINATIONS OF NATURAL ANTIVIRAL AND ANTIMICROBIAL, THEIR USE AND FORMULATIONS CONTAINING THEM |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7166435B2 (en) * | 2001-08-06 | 2007-01-23 | The Quigley Corporation | Compositions and methods for reducing the transmissivity of illnesses |
CA2539534A1 (en) * | 2003-09-22 | 2005-04-07 | Genyous Biomed International Inc. | Hippophae rhamnoides compositions for cancer therapy |
-
2009
- 2009-06-12 KR KR1020090052446A patent/KR101186264B1/en not_active IP Right Cessation
-
2010
- 2010-06-11 WO PCT/KR2010/003791 patent/WO2010143919A2/en active Application Filing
Also Published As
Publication number | Publication date |
---|---|
WO2010143919A3 (en) | 2011-04-14 |
KR20100133747A (en) | 2010-12-22 |
WO2010143919A2 (en) | 2010-12-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR100720151B1 (en) | Flavonoid comprising antiviral activity | |
KR100545723B1 (en) | Water soluble extract from plant of Solanum genus and the preparation process thereof, and pharmaceutical composition containing the water soluble extract | |
Han et al. | Novel carbohydrate modified berberine derivatives: synthesis and in vitro anti-diabetic investigation | |
KR101818084B1 (en) | A composition comprising extract of Lycopodiella cernua or compound isolated therefrom for preventing or treating of Alzheimer disease-Ⅱ | |
CN104370871B (en) | The mouth diphenylene ketone oxide class separated from Swertia punicea Hemsl. and the application of suppression hepatitis B virus | |
KR101509554B1 (en) | Pharmaceutical composition for prevention and/or treatment of bone disease, functional food or health food comprising the composition, and pharmaceutical preparation comprising the composition as actⅳe ingredient | |
RU2684100C1 (en) | Fillygenin and glucuronic acid derivative, method for production thereof and use thereof | |
Nagah et al. | Bioguided isolation and in-silico analysis of Hep-G2 cytotoxic constituents from Laurus nobilis Linn. cultivated in Egypt | |
KR101186264B1 (en) | A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom | |
Parcha et al. | Cardioprotective effect of various extract of Rhododendron arborium Sm flower on Albino rats | |
KR101752247B1 (en) | A composition comprising compounds isolated from Selaginella tamariscina for preventing or treating metabolic disorder | |
KR101220519B1 (en) | A composition for diseases mediated by IL-6 or rhinovirus infectious diseases comprising an extract of Hippophae rhamnoides or a compound isolated therefrom | |
Han et al. | Inhibitory activity of a phytochemically characterized fraction from Streptocaulon juventas on lung cancer in nude mice | |
KR101248404B1 (en) | A composition comprising saponins isolated from anemone rivularis for treating or preventing metabolic diseases | |
WO2016178490A2 (en) | Pharmaceutical composition for preventing or treating gout and food composition for alleviating hyperuricemia, containing extract of salvia plebeia r. br. or fraction thereof | |
US20100041900A1 (en) | Isolation of lactam compound from adlay bran and its use on anti-proliferative cancer cells | |
Lu et al. | In vitro and in vivo apoptosis-inducing antileukemic effects of Mucuna macrocarpa stem extract on HL-60 human leukemia cells | |
KR20100115514A (en) | Anti infulenza virus composition | |
KR100628209B1 (en) | Use of hederagenin 3-O-α-L-rhamnopyranosyl(1→2)-[β-D-glucopyranosyl(1→4)]-α-L-arabinopyranoside or extracts from Pulsatillae radix containing the same as therapeutic agents for solid tumors | |
KR100542323B1 (en) | Preparation method of compounds with apoptosis-inducing activity on cells from the Machilus thunbergii | |
KR101861160B1 (en) | Composition for growth inhibition of cancer stem cells comprising extracts of Sticta weigelii, or brevicid X or salt thereof as an active ingredient | |
KR101252467B1 (en) | PPARγ agonists isolated from Cleistocalyx operculatus and compositions for prevention and treatment of diabetis mellitus containing the same as an active ingredients | |
Volochai et al. | The organic and amino acid composition of herb and rhizome Chamaenerion angustifolium (L.) Scop | |
US11452708B2 (en) | Discovery of potent [alpha]-glucosidase inhibitors from Heterophragma adenophyllum | |
Meselhy et al. | Study of Coumarin Content of Pelargonium fragrans-Willd. Root Grown in Egypt |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E902 | Notification of reason for refusal | ||
A107 | Divisional application of patent | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20150915 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20160808 Year of fee payment: 5 |
|
LAPS | Lapse due to unpaid annual fee |