KR101157135B1 - Method for Determination of mutant genotype of genes related to drug reaction of anticoagulant - Google Patents

Abstract

The present invention comprises the steps of amplifying a gene encoding CYP2C9 or VKORC1 from a genomic DNA isolated from a subject, or all of the genes simultaneously or separately; Performing pyro sequencing by attaching sequencing primers to amplify a site where a displacement exists in each of the amplified genes; And detecting a single nucleotide polymorphism from the results obtained by performing the pyro sequencing.

Description

Method for Determination of mutant genotype of genes related to drug reaction of anticoagulant

The present invention relates to a method for determining the mutated genotype of genes related to drug response of an anticoagulant such as warfarin, and more specifically, for each gene producing a protein of CYP2C9 and VKORC1 known as a target protein of warfarin involved in warfarin metabolism. The present invention relates to a method for diagnosing genotype by analyzing major monobasic polymorphisms related to the human body's drug response.

Warfarin or vitamin K antagonists are drugs that interfere with blood clotting to prevent or treat cardiac embolism, venous thrombosis, myocardial infarction, and the like. However, the drug has a very narrow safe area of treatment, so when the blood level of the patient is too low, blood coagulation does not occur well, which can cause side effects such as cerebral infarction, and on the contrary, it can cause fatal bleeding side effects when the overdose is administered. Nevertheless, warfarin is an anticoagulant that is widely used around the world because there is no effective drug to replace warfarin.

Since warfarin drug dosage varies greatly from person to person, the international standardized ratio (INR) is set around the world to continuously monitor the degree of coagulation. Since warfarin is a long-term drug, it is very important to determine the safe dose of warfarin according to the individual.The dose of warfarin is determined by trial-and-error method while increasing the dose of warfarin according to the INR value until the safe dose is determined. Done. However, recently, it has been found that the gene that plays an important role in the body's metabolism of warphyrin is CYP2C9 and the target protein of warfarin is VKORC1 in humans.If mutations occur in these genes, it is safe to change the safe dose and initial dose of warphyrin It has been repeatedly proven to help with medication.

Important mutations that determine warfarin dose include the CYP2C9 * 3 and VKORC1--1639G> A gene mutations. The U.S. Food and Drug Administration recognized the mutant gene as a validated drug response predictive biomarker for the treatment of warfarin in August 2007, and modified the label of the drug, and in vitro diagnostic genes for four or more of these mutant genes. The method has been approved for marketing by the US Food and Drug Administration. Mutations of these genes are frequently found in Koreans, and for the safe drug treatment of warfarin according to genotype, it is very necessary to develop an efficient method for the diagnosis of genetic variants.

The CYP2C9 gene is located on the 10th chromosome and is a major enzyme metabolizing warfarin. To date, CYP2C9 * 2 and CYP2C9 * 3 are known as the genetic polymorphisms of CYP2C9. (http://www.cypalleles.ki.se/cyp2c9.htm) Among Asians, including Koreans, CYP2C9 * 2 is not found, and only CYP2C9 * 3 is known.

The VKORC1 gene is located on the 16th chromosome and produces target proteins in the human body that act on warfarin or oral anticoagulant (vitamin K antagonist) drugs (Fregin et al. Blood 2002; 100: 3229-32) (Whitlon DS et al. Biochemistry 1978; 17: 1371-7.). Genetic analysis revealed four VKORC1 gene mutations in Koreans, VKORC1 -1639G> A, 1173C> T, 1181T> G, and 3730G> A, respectively. These mutations are completely unbalanced except for the 1181T> G variant, allowing analysis of the genotype of VKORC1 without analyzing all of the mutations. Among these, the genetic variation highlighted in relation to warfarin's drug response is VKORC1 -1639G> A (US Food and Drug Administration homepage), which is almost identical to that of -1639G> A even if 1173C> T and 3730G> A are analyzed according to the related imbalance. The same diagnostic results can be provided.

The present invention has been made to solve the problems of the prior art as described above, the object is to provide an efficient method for the diagnosis of mutated genes for the safe drug treatment of anticoagulant according to genotype.

The technical problem as described above is achieved by the following configuration according to the present invention.

(1) amplifying the gene encoding CYP2C9 or VKORC1 from the genomic DNA isolated from the subject, or all of the genes simultaneously or separately; Performing pyro sequencing by attaching sequencing primers to amplify a site where a displacement exists in each of the amplified genes; And detecting a single nucleotide polymorphism from the results obtained by performing the pyro sequencing.

(2) The mutation genotyping method according to item 1, wherein the variant genotype of CYP2C9 is CYP2C9 ^* 3, CYP2C9 ^* 13, or CYP2C9 ^* 14 gene.

(3) The mutation genotyping method according to item 1, wherein the mutation genotype of VKORC1 is at least one selected from the group of VKORC1-1639G> A, 1173C> T, 1181T> G, and 3730G> A.

(4) The genotype of CYP2C9, wherein the pyro sequencing is selected from the group of CYP2C9 ^* 3, CYP2C9 ^* 13, and CYP2C9 ^* 14; And VKORC1-1639G> A, 1173C> T, 1181T> G, and 3730G> A. A variant genotyping method for identifying two or more variant genotypes selected from the group of variant genotypes of VKORC1.

(5) The mutation genotyping method according to item 1, wherein pyro sequencing is performed to simultaneously identify CYP2C9 ^* 3, which is a variant genotype of CYP2C9, and VKORC1-1639G> A, which is a variant genotype of VKORC1.

(6) The mutation genotyping method according to item 1, wherein the sequencing primer for pyro sequencing of the CYP2C9 mutant gene consists of SEQ ID NO: 9.

(7) The mutant genotyping method according to item 1, wherein the sequencing primer for pyro sequencing of the VKORC1 mutant gene consists of SEQ ID NO: 10.

(8) The mutation genotyping method according to item 1, wherein the sequencing primer for pyro sequencing of the VKORC1 mutation gene consists of SEQ ID NO: 11.

(9) The mutant genotyping method according to claim 1, wherein the sequencing primer for pyro sequencing of the VKORC1 mutant gene consists of SEQ ID NO: 12.

(10) Amplification primers for amplifying a gene fragment comprising a CYP2C9 * 3 mutation gene, characterized in that the gene amplification method using a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2.

(11) Amplification primers for amplification of gene fragments comprising the VKORC1-1639G> A mutant gene, characterized in that the amplification method using a primer pair of SEQ ID NO: 3 and SEQ ID NO: 4.

(12) Amplification primers for amplifying gene fragments comprising VKORC1 1173C> T and 1181T> G mutation genes, wherein the primer pairs of SEQ ID NO: 5 and SEQ ID NO: 6 are used.

(13) Amplification primers for amplifying a gene fragment comprising a CYP2C9 * 13 mutation gene, characterized in that the gene pair using a primer pair of SEQ ID NO: 19 and SEQ ID NO: 20.

(14) Amplification primers for amplifying a gene fragment comprising a CYP2C9 * 14 mutant gene, characterized in that the use of primer pairs of SEQ ID NO: 21 and SEQ ID NO: 22.

(15) Amplification primers for amplifying gene fragments comprising the CYP2C9 * 13 and CYP2C9 * 14 mutation genes, characterized in that the gene pairs of SEQ ID NO: 25 and SEQ ID NO: 26 using a primer pair.

(16) The method of claim 1, wherein the sequencing primer for pyro sequencing of the CYP2C9 * 13 mutant gene consists of SEQ ID NO: 23 or SEQ ID NO: 27.

(17) The method of claim 1, wherein the sequencing primer for pyro sequencing of the CYP2C9 * 14 mutant gene consists of SEQ ID NO: 24.

According to the above configuration of the present invention, it is possible to provide an efficient method for diagnosing a variant gene for safe drug treatment of warfarin according to the genotype. In particular, multiple pyro sequencing of CYP2C9 * 3 and VKORC1-1639G> A genes, functional variants of CYP2C9 found in major Asians and Westerners, including Koreans, can simultaneously determine the genotypes of warfarin. It is very useful in selecting safe drug treatments.

The present invention includes amplifying a gene encoding CYP2C9 or VKORC1 from the genomic DNA isolated from a subject, or all of the above genes, respectively; Performing pyro sequencing by attaching sequencing primers to amplify a site where a displacement exists in each of the amplified genes; And detecting a single base polymorphism from the results obtained by performing the pyro sequencing.

Hereinafter, the content of the present invention will be described in more detail.

Biological samples that can be used in the analysis method of the CYP2C9 or VKORC1 mutant gene according to the present invention may be blood, skin, skin cells, mucosal cells and hair of a subject. Preferably blood.

The method for extracting DNA from the biological sample collected from the subject is not particularly limited, and techniques known in the art or commercially available extraction kits can be used. For example, the kit for DNA extraction is Qiagen, Inc. (California, USA) and Stratagene (California, USA).

PCR can be used to amplify the CYP2C9 and VKORC1 genes. PCR amplification is designed to design a primer that can selectively amplify only the CYP2C9 or VKORC1 gene, and performs PCR amplification using the primer.

As a result of analyzing the entire nucleotide sequence of the CYP2C9 and VKORC1 genes for the preparation of primers using an automatic sequence analyzer, three variants of CYP2C9 ^* 3, CYP2C9 * 13, and CYP2C9 * 14 were identified as mutations of CYP2C9 and VKORC1. Four variants of VKORC1 1173C> T, VKORC1-1639G> A, VKORC1 3730G> A and VKORC1 1181T> G were identified. Among the patients taking anticoagulants, primers for CYP2C9 ^* 3, VKORC1-1639G> A, VKORC1 1173C> T, VKORC1 3730G> A and CYP2C9 * 13 and CYP2C9 * 14 are known to affect dose Taking into account the entire nucleotide sequence for the production was determined as follows.

(1) Primer for PCR amplification of CYP2C9 ^* 3

Forward primer: Biotin-TGGATACCTTCATGATTCATA (SEQ ID NO: 1)

Reverse primer: ATCTGGAGAACACACACTGC (SEQ ID NO: 2)

(2) PCR amplification primers of VKORC1-1639G> A

Forward primer: ACAGCATCTGGAGAGGGAGGAG (SEQ ID NO: 3)

Reverse primer: Biotin-GCATTGCCCTGACACCTAGTGG (SEQ ID NO: 4)

(3) Primer for PCR amplification of VKORC1 1173C> T

Forward primer: TAGGGTCAGTGACATGGAATCC (SEQ ID NO: 5)

Reverse primer: Biotin-TGTTGGATTGATTGAGGATGCTG (SEQ ID NO: 6)

(4) Primer for PCR amplification of VKORC1 3730G> A

Forward primer: Biotin-AGCCTGATGTGGCTCAGTTT (SEQ ID NO: 7)

Reverse primer: CTGCTGGGAAGGGTGGTTAT (SEQ ID NO: 8)

(5) PCR amplification primers for CYP2C9 * 13

Forward primer: Biotin-GTAGAGACGTGGTATCACCTTG (SEQ ID NO: 19)

Reverse primer: CAGCCAGTGGGAAAATGC (SEQ ID NO: 20)

(6) PCR amplification primers for CYP2C9 * 14

Forward primer: TTACAGAGCTCCTCGGGCAGA (SEQ ID NO: 21)

Reverse primer: Biotin-GGTAATGGGAAAAACACTGCT (SEQ ID NO: 22)

(7) PCR amplification primers for CYP2C9 * 13 and CYP2C9 * 14

Forward primer: GTTTGCTGTTATCTCTGTCTA (SEQ ID NO: 25)

Reverse primer: Biotin-TAGTCCAGTAAGGTCAGTGATATG (SEQ ID NO: 26)

The SEQ ID NO: 25 and SEQ ID NO: 26 primers can be used as primers for amplifying CYP2C9 * 13 and CYP2C9 * 14 even in the multipyro sequencing of CYP2C9 * 3, CYP2C9 * 13 and CYP2C9 * 14.

(8) Multipyro sequencing of CYP2C9 * 3, CYP2C9 * 13 and CYP2C9 * 14

    Primer for PCR amplification of CYP2C9 * 3

Forward primer: TGGATACCTTCATGATTCATA (SEQ ID NO: 29)

Reverse primer: Biotin-ATCTGGAGAACACACACTGC (SEQ ID NO: 30)

Each primer for performing the PCR reaction may also include a DNA molecule selected from any one of the modified sequences subjected to the mutation based on this base sequence.

Variations based on base sequences consisting of these sequence numbers include partial deletions of base sequences, addition of excess bases or base sequences, substitution of bases or subsequences with other base sequences in base sequences, or sequences thereof It may include.

In addition, the DNA molecule for each primer may include a sequence to which a label that binds to the molecule and / or a site capable of binding to a solid phase carrier is introduced.

In the case of the modified sequence, it means a sequence in which some bases are deleted, inserted, added, and substituted within the range of maintaining hybridization ability on a single DNA molecule obtained by extending each primer.

The position of the mutation is not particularly limited as long as it does not interfere with hybridization, but preferably, the 3 ′ end portion that affects the elongation step is excluded or only a minimum of variation is allowed.

Markers that bind to the DNA molecule may include any of radioactive materials or non-radioactive materials. The radioactive material may be, for example, comprising a radioisotope in the phosphate ester moiety. Examples of the non-radioactive label may be fluorescent materials such as rhodamine, fluorosine and derivatives thereof. In addition, biotin, hapten, or the like may be introduced as an indirect marker.

The site capable of binding to a solids-phase carrier is used when the specific fragment of the nucleic acid is specifically bound to the solid carrier, for example, a sandwich hybridization reaction. The solid phase carrier is not particularly limited as long as it can more effectively perform selective detection of polymerase chain reaction products. Examples of these solid carriers include the introduction of streptoavidin, an antibody, and the like to capture binding sites introduced in the primer to solid carriers such as agarose beads, polyacryl beads, latex, microtiters, and polystyrene balls. There is this.

The site capable of binding to the label or solid carrier is preferably introduced at the 5 ′ end so as not to interfere with elongation during the polymerase chain reaction.

Although the specific arrangement is different from the DNA molecules consisting of the respective SEQ ID NOs, more specific examples of using a modified sequence, a label, a solid carrier, and the like in the nucleic acid fragments are disclosed in Japanese Patent Application Laid-Open No. 2001-0095120.

Reaction conditions of PCR amplification using each primer may vary depending on the gene to be amplified. The reaction conditions are not particularly limited, but may be preferably in accordance with the following conditions.

(1) PCR reaction condition of CYP2C9 ^* 3 gene

After reacting at 94 ° C. for 5 minutes, the reaction was repeated 35 times for 30 seconds at 94 ° C., 30 seconds at 62 ° C., and 30 seconds at 72 ° C. for 5 minutes at 72 ° C.

(2) PCR reaction conditions of VKORC1-1639G> A gene

After reacting at 94 ° C. for 5 minutes, the reaction was repeated 35 times at 94 ° C. for 30 seconds, at 64 ° C. for 30 seconds, and at 72 ° C. for 30 seconds, and at 72 ° C. for 5 minutes.

(3) PCR reaction conditions of VKORC1 1173C> T gene

After reacting at 94 ° C. for 5 minutes, the reaction was repeated 35 times for 30 seconds at 94 ° C., 30 seconds at 55 ° C., and 25 seconds at 72 ° C. for 5 minutes at 72 ° C.

(4) PCR reaction conditions of VKORC1 3730G> A gene

After reacting for 5 minutes at 94 ° C., the reaction was repeated 35 times for 30 seconds at 94 ° C., 30 seconds at 58 ° C., and 30 seconds at 72 ° C., followed by 5 minutes at 72 ° C.

(5) PCR reaction condition of CYP2C9 * 13 gene

After reacting at 94 ° C. for 5 minutes, the reaction was repeated 35 times for 30 seconds at 94 ° C., 30 seconds at 62 ° C., and 30 seconds at 72 ° C. for 5 minutes at 72 ° C.

(6) PCR reaction condition of CYP2C9 * 14 gene

After reacting at 94 ° C. for 5 minutes, the reaction was repeated 35 times for 30 seconds at 94 ° C., 30 seconds at 56 ° C., and 30 seconds at 72 ° C., followed by 5 minutes at 72 ° C.

(7) PCR reaction conditions of CYP2C9 * 13 and CYP2C9 * 14 genes

After reacting at 94 ° C. for 5 minutes, the reaction was repeated 35 times at 94 ° C. for 30 seconds, at 55 ° C. for 30 seconds, and at 72 ° C. for 30 seconds, and at 72 ° C. for 7 minutes.

The size of the PCR product obtained according to the reaction conditions is 486bp for CYP2C9 ^* 3, 501bp for VKORC1-1639G> A, 266bp for VKORC1 1173C> T, 468bp for VKORC1 3730G> A, 536bp for CYP2C9 * 13, 592bp for CYP2C9 * 14 and 554bp for simultaneous PCR of CYP2C9 * 13 and CYP2C9 * 14.

The pyrosequencer is used in the present invention to diagnose the mutated gene using the amplified PCR products as templates. The pyrosequencer converts free pyrophosphate (PPi) into ATP in the presence of sulfulylase during the DNA polymerization process, and the ATP activates the luciferase to emit a luminescence reaction. is a device that analyzes the sequence by measuring with a couple device camera and the measured reactivity is indicated by a peak. Since the height of each peak displayed is proportional to the number of bases added, the homozygote appears twice as high as the peak of the heterozygote.

The sequencing method using the pyro sequencer includes a mono pyro sequencing method performed on each sample to detect single nucleotide polymorphism (SNP) and a multiplex pyro sequencing method that can identify two or more genes together. An example of a multiplex pyro sequencing method may be performed by selecting at least two or more of four mutant genes known to affect the dose of anticoagulant. More specifically, when performing multi-pyro sequencing that can identify two genes as an example of multiplex pyro sequencing, CYP2C9 ^* 3 and VKORC1-1639G> A, CYP2C9 ^* 3 and VKORC1 1173C> T, CYP2C9 ^* 3 and VKORC1 3730G> A, VKORC1-1639G> A and VKORC1 1173C> T, VKORC1-1639G> A and VKORC1 3730G> A, VKORC1 1173C> T and VKORC1 3730G> A, CYP2C9 * 13 and CYP2C9 * 14, CYP2C9 * 3 In addition, CYP2C9 * 13 and CYP2C9 * 14 can be diagnosed quickly and accurately. Among these, CYP2C9 ^* 3 and VKORC1-1639G> A are found in major Asians and Westerners, including Koreans, and pyro sequencing of these genes is more desirable for safe dose estimation of warfarin.

Primers for performing pyro sequencing can be determined as follows with reference to the sequence of each amplified gene. However, the following sequencing primers represent mono and multiplex sequencing primers, respectively.

(1) Primer for monopyro sequencing of CYP2C9 ^* 3

TGGTGGGGAGAAGGTC (SEQ ID NO: 9)

(2) Primer for monopyro sequencing of VKORC1-1639G> A

CTGAAAAACAACCATTGGCC (SEQ ID NO: 10)

(3) Primer for monopyro sequencing of VKORC1 1173C> T

CCAGGAGATCATCGAC (SEQ ID NO: 11)

(4) Primer for monopyro sequencing of VKORC1 3730G> A

ATTTGGTCCATTGTCAT (SEQ ID NO: 12)

(5) When performing VKORC1 1173C> T and VKORC1 3730G> A multi-fi

    Primers for Multipyro Sequencing of VKORC1 1173C> T

       CCAGGAGATCATCGAC (SEQ ID NO: 13)

(6) Performing VKORC1 1173C> T and VKORC1 3730G> A multi-fi

    Primer for Multipyro Sequencing of VKORC1 3730G> A

       ATTTGGTCCATTGTCAT (SEQ ID NO: 14)

(7) Performing VKORC1 -1639G> A and VKORC1 1173C> T multi-fi

    Primer for Multipyro Sequencing of VKORC1-1639G> A

       CTGAAAAACAACCATTGGCC (SEQ ID NO: 15)

(8) When performing VKORC1 -1639G> A and VKORC1 1173C> T multi-fi

    Primer for Multipyro Sequencing of VKORC1 1173C> T

       CCAGGAGATCATCGAC (SEQ ID NO: 16)

(9) Performing with VKORC1 -1639G> A and CYP2C9 * 3 multi-fi

    Primer for Multipyro Sequencing of VKORC1-1639G> A

       TGAAAAACAACCATTGGC (SEQ ID NO: 17)

(10) Performing with VKORC1 -1639G> A and CYP2C9 * 3 Multi-Fi

    Primers for Multipyro Sequencing of CYP2C9 * 3

       TGGTGGGGAGAAGGTCAA (SEQ ID NO: 18)

(11) Primer for Monopyro Sequencing of CYP2C9 ^* 13

CAGAAAACTCCTCTCCA (SEQ ID NO: 23)

(11) Primer for Monopyro Sequencing of CYP2C9 ^* 14

ATGGAAGGAGATCCG (SEQ ID NO: 24)

(12) Sequencing with CYP2C9 ^* 13 and CYP2C9 * 14 with MultiFire

     Primers for Multipyro Sequencing of CYP2C9 * 13

GAAGGAAGCCCTGATTGATC (SEQ ID NO: 27)

(13) Sequencing with CYP2C9 ^* 13 and CYP2C9 * 14 with MultiFire

     Primers for Multipyro Sequencing of CYP2C9 * 14

ATGGAAGGAGATCCG (SEQ ID NO 28)

(14) Sequencing with CYP2C9 * 3, CYP2C9 ^* 13, and CYP2C9 * 14 with MultiPi

     Primers for Multipyro Sequencing of CYP2C9 * 3

TGCACGAGGTCCAGAGAT (SEQ ID NO: 33)

(15) Sequencing with CYP2C9 * 3, CYP2C9 ^* 13, and CYP2C9 * 14 with MultiFire

     Primers for Multipyro Sequencing of CYP2C9 * 13

GAAGGAAGCCCTGATTGATC (SEQ ID NO 34)

(16) Sequencing with CYP2C9 * 3, CYP2C9 ^* 13, and CYP2C9 * 14 with MultiFire

     Primers for Multipyro Sequencing of CYP2C9 * 14

ATGGAAGGAGATCCG (SEQ ID NO 35)

In the monopyro sequencing analysis according to the present invention, the sequencing primers consist of SEQ ID NOs: 9-12, 23, and 24, and in the multi-pyro analysis, the sequencing primers are SEQ ID NOs: 13-18, 27, 28, and It consists of 33-35. The mutation may be selected from any one of the modifications based on the nucleotide sequence.

A sequence in which a mutation based on the base sequence consisting of these sequence numbers is a partial deletion of a base sequence, addition of an excess base or base sequence, substitution of a base or subsequence in another base sequence with another base sequence, or a combination thereof It includes.

In the case of the modified sequence, it means a sequence in which some bases are deleted, inserted, added, and substituted within the range of maintaining hybridization ability on a single DNA molecule obtained by extending each primer.

The position of the mutation is not particularly limited as long as it does not interfere with hybridization, but preferably, the 3 ′ end portion that affects the elongation step is excluded or only a minimum of variation is allowed.

Detection method according to the present invention using the pyro sequencing primer for four mutation genes known to affect the dose of anticoagulant CYP2C9 ^* 3, VKORC1- 1639G> A, VKORC1 1173C> T, VKORC1 3730G> A It allows for quick and accurate diagnosis. It also enables the diagnosis of CYP2C9 * 13 and CYP2C9 * 14 where anticoagulant doses are expected. According to the present invention, mono pyro sequencing may be performed in the diagnosis of the six mutant genes, but it is time and economical to determine at least two or more mutation genes among the four genotypes simultaneously through multiple pyro sequencing analysis. It is more preferable at the side.

Hereinafter, the content of the present invention will be described in more detail with reference to Examples. However, the following examples are only presented to aid the understanding of the present invention, but the scope of the present invention is not limited thereto.

Example 1 Amplification of the CYP2C9 and VKORC1 Genes

After separating blood from Korean subjects, DNA was isolated using a genomic DNA separation kit from Qiagen.

As a result of analyzing the entire sequence of CYP2C9 gene and VKORC1 gene using an automatic sequence analyzer, four variants of CYP2C9 ^* 3, VKORC1 1173C> T, VKORC1-1639G> A, VKORC1 3730G> A, and VKORC1 1181T> G were identified. It became. PCR was performed by dividing each gene into four fragments. Primer pairs used for each PCR were as shown in Table 1, wherein the reaction conditions for the PCR fragments are shown in Table 2 below.

TABLE 1

PCR products Primer name Primer sequence (5 '→ 3') CYP2C9 * 3 * 3_F2  TGGATACCTTCATGATTCATA * 3_R2  ATCTGGAGAACACACACTGC VKORC1-1639 -1639_F  ACAGCATCTGGAGAGGGAGGAG -1639_R  GCATTGCCCTGACACCTAGTGG VKORC1 1173 1173_F2  TAGGGTCAGTGACATGGAATCC 1173_R2  TGTTGGATTGATTGAGGATGCTG VKORC1 3730 3730_F  AGCCTGATGTGGCTCAGTTT 3730_R  CTGCTGGGAAGGGTGGTTAT

TABLE 2

PCR products Reaction condition CYP2C9 ^* 3 94 ℃ 5 minutes, (94 ℃ 30 seconds, 62 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 5 minutes VKORC1-1639 94 ℃ 5 minutes, (94 ℃ 30 seconds, 64 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 5 minutes VKORC1 1173 94 ° C 5 minutes, (94 ° C 30 seconds, 55 ° C 30 seconds, 72 ° C 25 seconds) 35 times, 72 ° C 5 minutes VKORC1 3730 94 ℃ 5 minutes, (94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 5 minutes

The location of each primer in the PCR reaction and the size of the PCR product are shown in Table 3 below. The location of the nucleotides is described according to the nomenclature of the cytochrome P450 (CYP) Allele Nomenclature Committee).

TABLE 3

PCR products Primer name location Size (bp) CYP2C9 * 3 * 3_F2 42408 ~ 42429 486 * 3_R2 42873 ~ 42893 VKORC1-1639 -1639_F -1783-1762 501 -1639_R -1304 ~ -1283 VKORC1 1173 1173_F2 1111-1132 266 1173_R2 1354-1376 VKORC1 3730 3730_F 3534 ~ 3553 468 3730_R 3981-4000

※ VKORC1 reference sequencer AY587020 (ATG of translation initiation codon ATG is +1)

<Example 2>

PCR products obtained in Example 1 were confirmed by an automatic base sequence analyzer. Each primer used at this time is shown in Table 4.

TABLE 4

PCR products Sequencing primers CYP2C9 ^* 3 * 3_F2 VKORC1-1639 -1639_F VKORC1 1173 1173_R2 VKORC1 3730 3730_F

The results of the four single nucleotide polymorphisms revealed by analyzing the autobase sequences are shown in Table 5 below.

TABLE 5

SNP n Allele location effect Allele
frequency(%) CYP2C9 267 ^* 3 Exxon7 I359L 4.87 VKORC1-1639G> A 267 Promoter 93.83 VKORC1 1173C> T 267 Intron 93.83 VKORC1 1181T> G 267 Intron 0.75 VKORC1 3730G> A 267 3'UTR 6.18

Example 3 High Speed Testing of Mutant Genes Using Pyro Sequencing

After separating blood from Korean subjects, DNA was isolated using Qiagen's genomic DNA separation kit. Analysis of the entire sequence of the CYP2C9 gene and VKORC1 using an autobase sequencer identified four functional mutations known to affect doses in patients taking anticoagulants such as warfarin, respectively. -1639G> A, VKORC1 1173C> T, VKORC1 3730G> A.

In order to identify the four monobasic polymorphisms, a mono pyrosequencing method for searching each gene and a multi-pyro sequencing analysis, which is a multiple mutation method for identifying two genes together, were performed. In this case, PCR primer pairs for gene amplification using the mono pyro sequencing method are shown in Table 6 below.

<Table 6>

PCR products Primer name Primer sequence (5 '→ 3') Size (bp) CYP2C9 * 3 * 3_PBF2 *  Biotin-TGGATACCTTCATGATTCATA 486 * 3_PR2  ATCTGGAGAACACACACTGC VKORC1-1639 -1639_PF  ACAGCATCTGGAGAGGGAGGAG 501 -1639_PBR *  Biotin-GCATTGCCCTGACACCTAGTGG VKORC1 1173 1173_PF2  TAGGGTCAGTGACATGGAATCC 266 1173_PBR2 *  Biotin-TGTTGGATTGATTGAGGATGCTG VKORC1 3730 3730_PBF *  Biotin-AGCCTGATGTGGCTCAGTTT 468 3730_PR  CTGCTGGGAAGGGTGGTTAT

^* Biotin is attached to the 5 'end

In addition, PCR primer pairs for gene amplification for using the multi-pyro sequencing method are shown in Tables 7-1 to 3 below.

TABLE 7-1

Primer name Primer sequence (5 '→ 3') Size (bp) Mu_1173 PF2 TAGGGTCAGTGACATGGAATCC 266 Mu_1173 PBR2 ^* Biotin-TGTTGGATTGATTGAGGATGCTG Mu_3730 PBF ^* Biotin-AGCCTGATGTGGCTCAGTTT 468 Mu_3730 PR CTGCTGGGAAGGGTGGTTAT

^* Biotin is attached to the 5 'end

TABLE 7-2

Primer name Primer sequence (5 '→ 3') Size (bp) Mu-1639_PF ACAGCATCTGGAGAGGGAGGAG 501 Mu-1639 _PBR ^* Biotin-GCATTGCCCTGACACCTAGTGG Mu_1173 PF2 TAGGGTCAGTGACATGGAATCC 266 Mu_1173 PBR2 ^* Biotin-TGTTGGATTGATTGAGGATGCTG

^* Biotin is attached to the 5 'end

TABLE 7-3

Primer name Primer sequence (5 '→ 3') Size (bp) Mu-1639_PF ACAGCATCTGGAGAGGGAGGAG 501 Mu-1639 _PBR ^* Biotin-GCATTGCCCTGACACCTAGTGG Mu_CYP2C9 ^* 3 PBF2 ^* Biotin-TGGATACCTTCATGATTCATA 486 Mu_CYP2C9 ^* 3 PR2 ATCTGGAGAACACACACTGC

^* Biotin is attached to the 5 'end

The reaction conditions used for each PCR are shown in Table 8.

<Table 8>

PCR products Reaction condition CYP2C9 ^* 3 94 ℃ 5 minutes, (94 ℃ 30 seconds, 62 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 5 minutes VKORC1-1639 94 ℃ 5 minutes, (94 ℃ 30 seconds, 64 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 5 minutes VKORC1 1173 94 ° C 5 minutes, (94 ° C 30 seconds, 55 ° C 30 seconds, 72 ° C 25 seconds) 35 times, 72 ° C 5 minutes VKORC1 3730 94 ℃ 5 minutes, (94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 5 minutes

Using each amplified PCR product as a template, pyro sequencing was performed using sequencing primers. At this time, the sequencing primers used in the mono and multi reactions are shown in Table 9 and Tables 10-1 to 3, respectively.

<Table 9>

Primer name Primer sequence (5 '→ 3') S-2C9 ^* 3_seq.R TGGTGGGGAGAAGGTC S-1639_seq.F CTGAAAAACAACCATTGGCC S-1173_seq.F CCAGGAGATCATCGAC S-3730_seq.R ATTTGGTCCATTGTCAT

TABLE 10-1

Primer name Primer sequence (5 '→ 3') Mu1-1173_seq.F CCAGGAGATCATCGAC Mu1-3730_seq.R ATTTGGTCCATTGTCAT

TABLE 10-2

Primer name Primer sequence (5 '→ 3') Mu2-1639_seq.F CTGAAAAACAACCATTGGCC Mu2-1173_seq.F CCAGGAGATCATCGAC

TABLE 10-3

Primer name Primer sequence (5 '→ 3') Mu3-1639_seq.F TGAAAAACAACCATTGGC Mu3-2C9 ^* 3_seq.R TGGTGGGGAGAAGGTCAA

Experimental results obtained according to the mono pyro sequencing method and the multi pyro sequencing method according to the embodiment of the present invention are shown in FIGS. 1 to 16, respectively.

1 and 2 are pyrograms obtained by mono pyro sequencing using the S-1173_seq.F sequencing primer according to an embodiment of the present invention, and it was confirmed that the VKORC1 1181T> G type could be determined by this process as well. . The results shown in FIG. 1 confirm the genotypes of the VKORC1 1173CT and VKORC1 1181TT types, while the results shown in FIG. 2 confirm the genotypes of the VKORC1 1173TT and VKORC1 1181TT types.

3 is a pyrogram obtained as a result of mono pyro sequencing using S-3730_seq.R sequencing primer according to an embodiment of the present invention, and the genotype of the subject can be diagnosed as a genotype of VKORC1 3730GG type.

4 is a pyrogram of another subject sample obtained as a result of mono pyro sequencing using S-3730_seq.R sequencing primer according to an embodiment of the present invention, where the genotype of the subject can be diagnosed as genotype of VKORC1 3730GA type.

5 is a pyrogram obtained as a result of mono pyro sequencing using S-1639_seq.F sequencing primer according to an embodiment of the present invention, and the genotype of the subject can be diagnosed as genotype of VKORC1-1639GA type.

6 is a pyrogram of another subject sample obtained by mono pyro sequencing using the S-1639_seq.F sequencing primer according to an embodiment of the present invention, and the genotype of the subject may be diagnosed as a genotype of VKORC1-1639AA type. .

7 is a pyrogram obtained by mono pyro sequencing using S-2C9 ^* 3_seq.R sequencing primer according to an embodiment of the present invention, and the genotype of the subject can be diagnosed as genotype of CYP2C9 ^* 1 / ^* 1 type. have.

8 is a pyrogram of another subject sample obtained as a result of mono pyro sequencing using S-2C9 ^* 3_seq.R sequencing primer according to an embodiment of the present invention, wherein the genotype of the subject is CYP2C9 ^* 1 / ^* 3 genotype Can be diagnosed.

9 is a pyrogram of another subject sample obtained as a result of mono pyro sequencing using the S-2C9 ^* 3_seq.R sequencing primer according to an embodiment of the present invention, wherein the genotype of the subject is CYP2C9 ^* 3 / ^* 3 type. The genotype can be diagnosed.

FIG. 10 is a pyrogram obtained as a result of multi-pyro sequencing using the sequencing primers shown in Table 10-1 according to an embodiment of the present invention. The subject's genotype may be diagnosed as genotypes of VKORC1 1173CT and VKORC1 3730GA types.

11 is a pygram of another subject sample obtained by multi-pyro sequencing using the sequencing primers shown in Table 10-1 according to an embodiment of the present invention, wherein the genotype of the subject is a genotype of VKORC1 1173TT and VKORC1 3730AA types. can do.

FIG. 12 is a pyrogram obtained as a result of multi-pyro sequencing using the sequencing primers shown in Table 10-2 according to the embodiment of the present invention, and the genotype of the subject may be diagnosed as the genotypes of the VKORC1-1639GA and VKORC1 1173CT types. .

FIG. 13 is a pygram of another subject sample obtained by multi-pyro sequencing using the sequencing primers shown in Table 10-2 according to an embodiment of the present invention, wherein the genotype of the subject is genotype of VKORC1-1639AA and VKORC1 1173TT types. Diagnosis can be made.

Figure 14 is a gram Pyro sequencing results obtained with a multi-pie using the sequencing primers set forth in Table 10-3, according to an embodiment of the invention, that the genotype of the subject is -1639AA VKORC1 and CYP2C9 ^* 1 / ^* 3 genotype type of Diagnosis can be made.

FIG. 15 is a pygram of another subject sample obtained by multi-pyro sequencing using the sequencing primers shown in Table 10-3 according to an embodiment of the present invention. Genotypes of the subjects were VKORC1-1639GA and CYP2C9 ^* 1 / ^* 1 It can be diagnosed that the genotype of the type.

16 is a pygram of another subject sample obtained by multi-pyro sequencing using the sequencing primers shown in Table 10-3 according to an embodiment of the present invention, genotypes of the subjects were VKORC1--1639AA and CYP2C9 ^* 3 / ^*. 3 types of genotype can be diagnosed.

As described above, according to the diagnostic method of the present invention, it can be confirmed that genotypes for four mutant genes known to affect dose in patients taking anticoagulants can be easily diagnosed.

Example 4 Amplification of CYP2C9 ^* 13 and CYP2C9 ^* 14 Genes

PCR was performed by dividing the CYP2C9 ^* 13 and CYP2C9 ^* 14 genes into four fragments. Primer pairs used for each PCR were as shown in Table 11 below, the location of each primer and the size of the PCR product is shown in Table 12 below.

<Table 11>

PCR products Primer sequence (5 '→ 3') Size (bp) Tm
CYP2C9 * 13 SEQ ID NO: 19:
BiotinGTAGAGACGTGGTATCACCTTG $
536
62 SEQ ID NO: 20
CAGCCAGTGGGAAAATGC
CYP2C9 * 14 SEQ ID NO: 21
TTACAGAGCTCCTCGGGCAGA
592
56 SEQ ID NO: 22
Biotin GGTAATGGGAAAAACACTGCT $

^$ Pharmacogenetics and Genomics 2006, 16: 497-514

<Table 12>

PCR products Primer name location size CYP2C9 * 13 * 13_PFB2 2781 ~ 2802 536 * 13_PR2 3300 ~ 3317 CYP2C9 * 14 * 14_PFB2 3401 ~ 3422 592 * 14_PR2 3947 ~ 3994

Reaction conditions for each PCR are shown in Table 13 below.

TABLE 13

PCR products Reaction condition CYP2C9 ^* 13 94 ℃ 5 minutes, (94 ℃ 30 seconds, 62 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 5 minutes CYP2C9 ^* 14 94 ℃ 5 minutes, (94 ℃ 30 seconds, 56 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 5 minutes

Results of automatic sequencing analysis The results of the single nucleotide polymorphism are shown in Table 14 below.

TABLE 14

SNP n Allele location effect Allele
frequency(%) CYP2C9 267 ^* 13 Exxon 2 L90P 0.19 CYP2C9 267 ^* 14 Exxon 3 R125H 0.19

Using each amplified PCR product as a template, pyro sequencing was performed using sequencing primers. The single sequencing primer used at this time is shown in Table 15, the results are shown in Figures 17-20.

TABLE 15

Primer name Primer sequence (5 '→ 3') S-2C9 ^* 13_seq.R SEQ ID NO: 23 CAGAAAACTCCTCTCCA S-2C9 ^* 14_seq.F SEQ ID NO: 24 ATGGAAGGAGATCCG

Example 5 Multi-Pyro Sequencing of CYP2C9 ^* 13 and CYP2C9 ^* 14 Genes

PCR was performed by dividing the CYP2C9 ^* 13 and CYP2C9 ^* 14 genes into the following fragments. Primer pairs used for each PCR were as shown in Table 16, and the position of each primer and the size of the PCR product are shown in Table 17 below.

TABLE 16

PCR products Primer sequence (5 '→ 3') size
(bp) Tm
CYP2C9 * 13, * 14 SEQ ID NO: 25
GTTTGCTGTTATCTCTGTCTA
554
55 SEQ ID NO: 26
Biotin TAGTCCAGTAAGGTCAGTGATATG

TABLE 17

PCR products Primer name location size CYP2C9 * 13, * 14 Muti_f 3145 ~ 3166 554 Muti-br 3675 ~ 3699

Reaction conditions for each PCR are shown in Table 18 below.

TABLE 18

PCR products Reaction condition CYP2C9 ^* 13, ^* 14 94 ℃ 5 minutes, (94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 30 seconds) 35 times, 72 ℃ 7 minutes

Results of automatic sequencing analysis The results of single nucleotide polymorphism are shown in Table 19 below.

TABLE 19

SNP n Allele location effect Allele
frequency(%) CYP2C9 267 ^* 13 Exxon 2 L90P 0.19 CYP2C9 267 ^* 14 Exxon 3 R125H 0.19

Using each amplified PCR product as a template, pyro sequencing was performed using sequencing primers. The multi sequencing primer used at this time is shown in Table 20, the results are shown in Figure 21 ~ 23.

TABLE 20

Primer name Primer sequence (5 '→ 3') S-2C9 ^* 13_seq.F SEQ ID NO: 27 GAAGGAAGCCCTGATTGATC S-2C9 ^* 14_seq.F SEQ ID NO: 28: ATGGAAGGAGATCCG

Example 6 Triplex PyroSequencing of CYP2C9 ^* 3, CYP2C9 ^* 13 and CYP2C9 ^* 14 Genes

PCR was performed by dividing the CYP2C9 ^* 3, CYP2C9 ^* 13 and CYP2C9 ^* 14 genes into the following fragments. Primer pairs used for each PCR were as shown in Table 21 below.

TABLE 21

PCR products Primer sequence (5 '→ 3') size
(bp) Tm
CYP2C9 * 3 SEQ ID NO: 29
TGGATACCTTCATGATTCATA
486
62 SEQ ID NO: 30
Biotin ATCTGGAGAACACACACTGC
CYP2C9 * 13, * 14 SEQ ID NO: 31
GTTTGCTGTTATCTCTGTCTA
554
55 SEQ ID NO: 32
Biotin TAGTCCAGTAAGGTCAGTGATATG

Using each amplified PCR product as a template, triplex pyro sequencing was performed using sequencing primers. The sequencing primer used at this time is shown in Table 22, the results are shown in Figures 24-28.

TABLE 22

Primer name Primer sequence (5 '→ 3') S-2C9 ^* 3_seq.F SEQ ID NO: 33 TGCACGAGGTCCAGAGAT S-2C9 ^* 13_seq.F SEQ ID NO: 34 GAAGGAAGCCCTGATTGATC S-2C9 ^* 14_seq.F SEQ ID NO: 35 ATGGAAGGAGATCCG

Each primer pair used in the triplex pyro sequencing is the position of the primer pair used in the determination of a single pyrosequencing, PCR conditions are the same, but the biotin position of the forward and reverse of each primer is different.

As described above, it has been described with reference to a preferred embodiment of the present invention, but those skilled in the art various modifications and changes of the present invention without departing from the spirit and scope of the invention described in the claims below I can understand that you can.

1 is a first experimental result of mono pyro sequencing performed to determine whether VKORC1 1173C> T, a variant gene of VKORC1, using a pyro sequencer.

2 is a second experimental result of mono pyro sequencing performed to determine whether VKORC1 1173C> T, which is a variant gene of VKORC1, using a pyro sequencer.

3 is a first experimental result of mono pyro sequencing performed to determine whether VKORC1 3730G> A, a variant gene of VKORC1, using a pyro sequencer.

4 is a second experimental result of mono pyro sequencing performed to determine whether VKORC1 3730G> A, a variant gene of VKORC1, using a pyro sequencer.

5 is a first experimental result of mono pyro sequencing performed to determine whether VKORC1-1639G> A, a variant gene of VKORC1, using a pyro sequencer.

6 is a second experimental result of mono pyro sequencing performed to determine whether VKORC1-1639G> A, a variant gene of VKORC1, using a pyro sequencer.

7 is a first experimental result of mono pyro sequencing performed to determine whether CYP2C9 ^* 3 is a variant gene of CYP2C9 using a pyro sequencer.

8 is a second experimental result of mono pyro sequencing performed to determine whether CYP2C9 ^* 3, which is a mutation gene of CYP2C9, using a pyro sequencer.

FIG. 9 is a third experimental result of mono pyro sequencing performed to determine whether CYP2C9 ^* 3 is a variant gene of CYP2C9 using a pyro sequencer. FIG.

10 is a first experimental result of multi-pyro sequencing performed to determine whether the VKORC1 mutant genes VKORC1 1173C> T and VKORC1 3730G> A using a pyro sequencer.

FIG. 11 is a second experimental result of multi-pyro sequencing performed to determine whether VKORC1 1173C> T and VKORC1 3730G> A, which are VKORC1 mutation genes, using a pyro sequencer.

FIG. 12 is a first experimental result of multi-pyro sequencing performed to determine whether VKORC1-1639G> A and VKORC1 1173C> T, which are VKORC1 mutation genes, using a pyro sequencer.

FIG. 13 is a second experimental result of multi-pyro sequencing performed to determine whether VKORC1-1639G> A and VKORC1 1173C> T, which are VKORC1 mutation genes, using a pyro sequencer.

14 is a first experimental result of the multi-pyro sequencing performed to determine whether the VKORC1-1639G> A and the CYP2C9 mutation gene CYP2C9 ^* 3 using the pyro sequencer.

15 is a second experimental result of multi-pyro sequencing performed to determine whether the VKORC1-1639G> A and the CYP2C9 mutation gene CYP2C9 ^* 3 using the pyro sequencer.

FIG. 16 is a third experimental result of multi-pyro sequencing performed to determine whether the VKORC1-1639G> A and the CYP2C9 mutant gene CYP2C9 ^* 3 using a pyrosequencer.

Figure 17 shows the first experimental result of mono pyro sequencing performed to determine whether CYP2C9 ^* 13, a mutation gene of CYP2C9 using a pyro sequencer (CYP2C9 ^* 1 / ^* 1).

FIG. 18 is a second experimental result of mono pyro sequencing performed to determine whether CYP2C9 ^* 13, which is a mutation gene of CYP2C9, using a pyro sequencer (CYP2C9 ^* 1 / ^* 13).

19 is a first experimental result of mono pyro sequencing performed to determine whether the CYP2C9 mutation gene CYP2C9 ^* 14 using a pyro sequencer (CYP2C9 ^* 1 / ^* 1).

20 is a second experimental result of mono pyro sequencing performed to determine whether the CYP2C9 mutant gene CYP2C9 ^* 14 by using a pyro sequencer (CYP2C9 ^* 1 / ^* 14).

21 is a first experimental result of multi-pyro sequencing performed to determine whether the CYP2C9 mutant genes CYP2C9 ^* 13, CYP2C9 ^* 14 by using a pyro sequencer (CYP2C9 ^* 1 / ^* 1).

22 is a second experimental result of multi-pyro sequencing performed to determine whether the CYP2C9 mutant genes CYP2C9 ^* 13, CYP2C9 ^* 14 by using a pyro sequencer (CYP2C9 ^* 1 / ^* 13).

FIG. 23 shows a third experimental result of multi-pyro sequencing performed to identify whether CYP2C9 mutant genes CYP2C9 ^* 13 and CYP2C9 ^* 14 using a pyro sequencer (CYP2C9 ^* 1 / ^* 14).

FIG. 24 is a first experimental result of triplex pyro sequencing performed to determine whether CYP2C9 mutant gene CYP2C9 ^* 3.CYP2C9 ^* 13 and CYP2C9 ^* 14 using a pyrosequencer (CYP2C9 ^* 1 / ^* 1) ).

25 is a second experimental result of triplex pyro sequencing performed to determine whether the CYP2C9 mutant gene CYP2C9 ^* 3. CYP2C9 ^* 13, CYP2C9 ^* 14 using a pyrosequencer (CYP2C9 ^* 1 / ^* 3 ).

FIG. 26 is a third experimental result of triplex pyro sequencing performed to determine whether CYP2C9 mutant genes CYP2C9 ^* 3.CYP2C9 ^* 13 and CYP2C9 ^* 14 using a pyrosequencer (CYP2C9 ^* 3 / ^* 3) ).

27 is a fourth experimental result of triplex pyro sequencing performed to determine whether CYP2C9 mutant genes CYP2C9 ^* 3.CYP2C9 ^* 13 and CYP2C9 ^* 14 using a pyrosequencer (CYP2C9 ^* 1 / ^* 13) ).

28 is a fifth experimental result of triplex pyro sequencing performed to determine whether the CYP2C9 mutant gene CYP2C9 ^* 3. CYP2C9 ^* 13, CYP2C9 ^* 14 using a pyrosequencer (CYP2C9 ^* 1 / ^* 14 ).

<110> Inje university industry-academic cooperation foundation <120> Method for Diagnosis of mutant genotype of genes related to drug          reaction of anticoagulant <130> DPP080185KR <160> 35 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for PCR <400> 1 tggatacctt catgattcat a 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for PCR <400> 2 atctggagaa cacacactgc 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for PCR <400> 3 acagcatctg gagagggagg ag 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for PCR <400> 4 gcattgccct gacacctagt gg 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for PCR <400> 5 tagggtcagt gacatggaat cc 22 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for PCR <400> 6 tgttggattg attgaggatg ctg 23 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for PCR <400> 7 agcctgatgt ggctcagttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for PCR <400> 8 ctgctgggaa gggtggttat 20 <210> 9 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 9 tggtggggag aaggtc 16 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 10 ctgaaaaaca accattggcc 20 <210> 11 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 11 ccaggagatc atcgac 16 <210> 12 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 12 atttggtcca ttgtcat 17 <210> 13 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 13 ccaggagatc atcgac 16 <210> 14 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 14 atttggtcca ttgtcat 17 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 15 ctgaaaaaca accattggcc 20 <210> 16 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 16 ccaggagatc atcgac 16 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 17 tgaaaaacaa ccattggc 18 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sequencing primer <400> 18 tggtggggag aaggtcaa 18 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 13 <400> 19 gtagagacgt ggtatcacct tg 22 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 13 <400> 20 cagccagtgg gaaaatgc 18 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 14 <400> 21 ttacagagct cctcgggcag a 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 14 <400> 22 ggtaatggga aaaacactgc t 21 <210> 23 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for CYP2C9 * 13 <400> 23 cagaaaactc ctctcca 17 <210> 24 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for CYP2C9 * 14 <400> 24 atggaaggag atccg 15 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 13, * 14 <400> 25 gtttgctgtt atctctgtct a 21 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 13, * 14 <400> 26 tagtccagta aggtcagtga tatg 24 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for CYP2C9 * 13 <400> 27 gaaggaagcc ctgattgatc 20 <210> 28 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for CYP2C9 * 14 <400> 28 atggaaggag atccg 15 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 3 <400> 29 tggatacctt catgattcat a 21 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 3 <400> 30 atctggagaa cacacactgc 20 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 13, * 14 <400> 31 gtttgctgtt atctctgtct a 21 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer for CYP2C9 * 13, * 14 <400> 32 tagtccagta aggtcagtga tatg 24 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for CYP2C9 * 3 <400> 33 tgcacgaggt ccagagat 18 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for CYP2C9 * 13 <400> 34 gaaggaagcc ctgattgatc 20 <210> 35 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for CYP2C9 * 14 <400> 35 atggaaggag atccg 15  

Claims (24)

Amplifying the genes encoding CYP2C9 and VKORC1 from genomic DNA isolated from the subject; Mono or multiple pyro using the primers of SEQ ID NOs: 9, 10, 11, 12, 17, 18, 23, 24, 27, and 33 as sequencing primers for amplifying a site where a displacement exists in each of the amplified genes. Performing sequencing; And detecting a single nucleotide polymorphism from a result obtained by performing the mono or multiple pyro sequencing. The method of claim 1, wherein the mutation gene associated with the drug response of warfarin is VKORC1-1639G> A, VKORC1 1173C> T, VKORC1 3730G> A, CYP2C9 ^* 3, CYP2C9 ^* 13, and CYP2C9 ^* 14 Method of determining genotype variation of genes related to drug response. The method of claim 1, wherein the variant genotype of VKORC1 further comprises VKORC1 1181T> G. delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete

Images