KR101168052B1 - Kits for Determining a Diabetes Mellitus and Uses Thereof - Google Patents

Abstract

The present invention relates to a kit for diagnosing and diagnosing human diabetes. The C allele ( APOA5 -1131T> C) at the -1131 position of the APOA5 (Apolipoprotein A5) gene promoter, the single nucleotide polymorphisms (SNPs) of the present invention, can be used to diagnose diabetes in humans, especially Korean women. Accordingly, the kits and methods of the present invention comprising the SNPs of the present invention can diagnose human diabetes very effectively and easily.

Apolipoprotein A5, SNP, Triglycerides, Diabetes, Cardiovascular Complications

Description

Kits for Determining a Diabetes Mellitus and Uses Thereof}

The present invention relates to a kit for diagnosing and diagnosing human diabetes.

Apolloprotein A5 gene ( APOA5 ) is involved in triglyceride (TG) metabolism in both the fasting and dietary states of humans [1-3]. Among many common single nucleotide polymorphisms (SNPs) of the APOA5 gene, the C allele at the -1131 position of the APOA5 gene promoter ( APOA5 -1131T> C) is associated with hypertriglyceridemia and many Korean populations. Was most closely associated with an increased risk of coronary artery disease (CAD). The frequency of the C allele on APOA5-1131SNP also varies within the population, which is relatively high in East Asians (33% in Chinese and Japanese and 28-30% in Korean) compared to Westerners [2, 4-9]. In previous studies by the present inventors, APOA5 -1131C allele was associated with more high TG level, the typical environmental factors independently from those higher cardiovascular disease in Korean identify significant factor involved in the (cardiovascular disease, CVD) [2, 10].

Hypertriglyceridemia is not only a classic risk factor in CVD but also a commonly known risk factor that causes lipid abnormalities in diabetes mellitus (DM). Hypertriglyceridemia is also an independent risk factor for atherosclerosis caused by type 2 diabetes [11, 12]. As a result, the APOA5 gene has been in the spotlight as a potential candidate for the development of vascular complications in type 2 diabetes or the development of diabetes itself. However, the results are still inconsistent. Zhai et al. Reported that the frequency of the APOA5 -1131C allele in DM patients was significantly higher than the frequency of the allele in patients without diabetes [13]. CC homozygote (homozygote) had a 3.75-fold higher risk of DM than TT genotype and C carriers in DM patients contributed to increased levels of TG, total-cholesterol and LDL-cholesterol in plasma. There was no effect on insulin resistance. Yan et al. Found an increased association between APOA5 -1131C allele and TG in type 2 diabetes in the Chinese population, and found that the risk of type 2 diabetes with CAD in C carriers was more than doubled in patients with TT. [14]. However, gender, low HDL-cholesterol and higher TG, and adjustment to smoking significantly diminished the increased risk. Meanwhile, Talmud et al. Reported a 15-year follow-up study of healthy UK men that had no effect of the APOA5 genotypes (-1131T> C and S19W) on the risk of developing type 2 diabetes (Northwick Park Heart). Study II; 15). However, there were no studies on the relationship between diabetes and APOA5 -1131T> C polymorphism in the Korean population.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The inventors have sought to develop new methods for diagnosing diabetes in humans. As a result, the present inventors have found that human apolipoprotein A5 (APOA5) C allele of the -1131 position of the promoter gene; single nucleotide polymorphism of (allele APOA5 -1131T> C) ( single nucleotide polymorphisms, SNPs) the risk of diabetes in Korean women The present invention is completed by finding that the C allele described above is a CC homozygote, and the risk of diabetes and cardiovascular complications is increased more than that of the TT or TG genotype. It became.

Accordingly, it is an object of the present invention to provide a kit for diagnosing human diabetes.

Another object of the present invention is to provide a method for diagnosing human diabetes.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to an aspect of the present invention, the present invention provides 10-100 consecutive sequences of the C allele comprising the C nucleotide ( APOA5 -1131T> C) at the -1131 position of the APOA5 gene promoter, which is SEQ ID NO: 1 It provides a kit for diagnosing human diabetes comprising a primer or probe that specifically binds to the nucleotide sequence.

The inventors have sought to develop new methods for diagnosing diabetes in humans. As a result, the present inventors have found that human apolipoprotein A5 (APOA5) C allele of the -1131 position of the promoter gene; single nucleotide polymorphism of (allele APOA5 -1131T> C) ( single nucleotide polymorphisms, SNPs) the risk of diabetes in Korean women It has been found that the C allele described above has an increased risk of diabetes and cardiovascular complications than the TT or TG genotype.

The present invention investigated the association of apolipoprotein A5 with diabetes in Korean women.

Apolipoprotein A5 is a determinant of plasma triglyceride levels, a major risk factor for coronary artery disease (CAD), and is very low-density lipoprotein (VLDL), high-density lipoprotein (HDL), or kilo It is an element of lipoproteins, including chylomicrons. Apolipoprotein A5 interacts with LDL-R gene family receptors to affect lipoprotein metabolism (Nilsson SK, Christensen S, Raarup MK, Ryan RO, Nielsen MS and Olivecrona G, Endocytosis of apolipoprotein AV by members of the low density lipoprotein receptor and the Vps10p domain receptor families.J. Biol. Chem. , 283: 25920-25927 (2008)).

According to the invention, the present invention APOA5 -1131T> C shows a very close correlation with diabetes. The kit of the present invention specifically relates to 10-100 consecutive nucleotide sequences of the C allele comprising the C nucleotide ( APOA5 -1131T> C) at the -1131 position of the APOA5 gene promoter, SEQ ID NO: 1 Comprising a binding primer or probe, Complementary expression of the C nucleotides are G nucleotides can be used to diagnose human diabetes. More preferably, the kit of the present invention can be used for Korean women.

As used herein, the term “nucleotide” is a deoxyribonucleotide or ribonucleotide that exists in single- or double-stranded form, and includes analogs of natural nucleotides unless otherwise specified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990).

The present invention relates to an allele in which the nucleotide at the -1131 position in the APOA5 (Apolipoprotein A5) gene promoter nucleotide sequence is "C", but when such an allele nucleotide is found in a double stranded genomic DNA (gDNA) It is also understood to include nucleotide sequences that are complementary to the sequence. In other words, "C", which is a single nucleotide polymorphism (SNPs), becomes "T" in the complementary nucleotide sequence. In this aspect, all sequences herein are based on sequences in the sense strand in gDNA, unless otherwise noted.

As used herein, “single nucleotide polymorphisms” (SNPs) are those that occur when a single base (A, T, C, or G) in the genome differs between members of a species or between paired individual chromosomes of an individual. Refers to the diversity of DNA sequences. For example, three DNA fragments from different individuals (eg AAGT [A / A] AG, AAGT [A / G] AG, AAGT [G / G] AG, -1131T / C in the SNP of the present invention is expressed as a complementary base of A / G ) When included, it is called two alleles (C or T), and generally all SNPs have two alleles. Within a population, SNPs may be assigned a minor allele frequency (MAF; the lowest allele frequency at the locus found in a particular population). Variations exist within the human population, and one SNP allele common in geological or ethnic groups is very rare. Single bases can be altered (replaced), removed (deleted) or added (inserted) to the polynucleotide sequence. SNPs can cause changes in the translation frame.

Mononucleotide polymorphisms can be included in coding sequences of genes, non-coding regions of genes or intergenic regions between genes. SNPs in the coding sequence of a gene do not necessarily cause a change in the amino acid sequence of the target protein due to the degeneracy of the genetic code. SNPs that form the same polypeptide sequence are called synonymous (sometimes called silent mutations), and non-synonymous for SNPs that form other polypeptide sequences. Non-synonymous SNPs can be missense or nonsense, where the missense change results in another amino acid, while the nonsense change forms a nonmature termination codon. SNPs that are not at the protein-coding site can cause gene silencing, transcription factor binding or non-coding RNA sequences.

Variability on human DNA sequences can affect the onset of disease and how humans respond to pathogens, chemicals, drugs, vaccines, and other reagents. SNPs are also considered to be key enablers for realizing the concept of personalized medicine. Above all, SNPs, which are being actively developed as markers recently, are the most important in biomedical research to diagnose diseases by comparing genomic regions between groups with or without disease. SNPs are the largest variation of the human genome, and are believed to exist at one SNP ratio per 1.9 kb (Sachidanandam et al., 2001). SNPs are very stable genetic markers, sometimes directly affecting the phenotype, and are well suited for automated genotyping systems (Landegren et al., 1998; Isaksson et al., 2000). SNPs research is also important in grain and livestock raising programs.

According to the present invention, the present invention can be annealed to a polynucleotide of SEQ ID NO: 1 sequence, and comprises a primer pair designed to amplify a polynucleotide comprising the -1131 nucleotide of SEQ ID NO: 1 sequence Diabetic diagnostic kits.

Preferably, the forward primer among the primer pairs includes a nucleotide sequence capable of annealing with a sequence adjacent to a human diabetes-associated mononucleotide polymorphism (SNP) base corresponding to the -1131 nucleotide in SEQ ID NO: 1; , 3′-end of the forward primer has a base complementary to the SNP base.

According to a preferred embodiment of the invention, the method of the invention may be gene amplification or microarray. More preferably, the amplification of the present invention is carried out according to a polymerase chain reaction (PCR). According to a preferred embodiment of the present invention, the primers of the present invention are used for gene amplification reactions.

As used herein, the term “amplification reaction” means a reaction that amplifies a nucleic acid molecule. Various amplification reactions are reported in the art, which include polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcriptase-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual , 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction (LCR) ( 17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) (19) (WO 88/10315), autologous Self sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (US Pat. No. 6,410,276), consensus sequence priming polymerase chain Consensus sequence primed polymerase chain reaction (CP-PCR) (US Pat. No. 4,437,975), optionally Arbitrarily primed polymerase chain reaction (AP-PCR) (US Pat. Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA) (US Pat. No. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification (21, 22) and loop-mediated isothermal amplification; LAMP) 23, but is not limited thereto. Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and US Pat. No. 09 / 854,317.

PCR is the best known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (inverse polymerase) chain reaction (IPCR), vectorette PCR and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR . BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

When the diagnostic kit of the present invention is carried out using a primer, a gene amplification reaction is performed to analyze the nucleotide sequence of the marker of the present invention. Since the present invention is to detect the nucleotide sequence of the marker of the present invention, the MS or DM can be determined by investigating by determining the nucleotide sequence of the marker of the present invention in a sample (eg, genomic DNA) to be analyzed.

In the most preferred embodiment of the invention, the amplification process is carried out according to the polymerase chain reaction (PCR) disclosed in US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159.

As used herein, the term “primer” refers to an oligonucleotide, which is a condition in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, i.e., the presence of a polymerizer such as nucleotide and DNA polymerase, and It can serve as a starting point for the synthesis at conditions of suitable temperature and pH. Preferably, the primer is deoxyribonucleotide and single chain. Primers used in the present invention may comprise naturally occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primer may also include ribonucleotides.

As used herein, the term "extension primer" refers to a primer that is annealed to a target nucleic acid to form a sequence complementary to the target nucleic acid by a template-dependent nucleic acid polymerase. The extension primer is an annealed probe. It extends to position to occupy the region where the probe is annealed.

The extension primer used in the present invention includes a hybridizing nucleotide sequence complementary to the first position of the target nucleic acid. The term “complementary” means that the primer or probe is sufficiently complementary to selectively hybridize to a target nucleic acid sequence under certain annealing or hybridization conditions, and is substantially complementary and perfectly complementary. It has the meaning encompassing all, and preferably means completely complementary. As used herein, the term “substantially complementary sequence” as used in connection with a primer sequence is intended to partially match the sequence to be compared, as well as to the exact match, as well as to the extent that it may serve as a primer by annealing to a particular sequence. Mismatched sequences are also included.

The primer should be long enough to prime the synthesis of the extension product in the presence of the polymerizer. Suitable lengths of the primers depend on a number of factors, such as temperature, application and source of the primer, but are typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form hybrid complexes that are sufficiently stable with the template. The term “annealing” or “priming” refers to the placement of an oligodioxynucleotide or nucleic acid into a template nucleic acid, where the polymerase polymerizes the nucleotide to form a nucleic acid molecule that is complementary to the template nucleic acid or portion thereof. Let's do it.

The sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient if the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer in the present invention does not need to have a sequence that is perfectly complementary to the above-described nucleotide sequence as a template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to the gene sequence to act as a primer. The design of such primers can be easily carried out by those skilled in the art with reference to the above-described nucleotide sequence, for example, by using a program for primer design (eg, PRIMER 3 program).

The nucleotide sequence of the target of the present invention to be referred to in the preparation of the primer can be found in GenBank. For example, the nucleotide sequence of the C allele (gene accession number: rs662799) including the C nucleotide ( APOA5 -1131T> C) at the -1131 position of the APOA5 gene promoter (SEQ ID NO: 1), which is the target sequence of the present invention, is listed. Is disclosed and primers can be designed with reference to this sequence. 'R', the 27th nucleotide set forth in SEQ ID NO: 1, means A / G. Preferably, the forward primers among the primer pairs comprise a nucleotide sequence capable of annealing with a sequence adjacent to a human diabetes-associated mononucleotide polymorphism (SNP) base corresponding to the −1131 nucleotide in SEQ ID NO: 1; The 3′-end of the aromatic primer has a base complementary to the SNP base.

As used herein, the term “nucleic acid molecule” is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides, which are the basic structural units in nucleic acid molecules, modify not only natural nucleotides, but also sugar or base sites. Analogues (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990)).

If the starting material in the kit of the invention is gDNA, isolation of gDNA can be carried out according to conventional methods known in the art (Rogers & Bendich (1994)).

If the starting material is mRNA, total RNA is isolated and performed by conventional methods known in the art (see Sambrook, J. et al., Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press ( 2001); Tesniere, C. et al., Plant Mol. Biol. Rep. , 9: 242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology , John Willey & Sons (1987); and Chomczynski, P. et al., Anal.Biochem. 162: 156 (1987)). The isolated total RNA is synthesized into cDNA using reverse transcriptase. Since the total RNA is isolated from humans (e.g., diabetic patients), the end of the mRNA has a poly-A tail, and cDNA can be easily synthesized using oligo dT primer and reverse transcriptase using this sequence characteristic. ( PNAS USA , 85: 8998 (1988); Libert F, et al., Science , 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning.A Laboratory Manual , 3rd ed.Cold). Spring Harbor Press (2001).

In the kit of the present invention, it can be carried out by applying a variety of methods known in the art used to identify the specific sequence. For example, techniques applicable to the present invention include fluorescence phosphorylation hybridization (FISH), direct DNA sequencing, PFGE analysis, southern blot analysis, single-strand conformation analysis (SSCA, Orita et al., PNAS, USA 86: 2776 (1989)), RNase protection assay (Finkelstein et al., Genomics , 7: 167 (1990)), dot blot analysis, denaturation gradient gel electrophoresis (DGGE, Wartell et al., Nucl. Acids Res. , 18: 2699 (1990)), methods using proteins that recognize nucleotide mismatches (e.g., mutS proteins of E. coli ) (Modrich, Ann. Rev. Genet. , 25: 229-253 (1991)), and Allele-specific PCR, including but not limited to.

Sequence changes result in differences in base bonds within single-stranded molecules, resulting in different bands of mobility, which SSCA detects. DGGE analysis uses denaturation gradient gels to detect sequences that exhibit mobility different from wild-type sequences.

Other techniques generally employ probes or primers that are complementary to sequences comprising the SNPs of the invention.

For example, in RNase protection assays riboprobes complementary to the sequences comprising the SNPs of the invention are used. The riboprobe and DNA or mRNA isolated from humans are hybridized and then cleaved with an RNase A enzyme capable of detecting mismatches. If there is a mismatch and RNase A recognizes, a smaller band is observed.

In assays using hybridization signals, probes complementary to the sequences comprising the SNPs of the invention are used. In this technique, hybridization signals of probes and target sequences are detected to directly determine DM or MS.

As used herein, the term “probe” refers to a linear oligomer having naturally occurring or modified monomers or bonds, including deoxyribonucleotides and ribonucleotides that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably deoxyribonucleotide.

As the probe used in the present invention, a sequence perfectly complementary to the sequence including the SNP may be used, but a sequence complementarily complementary to a range that does not prevent specific hybridization may be used. It may be. Preferably, the probe used in the present invention comprises a sequence capable of hybridizing to a sequence comprising 10-30 contiguous nucleotide residues comprising the -1131 nucleotide in the SEQ ID NO: 1 sequence. More preferably, the 3′-end or 5′-end of the probe has a base complementary to the SNP base. Generally, the stability of duplexes formed by hybridization tends to be determined by the consensus of the sequences of the ends, so that the ends in probes having bases complementary to the SNP base at the 3'- or 5'-ends If the parts are not hybridized, these duplexes can be dismantled under stringent conditions.

Conditions suitable for hybridization include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach , Decisions may be made with reference to those disclosed in IRL Press, Washington, DC (1985). Stringent conditions used for hybridization can be determined by adjusting the temperature, ionic strength (buffer concentration), the presence of compounds such as organic solvents, and the like. Such stringent conditions can be determined differently depending on the sequence being hybridized.

According to a preferred embodiment of the invention, humans with the C allele of the invention increase the risk of diabetes.

According to a preferred embodiment of the invention, the C allele of the invention is a CC homozygous. More preferably, when the C allele of the present invention is a CC homozygotes, the risk of human diabetes and cardiovascular complications is increased even more than when TT or TC genotypes are present.

According to a preferred embodiment of the present invention, the cardiovascular complications described above include hypertriglyceridemia, congestive heart failure, cardiac hypertrophy, arrhythmia, coronary artery disease (CAD) or cardiovascular disease (CVD), It is not limited to this.

According to a preferred embodiment of the present invention, the above-described coronary artery disease is myocardial infarction, angina pectoris, other chronic coronary artery disease, atherosclerosis, acute coronary syndrome (eg, unstable angina pectoris, non-ST-elevation myocardial infarction (NSTEMI)). Or ST-elevation myocardial infarction (STEMI), peripheral arterial occlusive disease (PAOD), or cerebrovascular seizures.

According to a preferred embodiment of the present invention, the association between the SNPs of the present invention and diabetes is calculated by the odds rate (OR). As used herein, the term “odds rate (OR)” means a value that compares the probability that a particular disease or event will occur in two groups. In general, the calculation of the ratio is carried out as follows.

variable Disease or event U radish U a b radish c d

OR = (a / b) / (c / d).

According to the present invention, the genotype distribution and allele frequency between healthy controls and metabolic abnormalities (MA / MSG / IFG) or diabetic patients can be compared through the results of the ratio of the present invention. More specifically, a crossover ratio of 1 means that the incidence is the same in both groups, and a crossover ratio of greater than 1 indicates a greater incidence in patients with metabolic disorders or diabetes than healthy controls.

According to a preferred embodiment of the invention, the crossover ratio of the invention exhibits values of 1.1-10.0, more preferably 1.2-9.0, even more preferably 1.3-8.0 and most preferably 1.4-7.0.

According to a preferred embodiment of the present invention, the ratio of the present invention is one or more selected from the group consisting of age, body mass index (BMI), menopause, smoking, drinking, metabolic syndrome (MS) and lipid drugs Calculate by adjusting to a variable.

According to a preferred embodiment of the present invention, the MS of the present invention has a waist circumference (female) of> 80 cm, ≥150 mg / dl of triglyceride (TG), and <50 mg / dl of high-density lipoprotein (HDL)- At least three or more components from the group consisting of cholesterol (female), blood pressure of ≧ 130 / ≧ 85 mmHg and fasting glucose of ≧ 100 mg / dl.

According to another aspect of the present invention, the present invention provides a method for identifying a human nucleotide sequence ( APOA5 -1131T> C) consisting of SEQ ID NO: 1 in human biological samples to provide information for diagnosing human diabetes. In diagnosing diabetes, if the nucleotide sequence comprises C and the adjusted OR is measured to be 1.4-7.0, it is determined to be diabetes.

Since the method of the present invention is an essential component of the above-described primer, the detailed description of the primer also applies to the primer used in the method of the present invention. Therefore, the description is omitted to avoid excessive complexity of the present specification in accordance with the repeated description.

When the method of the present invention is applied to a PCR amplification process, the method of the present invention may optionally include reagents necessary for PCR amplification, such as buffers, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus ). filiformis , Thermis flavus , Thermococcus literalis or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs. The method of the present invention can be prepared in a number of separate packaging or compartments comprising the reagent components described above.

As used herein, the term “diagnosis” refers to determining the susceptibility of an object to a particular disease or condition, determining whether an object currently has a particular disease or condition (eg, metabolic abnormalities or diabetes mellitus). Identification), determining the prognosis of an object with a particular disease or condition, or terrametrics (e.g., monitoring the condition of an object to provide information about treatment efficacy). do.

According to a preferred embodiment of the present invention, the methods of the present invention may further comprise analyzing serum lipid profiles, apolipoproteins A1, A5 and B, glucose or plasma low-density lipoprotein (LDL) particle sizes.

According to a preferred embodiment of the invention, the method of the invention uses gene amplification or microarray.

The features and advantages of the present invention are summarized as follows:

(Iii) The present invention relates to a kit for diagnosing and diagnosing human diabetes.

(Ii) The C allele ( APOA5 -1131T> C) at the -1131 position of the APOA5 gene promoter, the single nucleotide polymorphism (SNPs) of the present invention, can be used to diagnose diabetes in humans, particularly Korean women. have.

(Iii) The kits and methods of the present invention comprising the SNPs of the present invention can diagnose human diabetes very effectively and easily.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example 1

Experimental Materials and Experimental Methods

Study group

All participants were Korean women supported by the Health Promotion Center during the routine check-up of Severance Hospital (January 2007-October 2008). Exclusion criteria include orthopedic limitations, weight loss / increase in the previous six months, diagnoses of vascular disease, cancer or kidney disease, liver disease, thyroid disease, or acute or chronic inflammatory by clinical or medical history. Disease included. Study participants were divided into three groups: healthy controls, diabetes and metabolic abnormalities (MA). Healthy controls were limited to participants who did not have any of the diagnosed diseases or MA. In addition, healthy controls were not taking any medications (antihypertensive, antidyslipidemic, antithrombotic and antidiabetic). MA included metabolic syndrome (MS) or impaired fasting glucose (IFG). The definition of MS was in accordance with variations of the National Cholesterol Board of Education-Adult Therapy Panel III (NCEP-ATPIII) guidelines, the Asia-Pacific guidelines and the American Diabetes Association Guidelines. Definition of MS is waist circumference (female)> 80 cm, triglyceride (TG) ≥ 150 mg / dl, HDL-cholesterol (female) <50 mg / dl, blood pressure ≥130 / ≥85 mmHg or ≥100 Although at least three or more components of fasting glucose of mg / dl were included, fasting blood glucose of 100-125 mg / dl was substantially classified as IFG according to the American Diabetes Association guidelines. Diabetes (Diabetes mellitus, DM) includes cases of fasting blood glucose of ≧ 126 mg / ml via the screening or screening of a hypoglycemic agent prescribed by a doctor and diagnosed with DM from a hospital. Finally, the study included 3,450 individual Korean women consisting of a healthy control group (n = 2,033), DM (n = 304), and MA (n = 1,113). Written informed consent was obtained from all patients, and the protocol was approved by the Institute of Review Board of Yonsei University.

Obesity indicators, blood pressure measurement and blood gain

Body weight and height were measured in the morning without shoes and without clothes. Blood pressure was measured using an automatic blood pressure monitor (TM-2654; A & D, Tokyo, Japan) in the left arm of the sitting patient 20 minutes after resting. After an overnight fasting period, venous blood samples were obtained in EDTA-treated or regular tubes, centrifuged to obtain plasma or serum and stored at −0 ° C. until analysis.

APOA5 C genotyping

Genomic DNA was extracted from 5 ml of total blood using a commercially available DNA isolation kit (WIZARDR Genomic DNA purification kit, Promega Corp., Madison, Wis.) According to the manufacturer's protocol. -1131T> C genotyping was performed by SNP-IT ™ assay (SNPstream 25K ™ System, Orchid Biosystems, NJ) using a single primer extension technique using the primers of Table 1. The results of yellow and / or blue coloration were analyzed with an ELISA reader and final genotype calls were calculated using the QCReview ™ program.

Primer sequence. shape primer  PCR-F TGAAGATGAGATGGCAAGAG  PCR-L atttgggcttgctctcct SNP Primer GAGCCCCAGGAACTGGAGCGAAAGT

Serum Lipid Profile, Apolipoproteins A1 and B, and Blood Sugar

Serum concentrations of TG and total cholesterol were measured using commercially available kits on a Hitachi 7150 automated analyzer (Hitachi Ltd. Tokyo, Japan). After using dextran sulfate magnesium to precipitate chylomicron, low-density lipoprotein (LDL) and high-density lipoprotein (HDL) cholesterol from the supernatant was measured by enzymatic method. LDL cholesterol was measured indirectly in patients with TG concentrations of <4.52 mol / l (400 mg / ml) using the Friedewald formula. In patients with TG concentrations of> 4.52 mol / l, LDL cholesterol was measured directly by enzymatic methods using a Hitachi 7150 analyzer. Serum apolipoproteins A1 and B were determined by turbidometry at 340 nm using specific anti-serum (Roche, Switzerland). Blood glucose was measured using the glucose oxidase method on a Beckman glucose analyzer (Beckman Instruments, Irvine, Calif.).

Plasma Apolipoprotein A5

Plasma apolipoprotein A5 (ApoaA5) concentrations were measured using an enzyme immunoassay (Human Apolipoprotein A ELISA Kit, Millipore, MO). The resulting color reaction was read at 450 nm using Victor ² (Perkin Elmer life sciences, Turka, Finland). Intra- and inter-assay CVs were 2.46% and 7.45%, respectively.

Plasma LDL particle size

The particle size distribution (1.019-1.063 g / ml) of LDL separated by continuous flotation ultracentrifugation contained 2-16% linear gradient acrylamide (Alamo Gels Inc., San Antonio, TX). Measurements were made with a pupil-gradient lipoprotein system (CBS Scientific, CA) using commercially available non-modified polyacrylamide slabs. To assess the relative migration (Rf) rate of each band, latex beads (30 nm) (Duke Scientific Corporation, Palo Alto, Calif., USA), thyroglobulin (17 nm; GE Healthcare, Buckinghamshire, UK), Standards of apoferritin (12.2 nm; GE Healthcare, Buckinghamshire, UK) and catalase (10.4 nm; GE Healthcare, Buckinghamshire, UK) were used. Gels were scanned with a GS-800 calculated imaging densitometer (Bio-Rad Laboratories, Graz, Austria). LDL particle size was calculated according to the Rf values of the standard forms.

Statistical analysis

Statistical analysis was performed using SPSS version 12.0 for Windows (Statistical Package for the Social Science, SPSS Inc, Chicago, IL). Sample size was checked using PS version 2.1 (power and sample size calculation, Nashville, Tenn). The Hardy-Weinberg Equilibrium was investigated using Executive SNP Analyzer 1.0 (http://www.istech.info/SilicoSNP/index.html). Genotype distributions and allele frequencies between healthy controls and MA (MS / IFG) or diabetic patients were compared by the chi square test (χ2 test). Odds ratio (OR) of the Chisquare test with complex factors associated with DM genotype; 95% confidence intervals (CIs)]. One-way ANOVA was performed and compared to compare the differences between each patient group (healthy control, metabolic abnormalities (MA) and DM) or between genotype groups within each patient group, adjusted or unadjusted. The Ferroni method was carried out. To investigate the correlation between fasting blood glucose and TG associated with APOA5 -1131T> C, Pearson correlation analysis and partial correlation test were performed. Each variable was examined for a normal distribution pattern and log-converted significantly tilted variables. For the above purposes, the mean value has been presented using unconverted and unadjusted values. Results were expressed as mean ± standard error or percentage and the two-tailed value of p <0.05 of p <0.05 was considered statistically significant.

Experiment result

Characteristics of the study subjects

Table 3 shows the general characteristics of 3,450 study subjects. The age and mean values of BMI, and postmenopausal rates of patients with MA (n = 1133) and DM (n = 304) were higher compared to healthy controls (N = 2,033). There was no significant difference in the rates of smoking and alcohol consumption between the three groups. Systolic blood pressure was higher in MA and DM patients than in healthy controls (p <0.001). Diastolic blood pressure and total cholesterol levels were higher in MA patients than in the other two groups (p <0.001). Fasting TG and ApoB were highest in MA women and lowest in healthy controls (p <0.001). HDL-cholesterol and ApoA1 levels were highest in healthy controls and lowest in MA women (p <0.001). ApoA5 levels were lower in the MA and DM patients than the healthy control (p <0.001) and LDL particle size was lower in the MA group. Fasting blood glucose levels were highest in DM patients and higher in MA group compared to healthy controls (p <0.001). This pattern was still valid after considering age, BMI and menopausal conditions. In addition, significant differences in LDL cholesterol levels between the groups disappeared after adjustment (p0 = 0.006, p1 = 0.072).

Population and metabolic indicators of the study population (n = 3,450 women). Healthy control
(n = 2,033) MA
(n = 1,113) DM
(n = 304) p ₀ p ₁ Age (years) 54.6 ± 0.3 59.7 ± 0.3 62.1 ± 0.5 <0.001 - Body mass index
(BMI, kg / m ² ) 23.4 ± 0.1 25.4 ± 0.1 25.1 ± 0.2 <0.001 - After menopause (%) 64.7 82.8 89.4 <0.05 - Current smoking (%) 2.4 1.8 2.0 n.s. - Current alcohol consumption (%) 31.9 24.2 16.2 n.s. - Systolic Blood Pressure (mmHg)
Diastolic Blood Pressure (mmHg) 120.8 ± 0.3 ^b
73.8 ± 0.2 ^b 133.0 ± 0.5 ^a
79.9 ± 0.3 ^a 132.1 ± 1.1 ^a
76.9 ± 0.6 ^b <0.001
<0.001 <0.001
<0.001 Triglycerides
(mg / dL) ^Φ 94.5 ± 0.8 ^c 170.7 ± 2.5 ^a 151.6 ± 5.9 ^b <0.001 <0.001 Total-cholesterol
(mg / dL) 194.3 ± 0.8 ^b 200.1 ± 1.1 ^a 194.9 ± 2.3 ^b <0.001 0.033 HDL-cholesterol
(mg / dL) 60.3 ± 0.3 ^a 47.1 ± 0.4 ^c 51.3 ± 0.7 ^b <0.001 <0.001 LDL-cholesterol
(mg / dL) 115.0 ± 0.7 118.7 ± 1.1 114.2 ± 2.2 0.006 0.072 Apolipoprotein A1
(mg / dL) 149.4 ± 0.7 ^a 135.6 ± 0.8 ^c 140.8 ± 1.4 ^b <0.001 <0.001 Apolipoprotein B
(mg / dL) 81.8 ± 0.5 ^c 94.3 ± 0.7 ^a 88.5 ± 1.4 ^b <0.001 <0.001 Apolipoprotein A5
(mg / dL) ^Φ 250.4 ± 7.0 ^a 213.8 ± 8.2 ^b 187.1 ± 6.6 ^b <0.001 <0.001 LDL particle size (nm) ^Φ 24.3 ± 0.03 ^a 23.9 ± 0.04 ^b 24.2 ± 0.09 ^a <0.001 <0.001 Blood sugar (mg / dL) ^Φ 83.6 ± 0.2 ^c 89.5 ± 0.4 ^b 127.1 ± 2.1 ^a <0.001 <0.001

Mean ± Standard Error.

MA: metabolic abnormalities such as metabolic syndrome or fasting blood glucose disorders, DM: diabetes, ns: no significant, P ₀ : uncorrected p-value, P ₁ : corrected p- for age, BMI and menopause value.

^Φ represents the indicators for which the corrected or uncorrected variables are log-converted, one-way ANOVA, and tested by Bonferroni's method.

Sharing the same alphapet in the same row indicates that there was no significant difference between the two groups after correction for age and body mass index.

APOA5 Distribution of -1131T> C polymorphism

Genotype distributions across the entire population, as well as healthy controls, MA and DM, were examined by Hardy-Weinberg equilibrium respectively. The minor allele frequency (MAF) of -1131T> C in the entire population was 0.29, consistent with the results observed previously in Koreans [2, 10]. The genotype distribution of -1131T> C polymorphism in the healthy control group was significantly different from that of the other two groups (MA: 0.319, DM: 0.327) (P <0.05).

Lipid profile, apolipoprotein and LDL particle size APOA5 Association with -1131T> C polymorphism

Age, BMI, systolic blood pressure and diastolic blood pressure common characteristics did not differ according to APOA5 -1131T> C of each genotype subjects (healthy controls, MA and DM) (Table 4). No significant differences were observed in each genotype group after postmenopausal, current smoking and alcoholism (no results).

Association between Lipid Profile, Apolipoprotein and LDL Particle Size and APOA5 -1131T> C Polymorphism in Korean Women (n = 3,450). TT TC CC Healthy control
TT (n = 1,096)
TC (n = 798)
CC (n = 139)


Age (years) 55.1 ± 0.4 54.2 ± 0.4 52.9 ± 1.1 Body mass index (kg / m ² ) 23.6 ± 0.1 23.3 ± 0.1 22.9 ± 0.2 Systolic Blood Pressure (mmHg) 121.7 ± 0.5 120.0 ± 0.6 117.8 ± 1.3 Diastolic Blood Pressure (mmHg) 74.3 ± 0.3 73.3 ± 0.4 72.0 ± 0.8 Total Cholesterol (mg / dL) 194.4 ± 1.1 194.5 ± 1.2 192.5 ± 3.2 LDL-cholesterol (mg / dL) 114.9 ± 1.0 114.9 ± 1.1 115.9 ± 2.8 Apo A1 (mg / dL) 150.9 ± 0.7 ^a 149.2 ± 1.1 ^a 140.6 ± 2.8 ^b Apo B (mg / dL) 81.1 ± 0.7 82.1 ± 0.8 85.3 ± 2.1 LDL particle size (nm) ^Φ 24.3 ± 0.04 ^a 24.3 ± 0.04 ^ab 24.1 ± 0.09 ^b MA
TT (n = 514)
TC (n = 489)
CC (n = 110) Age (years) 60.5 ± 0.5 58.9 ± 0.5 59.6 ± 1.1 Body mass index (kg / m ² ) 25.4 ± 0.1 25.3 ± 0.1 25.8 ± 0.3 Systolic Blood Pressure (mmHg) 133.0 ± 0.7 132.4 ± 0.7 135.1 ± 1.7 Diastolic Blood Pressure (mmHg) 79.9 ± 0.4 79.6 ± 0.5 81.2 ± 1.1 Total Cholesterol (mg / dL) 197.4 ± 1.7 ^b 204.3 ± 1.7 ^a 194.5 ± 3.7 ^b LDL-cholesterol (mg / dL) 118.6 ± 1.5 ^a 121.0 ± 1.6 ^a 109.6 ± 3.7 ^b Apo A1 (mg / dL) 135.2 ± 1.1 ^a 137.8 ± 1.2 ^a 128.3 ± 2.3 ^b Apo B (mg / dL) 92.2 ± 1.1 ^b 96.2 ± 1.1 ^a 95.6 ± 2.4 ^ab LDL particle size (nm) ^Φ 23.9 ± 0.06 23.9 ± 0.06 23.7 ± 0.15 DM
TT (n = 139)
TC (n = 131)
CC (n = 34) Age (years) 62.9 ± 0.7 61.7 ± 0.9 60.4 ± 1.8 Body mass index (kg / m ² ) 25.0 ± 0.3 25.3 ± 0.3 24.6 ± 0.4 Systolic Blood Pressure (mmHg) 132.8 ± 1.7 131.6 ± 1.6 131.2 ± 2.5 Diastolic Blood Pressure (mmHg) 76.9 ± 1.0 77.0 ± 0.9 76.3 ± 1.4 Total Cholesterol (mg / dL) 196.8 ± 3.3 192.8 ± 3.5 195.3 ± 6.8 LDL-cholesterol (mg / dL) 115.4 ± 3.2 113.9 ± 3.4 110.7 ± 6.2 Apo A1 (mg / dL) 143.1 ± 2.2 139.9 ± 2.0 134.6 ± 4.4 Apo B (mg / dL) 88.4 ± 2.1 87.6 ± 2.2 91.8 ± 4.5 LDL particle size (nm) ^Φ 24.3 ± 0.14 24.1 ± 0.14 24.1 ± 0.25

Mean ± Standard Error.

MA: metabolic abnormalities such as metabolic syndrome or fasting blood glucose disorders, DM: diabetes, BP: blood pressure, Apo: apolipoprotein

^Φ represents the indicators for which the corrected or uncorrected variables are log-converted, one-way ANOVA, and tested by Bonferroni's method.

Sharing the same alphapet in the same row indicates no significant difference between the two groups after adjustment for age and body mass index.

In healthy control and MA patients, C carriers, particularly CC homozygotes, had higher levels of TG than TT genotype (p0). This pattern was maintained even after adjusting for age, BMI, menopause, smoking and drinking (p1; FIG. 1). However, corrections for plasma ApoA5 or / and lipid drug intake have diminished significant differences (p2 and p3). On the other hand, CC homozygotes in DM patients consistently showed higher TG levels than TT or TG genotypes (p0, p1 and p3). CC homozygotes in the three subject groups had lower HDL-cholesterol levels than the TT or TC genotype before (p0) and after (p1) correction (FIG. 1). However, further corrections for plasma ApoA5 (p2) and / or lipid drug intoxication (p3) weakened significant differences. For plasma ApoA5 levels, the C carriers of the CC homozygotes of healthy controls and MA patients had lower levels than other genotypes before (p0) and after (p1) correction. However, in MA women, statistical significance disappeared after further correction of lipid drug intake. On the other hand, no significant gyration was observed in DM patients before (p0) and after (p1 and p4) (FIG. 1).

Table 4 also shows the association between total cholesterol, LDL cholesterol, ApoA1, ApoB and LDL particle sizes and genotypes in each subject group. Plasma levels of total cholesterol, LDL cholesterol and ApoB did not differ significantly by genotype in both healthy controls and DM patients. On the other hand, total cholesterol and ApoB in MA patients were significantly higher in TC genotype, and LDL cholesterol in MA patients was lower in CC genotype. In addition, ApoA1 levels in the healthy control and MA women were lower in the CC genotype than in the other genotypes, and in the healthy control, the LDL particle size was higher in the TT genotype than in the CC genotype. Fasting blood glucose, on the other hand, did not differ significantly between genotypes in all patient groups (TT: 83.7 ± 0.2, TC: 83.5 ± 0.3, CC: 83.6 ± 0.8 mg / dL for healthy controls; TT: for MA patients). 89.5 ± 0.6, TC: 89.8 ± 0.6, CC: 88.6 ± 1.1 mg / dL; TT: 129.0 3.0, TC: 125.7 3.2, CC: 124.6 7.5 mg / dL for DM patients). In addition, the proportion of medications, such as antihypertensives, lipid lowering agents or oral hypoglycemic agents, did not differ significantly by genotype in MA and DM patients (no results).

APOA5 Relative risk of diabetes mellitus according to

Carriers of minor C alleles were compared to TT homozygotes (reference group) (Table 5). C carriers showed a significantly higher risk of DM than the TT genotype [OR ₀ 1.39 (95% CI, 1.09-1.77), P = 0.008]. This phenomenon was still present after correction for age, BMI, menopause, smoking and drinking [OR ₁ 1.61 (95% CI, 1.23-2.10), P <0.001]. In particular, the CC genotype showed a much higher increased risk than the TT genotype [OR ₀ 1.93 (95% CI, 1.27-2.92), P = 0.002, OR ₁ 2.35 (95% CI, 1.46-3.77), P <0.001 ]. Similar patterns were observed for the risk of MA, but weaker than those for DM. After adjustment for additional metabolic syndrome, C carriers still had a significantly higher risk of DM [OR ₂ 1.98 (95% CI, 1.09-3.59), p = 0.024]. CC homozygotes also showed a high risk, but were transient (OR ₂ 2.51 (95% CI, 0.90-6.96), p = 0.078).

Odds ratio of diabetes according to APOA5-1131T> C genotype (OR). Unadjusted Cross Ratio
(OR ₀ ) Adjusted Cross Ratio ¹
(OR ₁ ) Adjusted crossover ratio (OR ₂ ) MA DM MA DM DM TT ¹ One One One One One C carrier
(TC + CC) OR
(95% CI ² ) 1.363
(1.177-1.578) 1.388
(1.090-1.768) 1.466
(1.248-1.721) 1.608
(1.233-2.098) 1.983
(1.094-3.593) p-value <0.001 0.008 <0.001 <0.001 0.024 CC OR
(95% CI ² ) 1.687
(1.287-2.213) 1.929
(1.274-2.929) 1.913
(1.423-2.573) 2.348
(1.463-3.769) 2.511
(0.903-6.598) p-value <0.001 0.002 <0.001 <0.001 0.078

¹ See, ² confidence intervals, MA: metabolic abnormalities such as metabolic syndrome or fasting blood glucose disorders, DM: diabetes.

The association between MA or DM and genotypes is determined by the odds ratio (OR) of the corrected or uncorrected chi-square test; 95% confidence intervals (CIs)].

OR ₀ : uncorrected crossover ratio, OR ₁ : adjusted crossover ratio for age, BMI, menopause, smoking and drinking, OR ₂ : corrected crossover ratio for age, BMI, menopause, smoking, drinking and metabolic syndrome.

For triglycerides APOA5 Association effect of -1131T> C and fasting blood glucose

Table 6 shows the correlation between fasting plasma glucose and TG and associated APOA5 -1131T> C genotype. Fasting blood glucose levels were positively associated with TG levels in the entire population (R0: r = 0.142, p <0.001) as well as DM patients (R0: r = 0.148, p = 0.010). These two variables were also positively associated with each genotype subgroup of the total population (R0). DM patients, on the other hand, have a positive association only with C carriers (R0: r = 0.165, p = 0.035), especially CC homozygotes (R0: r = 0.395, p = 0.021) and show a TT genotype (R0: r = 0.139). , p = 0.102). This pattern was still maintained after correction for age, BMI, menopause, smoking, drinking and lipid drug intake (R1). Each patient group was divided into two groups according to fasting blood glucose levels (median: healthy control group, 84 mg / dl; MA, 87 mg / dl; and DM, 122 mg / dl) (FIG. 2). Healthy control and MA women showed higher TG levels in CC homozygotes as well as C carriers than TT genotype despite fasting blood glucose levels before and after adjustment. On the other hand, DM patients did not show a significant association between TG levels and genotypes when fasting glucose levels were below 122 mg / dl, whereas CC patients showed very high TG levels when fasting glucose levels were ≥122 mg / dl. . This pattern was maintained even after correction.

Odds ratio of diabetes according to APOA5-1131T> C genotype (OR). According to APOA5 -1131T> C genotype gun TT C carrier (TC + CC) CC R0 R1 R0 R1 R0 R1 R0 R1 Total collective
(n = 3,450) r 0.142 0.130 0.144 0.105 0.139 0.096 0.183 0.150 p <0.001 0.002 <0.001 <0.001 <0.001 <0.001 0.002 0.013 DM
(n = 304) r 0.148 0.146 0.139 0.113 0.165 0.168 0.395 0.451 p 0.010 0.015 0.102 0.219 0.035 0.039 0.021 0.027

r : correlation coefficient, p : p-value, R0: uncorrected value, R1: corrected value for age, BMI, menopause, smoking and drinking.

Further discussion

The results of the present invention indicate that the APOA5-1131C allele may contribute to an increased risk of diabetes in Korean women; It is the first to suggest that the C carriers show a significantly increased risk of DM and that the risk is even higher in CC homozygotes. This phenomenon was effective even after correction for age, BMI, menopause, smoking, drinking and menopause status. After further adjustment for metabolic syndrome, C carriers still displayed a significantly higher risk of DM. This study is in line with the studies of Zhai et al. [13] and Yan et al. [14] in China, who reported higher DM risk (2-3.75 times) in C carriers, but the significance of these studies was significant. Association was weakened after correction of sex, HDL-cholesterol, TG, smoking, and the like. In addition, a 15-year continuous study of healthy men in the UK (Northwick Park Heart Study II) showed no impact of the APOA5 genotype (1131T> C or S19W) on the risk of developing type 2 diabetes [15]. ]. This discrepancy with the results of the present invention may be due to differences in patient characteristics and ethnicity. In this study, the patients were all Korean women and the diabetics did not have any cardiovascular disease, but other studies included both males and females [13, 14] or only males [15] and some had coronary artery disease. Patients were included [14]. In addition, differences in allele frequencies between populations may be considered. Decimal C allele frequencies in APOA5 -1131 SNP is It is well known than Westerners (9-16%) is higher in the East (28 to 30%) [2, 4-9]. In addition, minor allele frequencies may differ between groups even in the same Asian region; Although the prime C allele frequency of healthy subjects in this study was 0.265, the studies of Zhai et al. [13] and Yan et al. [14] were 0.296 and 0.277, slightly higher than ours, respectively.

APOA5-1131T > C is strongly associated with the risk of hypertriglyceridemia and increased CVD in various ethnic groups [2, 4, 10, 16]. Hypertriglyceridemia is also seen in DM and is commonly observed as a different risk factor for cardiovascular complications in type 2 diabetes [11, 12]. In this study, TG levels were highest in MA patients and higher in DM patients compared to healthy controls. In contrast, TG levels were higher in C-carriers, especially CC homozygotes, than in TT genotypes in three patient groups, and their significance was maintained even after correction for confounders such as age, BMI, smoking, drinking and menopause. It became. Further corrections to plasma ApoA5 levels and / or lipid drugs still retained their significance in DM patients but diminished in healthy control and MA women. ApoA5 plays an important role in the regulation of circulating TG by direct interaction with lipoprotein lipase (LPL) and hydrolysis of LPL-mediated plasma TG [17, 18]. Several studies have reported that ApoA5 levels are lower in CAD or DM patients than in healthy people [19-21]. According to Nowak et al., ApoA5 expression was down-regulated by insulin resistance and reduced by insulin infusion followed by plasma levels [22]. In addition, lower levels of ApoA5 are associated with the C allele of APOA5 -1131 [10], which moves opposite to TG levels. In this study, DM patients had lower levels of ApoA5 than healthy controls and had no particular association with genotypes, whereas C carriers in CC homozygotes of healthy controls and MA patients showed lower levels of ApoA5. In general, hyperinsulinemia and insulin resistance occurring in DM patients may be able to significantly down-regulate ApoA5 expression as masking the effects associated with the APOA5 -1131T> C genotype. However, fasting blood glucose levels did not vary by genotype in the three patient groups. Similar results were observed in Zhai et al. [13], in which the genotype association with the profile of insulin resistance in both healthy controls and type 2 diabetes was not apparent at the fasting level. Our previous studies on healthy control and CAD patients did not show significant genotype associations with fasting levels of blood glucose and insulin resistance calculated by homeostasis model assessment [10]. Chiu et al., On the other hand, reported interesting results that APOA5 V150M was not associated with fasting blood glucose levels, but was significantly associated with higher stage 1 and 2 insulin responses during hyperglycemic clamping [23]. These results were derived from different SNPs from the present invention, but the measurement of insulin during hyperglycemic clamp or glucose load test rather than postprandial levels of blood glucose or fasting state investigated the direct association between blood glucose or insulin response and APOA5 -1131T> C. To make it more relevant.

On the other hand, fasting blood glucose levels were positively correlated with TG levels, which were observed not only in the genotype of the allies, but also in the entire population. Interestingly, DM patients showed a positive association only with C carriers, not only with CC homozygotes, but with TT homozygotes. In addition, CC patients with higher fasting blood glucose (≧ 122 mg / dl) showed significantly higher TG levels. These results may mean that CC patients with hyperglycemia are more sensitive to hypertriglyceridemia, which may be more easily exposed to the risk of cardiovascular complications.

The research results of the present invention have various limitations. The patients studied are Korean women and may not apply the results of the present invention to ethnic specimens that may differ from the clinical and biochemical characteristics of the males or Korean population. Such patient-control studies are not designed to assess time sequential associations because exposures and outcomes are collected at one point in time. Postprandial glucose tolerance test or a hyperglycemic clamp test may be necessary to investigate the direct contribution of APOA5 -1131C allele in the regulation of blood sugar and insulin state. In addition, analysis of other SNPs of the APOA5 gene (eg, V150M, G185C) or other related genes (ie APOA1 / C3 / A4 ) needs to be considered to interpret the association with DM risk [1, 23]. ]. Despite these limitations, the new findings in this study indicate that the APOA5-1131C allele can independently contribute to the increased risk of DM in Korean women. In addition, the very high TG levels observed in CC homozygotes, especially in DM patients with higher fasting glucose levels, suggest that CC homozygotes of APOA5 -1131T> C with hyperglycemia may be more susceptible to cardiovascular complications. give.

References

[1] Pennacchio LA, Olivier M, Hubacek JA. Cohen JC, Cox DR, Fruchart JC, Krauss RM, Rubin EM. An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencing. Science , 294: 169-173 (2001).

[2] Jang Y, Kim JY, Kim OY, Lee JE, Cho H, Ordovas JM, Lee JH. The -1131T> C polymorphism in the apolipoprotein A5 gene is associated with postprandial hypertriacylglycerolemia; elevated small, dense LDL concentrations; and oxidative stress in nonobese Korean men. Am J Clin Nutr , 80: 832-840 (2004).

[3] Kim JY, Kim OY, Koh SJ, Jang Y, Yun SS, Ordovas JM, Lee JH. Comparison of Low-Fat Meal and High-Fat Meal on Postprandial Lipemic Response in Non-Obese Men according to the -1131T> C Polymorphism of the Apolipoprotein A5 (APOA5) Gene (Randomized Cross-Over Design). J Am Coll Nutr , 25: 340-347 (2006).

[4] Bi N, Yan SK, Li GP, Yin ZN, Chen BS. A single nucleotide polymorphism -1131T> C in the apolipoprotein A5 gene is associated with an increased risk of coronary artery disease and alters triglyceride metabolism in Chinese. Mol Genet Metab , 83: 280-286 (2004).

[5] Nabika T, Nasreen S, Kobayashi S, Masuda J. The genetic effect of the apoprotein AV gene on the serum triglyceride level in Japanese. Atherosclerosis , 165: 201-204 (2002).

[6] Endo K, Yanagi H, Araki J, Hirano C, Yamakawa-Kobayashi K, Tomura S. Association found between the promoter region polymorphism in the apolipoprotein AV gene and the serum triglyceride level in Japanese schoolchildren. Hum Genet , 111: 570-572 (2002).

[7] Pennacchio LA, Olivier M, Hubacek JA, Krauss RM, Rubin EM, Cohen JC. Two independent apolipoprotein A5 haplotypes influence human plasma triglyceride levels. Hum Mol Genet , 11: 3031-3038 (2002).

[8] Evans D, Buchwald A, Beil FU. The single nucleotide polymorphism -1131T> C in the apolipoprotein A5 (APOA5) gene is associated with elevated triglycerides in patients with hyperlipidemia. J Mol Med , 81: 645-654 (2003).

[9] Ribalta J, Figuera L, Fernandez-Ballart J, Vilella E, Castro Cabezas M, Masana L, Joven J. Newly identified apolipoprotein AV gene predisposes to high plasma triglycerides in familial combined hyperlipidemia. Clin Chem , 48: 1597-1600 (2002).

[10] Jang Y, Paik JK, Hyun YJ, Chae JS, Kim JY, Choi JR, Lee SH, Shin DJ, Ordovas JM, Lee JH. The apolipoprotein A5 -1131T> C promoter polymorphism in Koreans: Association with plasma APOA5 and serum triglyceride concentrations, LDL particle size and coronary artery disease. Clinica Chimica Acta , 402: 83-87 (2009).

[11] Lehto S, Ronnemaa T, Haffner SM, Pyorala K, Kallio V, Laakso M. Dyslipidemia and hyperglycemia predict coronary heart disease events in middle-aged patients with type 2 diabetes. Diabetes , 48: 1354-1359 (1997).

[12] Teno S, Uto Y, Nagashima H, Endoh Y, Iwamoto Y, Omori Y, Takizawa T. Association of postprandial hypertriglyceridemia and carotid intima-media thickness in patients with type 2 diabetes. Diabetes Care , 23: 1401-1406 (2000).

[13] Zhai GH, Wen P, Guo LF, Chen L. Association of apolipoprotein A5 gene -1131T / C polymorphism with lipid metabolism and insulin resistance in patients with type II diabetes mellitus. Yi Chuan. , 29: 541-546 (2007).

[14] Yan SK, Cheng XQ, Song YH, Xiao XH, Bi N, Chen BS. Apolipoprotein A5 gene polymorphism -1131T> C: association with plasma lipids and type 2 diabetes mellitus with coronary heart disease in Chinese. Clin Chem Lab Med , 43: 607-612 (2005).

[15] Talmud PJ, Cooper JA, Hattori H, Miller IP, Miller GJ, Humphries SE. The apolipoprotein AV genotype and plasma apolipoprotein AV and triglyceride levels: prospective risk of type 2 diabetes. Results from the Northwick Park Heart Study II. Diabetologia , 49: 2337-2340 (2006).

[16] Cardona F, Guardiola M, Queipo-OrtuMI, Murri M, Ribalta J, Tinahones FJ. The -1131T> C SNP of the APOA5 gene modulates response to fenofibrate treatment in patients with the metabolic syndrome: A postprandial study. Atherosclerosis , 2009, Epub print.

[17] Merkel M, Loeffler B, Kluger M, Fabig N, Geppert G, Pennacchio LA, Laatsch A, Heeren J. Apolipoprotein AV accelerates plasma hydrolysis of triglyceride-rich lipoproteins by interaction with proteoglycanbound lipoprotein lipase. J Biol Chem , 280: 21553-21560 (2005).

[18] Schaap FG, Rensen PC, Voshol PJ, Vrins C, van der Vliet HN, Chamuleau RA, Havekes LM, Groen AK, van Dijk KW. ApoAV reduces plasma triglycerides by inhibiting very low density lipoprotein-triglyceride (VLDL-TG) production and stimulating lipoprotein lipase-mediated VLDL-TG hydrolysis. J Biol Chem , 279: 27941-7947 (2004).

[19] Hirano T, Hayashi T, Adachi M, Taira T, Hattori H. Marked decrease of apolipoprotein AV in both diabetic and nondiabetic patients with end-stage renal disease. Metabolism , 56: 462-463 (2007).

[20] Pruneta-Deloche V, Ponsin G, Groisne L, Fruchart-Najib J, Lagarde M, Moulin P. Postprandial increase of plasma apo AV concentrations in Type 2 diabetic patients. Atherosclerosis , 181: 403-405 (2005).

[21] Hyun YJ, Jang Y, Chae JS, Kim JY, Paik JK, Kim SY, Yang JY, Ordovas JM, Ko YG, Lee JH. Association of apolipoprotein A5 concentration with serum insulin and triglyceride levels and coronary artery disease in Korean men. Atherosclerosis , 2009, Epub print.

[22] Nowak M, Helleboid-Chapman A, Jakel H, Martin G, Duran-Sandoval D, Staels B, Rubin EM, Pennacchio LA, Taskinen MR, Fruchart-Najib J, Fruchart JC. Insulinmediated downregulation of apolipoprotein A5 gene expression through the phosphatidylinositol 3-kinase pathway: role of upstream stimulatory factor. Mol Cell Biol , 25: 1537-1548 (2005).

[23] Chiu KC, Chiu YF, Boyadjian AA, Fernando S, Kwan C, Chuang LM. Impact of apolipoprotein A5 polymorphisms on insulin sensitivity and beta-cell function. Pancreas , 30: 328-332 (2005).

1 is APOA5 -1131T> is the result of a triglyceride according to the C polymorphism (polymorphism), measuring the blood plasma levels of HDL- cholesterol and apolipoprotein A5. The measured plasma levels of triglycerides, HDL-cholesterol and apolipoprotein A5 are shown as mean ± standard error. Φ represents the indicators for which adjusted or unadjusted variables are log-converted, one-way ANOVA, and tested by Bonferroni's method. Sharing the same alphapet in the same row indicates that there was no significant difference between the two groups after correction for age and body mass index. P0: uncorrected p-value, P1: age, body mass index (BMI), menopause, smoking, drinking and p-value corrected for ApoA5, P3: age, body mass index (BMI), menopause, smoking, drinking, P-value corrected for ApoA5 and lipid drug, P4: age, body mass index (BMI), p-value corrected for menopause, smoking, drinking and lipid drugs. Healthy control group (TT: n = 1096, TC: n = 798, CC: n = 139), MA (TT: n = 514, TC: n = 489, CC: n = 110), DM (TT: n = 139 , TC: n = 131, CC: n = 34). MA represents metabolic abnormalities such as metabolic syndrome or fasting blood glucose disorders, and DM represents diabetes mellitus.

FIG. 2 shows the synergistic effects of APOA5-1131T> C genotype and fasting blood glucose on plasma triglyceride ^Φ (mg / ml) in diabetes . The plasma levels of the measured plasma triglycerides are shown as mean ± standard error. Φ is log-converted and tested ( ^* p <0.05, ^** p <0.01, ^*** p <0.01); Were adjusted to age, body mass index (BMI), menopause, smoking and drinking and then tested compared to TT patients in each subject group († p <0.01, ‡ p <0.001); Age, body mass index (BMI), menopause, smoking, drinking, ApoA5 (healthy controls), and lipid drugs (MA and DM) were adjusted and then compared to TT patients in each subject group. Median fasting blood glucose levels were 84, 87 and 122 mg / dl, respectively, in healthy controls, MA and DM women. MA represents metabolic abnormalities such as metabolic syndrome or fasting blood glucose disorders, and DM represents diabetes mellitus.

<110> Yonsei University <120> Kits for Determining a Diabetes Mellitus and Uses Thereof <160> 1 <170> Kopatentin 1.71 <210> 1 <211> 52 <212> DNA <213> Homo sapiens <400> 1 tgagccccag gaactggagc gaaagtraga tttgccccat gaggaaaagc tg 52  

Claims (15)

A primer or probe that specifically binds to 10-100 consecutive nucleotide sequences of the C allele comprising the C nucleotide at position -1131 ( APOA5 -1131T> C) of the APOA5 gene promoter, SEQ ID NO: 1 Korean female diabetes diagnostic kit comprising the C allele is CC homozygotes (homozygote), adjusted to age, body mass index (BMI), menopause, smoking, drinking and metabolic syndrome (MS) Korean female diabetes diagnosis kit, characterized in that diagnosed as diabetes when the adjusted odds rate (calculated in the range of 1.4-7.0). delete delete delete delete delete delete delete delete delete The method of claim 1, wherein the MS has a waist circumference (female) of> 80 cm, ≥150 mg / dl of triglyceride (TG), <50 mg / dl of high-density lipoprotein (HDL) -cholesterol (female), Korean female diabetes diagnosis kit, characterized in that it comprises at least three or more components from the group consisting of blood pressure of ≥130 / ≥85 mmHg and fasting glucose of ≥ 100 mg / dl. The kit for diagnosing Korean female diabetes according to claim 1, wherein the kit further comprises analyzing serum lipid profiles, apolipoproteins A1, A5 and B, blood glucose or plasma LDL (low-density lipoprotein) particle sizes. delete delete delete

Images