KR101148755B1 - Novel SNPs and mehod for diagnosing bipolar disorder using them - Google Patents

Abstract

The present invention relates to SNPs (monopolymorphism) of the DUSP6 gene involved in bipolar disorder. More specifically, the present invention relates to one or more polynucleotides or complementary polynucleotides thereof selected from polynucleotides consisting of 10 or more consecutive bases including two new SNP position bases in the DUSP6 gene, for diagnosing bipolar disorder comprising the same. Probes, microarrays and kits are provided. By using the SNP of the present invention, it is possible to specifically diagnose bipolar disorder.

DUSP6 gene, SNP, bipolar disorder

Description

SNPs for diagnosing bipolar disorder and methods for diagnosing bipolar disorder using the same {Novel SNPs and mehod for diagnosing bipolar disorder using them}

The present invention relates to a SNP for diagnosing bipolar disorder and a microarray and a kit including the same. The present invention also relates to a method for diagnosing bipolar disorder using the polynucleotide containing the SNP. The SNPs are SNPs located in a dual specificity phosphatase 6 (DUSP6) gene.

Bipolar disorder is a life-threatening prevalence of 2 to 5%, often occurring late in puberty or early adulthood and is a major mental illness that affects life. Representative mood disorders that repeatedly show rise and fall of mood are characteristic of recurrent recurrence and chronicization of manic episodes, depression episodes, and mixed episodes.

In household studies of patients with bipolar disorder, the prevalence of bipolar disorder is four times higher and that of depression is two times higher than that of the general population. In twin studies of bipolar disorder, 65-100% of diagnosis was consistent in identical twins and 10-30% in fraternal twins. Combined with epidemiologic studies, bipolar disorder is known to be a heritable disease with a heritability of 60-80%. Numerous genetic studies have been conducted on bipolar disorders, but have shown significant associations at various chromosomal sites, and the proposed candidate genes have also produced inconsistent results.

DUSP6 (Dual specificity MAP kinase phosphatase 6) is one of the dephosphatase of Mitogen-activated protein kinases (MAPKs), and there is a lot of evidence that is closely related to major mental diseases. First of all, MAPKs regulate various cellular functions such as proliferation, differentiation and cell survival / death. DUSP6, also called MKP-3 (MAPK phosphatase-3), is one of the MAPKs, ERK1 / 2 (Extracellular signal-regulated kinases), which provides feedback feedback. ERK1 / 2 showed changes in activity levels in animal models of major psychiatric disorders, and activation of ERK1 / 2 signaling system was observed when mood modifiers and antipsychotics were used as treatments for bipolar disorder. In other words, the ERK signaling system is considered to be one of the main targets for the pathogenesis and treatment of bipolar disorder. DUSP6 is associated with the development and treatment of major psychiatric disorders, either directly or through ERK1 / 2. The DUSP6 gene is also located at 12q22-23, one of the chromosomal sites known to be associated with bipolar disorder.

Therefore, the present inventors studied the relationship between bipolar disorder of DUSP6 gene and T / G mutation of DUSP6 (rs2279574 of Leu114Val, missense mutation, exon 1) and schizophrenia, which are only visible in bipolar disorder. A positive correlation has been reported (KY Lee, et al., 2006, "The association of DUSP6 gene with schizophrenia and bipolar disorder: its possible role in the development of bipolar disorder", Molecular Psychiatry 11, p. 425-426. Reference). In particular, women with bipolar disorder had a higher percentage of G alleles.

Based on these results, we analyzed the association of bipolar disorder with two new SNPs (rs769700 in intron 2 and rs770087 in exon 2) located in the DUSP6 gene. The novel SNPs were selected in consideration of criteria such as potential functional sites, linkage disequilibrium, technical possibilities, and whether or not minor alleles are present at significant frequencies in East Asians. Of the 32 SNPs in DUSP6, the SNPs located at exon 1 around rs227954, which were previously analyzed, were excluded from further analysis because the frequency of minor alleles was nearly zero.

It is an object of the present invention to provide a polynucleotide comprising a novel SNP, a microarray and kit comprising the same, capable of early diagnosis of the onset and the probability of bipolar disorder. Another object of the present invention is to provide a method for effectively diagnosing the presence or danger of bipolar disorder using the polynucleotide.

In order to achieve the above object, in a first aspect the present invention provides novel single base polymorphisms (SNPs) in the DUSP6 gene (SEQ ID NO: 1).

Preferably, the SNP site (polymorphic site) is the 1524th base (when transcription start base is +1) in the entire DUSP6 gene (SEQ ID NO: 1). We named this SNP rs770087 (FIG. 1). The rs770087 is located in exon 2 of the DUSP6 gene, and ordinary people have T as the nucleotide sequence of this site, but in the case of bipolar disorder patients, they have a low T and a high G. Preferably, the SNP according to the present invention is derived from, but not limited to, the DNA sequence of SEQ ID NO: 1, wherein the polymorphic site is G and includes the 1524th base (G), but not less than 10 consecutive DNA sequences. It consists of a polynucleotide consisting of or a complementary polynucleotide thereof.

Preferably, the SNP site (polymorphic site) is the 2683th base (when transcription start base is +1) in the entire DUSP6 gene (SEQ ID NO: 1). We named this SNP rs769700 (Fig. 1). The rs769700 is located in intron 2 of the DUSP6 gene, the average person has a T as the base sequence, but in the case of patients with bipolar disorder has a low T and a high C. Preferably, the SNP according to the present invention is derived from, but not limited to, the DNA sequence of SEQ ID NO: 1, wherein the polymorphic site is C and comprises the 2683 nucleotide base (C), 10 or more consecutive DNAs It is provided as a polynucleotide consisting of a sequence or a complementary polynucleotide thereof.

In the present invention, SNP (single nucleotide polymorphism) means that one nucleotide sequence of the genome shows diversity at a constant rate within a population. The polynucleotide comprising rs770087 or rs769700 is a polymorphic sequence. A polymorphic sequence refers to a sequence comprising a polymorphic site representing SNP in a polynucleotide sequence. The polynucleotide can be DNA or RNA.

In a second aspect, the present invention provides a probe for diagnosing bipolar disorder comprising the polynucleotide (polymorphic sequence) and a microarray including the probe. Such microarrays can be prepared using the polynucleotides of the invention, their complementary polynucleotides, the polynucleotides hybridizing with them, the polypeptides encoded by them, or the cDNAs thereof. For example, the polynucleotide is a substrate coated with an active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. It can be fixed on the phase. In addition, the substrate may be selected from the group consisting of silicon wafer, glass, quartz, metal and plastic. The method of immobilizing the polynucleotide on a substrate includes a micropipetting method using a piezoelectric method or a method using a pin-shaped spotter.

In a third aspect, the present invention relates to a kit for diagnosing bipolar disorder comprising the microarray. The kit according to the present invention may further comprise a primer set used to separate and amplify DNA containing the SNP from the subject in addition to the microarray of the present invention. Such suitable primer sets will be readily apparent to those skilled in the art with reference to the sequences of the present invention.

In a fourth aspect, the present invention provides a method for diagnosing bipolar disorder using the SNP. Preferably the method comprises the steps of obtaining a nucleic acid sample from the sample; And determining the nucleotide sequence of the polymorphic site of the polymorphic sequence. The method for determining the nucleotide sequence of the polymorphic site of the polymorphic sequence can be used without limitation methods commonly used in the art, including PCR.

Bipolar disorder specific SNP according to the present invention can be used for the early detection of patients who are vulnerable to bipolar disorder and screening of bipolar disorder therapeutic drugs, and can be used for the use of bipolar disorder such as genetic fingerprint analysis. In addition, analyzing the SNP associated with the bipolar disorder of the present invention can provide basic information about the risk of bipolar disorder.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example  1. According to the present invention SNPs Of bipolar disorder

(1) Test subject

DNA was isolated from blood of Korean patients who were found to be bipolar disorder or schizophrenic patients and normal persons without bipolar disorder and schizophrenia symptoms, and the frequency of occurrence of specific SNPs was analyzed.

The experiment was conducted on 268 bipolar disorder patients, 278 schizophrenia patients and 350 healthy controls. All people were unrelated Koreans and all patients met the DSM-IV criteria for bipolar disorder or schizophrenia. All patients underwent a Diagnostic Interview for Genetic Studies. The diagnosis was made at a council and had informed consent before being approved by the Seoul National University Ethics Committee.

(2) Preparation and Amplification of DNA Samples

The SNP selected in this example was selected from a published database (NCBI dbSNP: http: //www.ncbi.nlm.nih.gov/SNP/), and the SNP sequence in the sample using primers using the sequence around the selected SNP. Was analyzed.

1) Preparation of DNA Sample

DNA was extracted from the blood of the patient group and the normal group. Chromosomal DNA extraction was performed using In-George's G-DEX ™ IIb Genomic DNA Extraction Kit (cat. No. 17241). The extracted DNA was obtained with a 260nm / 280nm ratio of about 1.8 to 1.9 using a spectrophotometer, and diluted to 50ng / ul for ease of use.

2) Amplification and Analysis of Target DNA

Taqman assay was used. DNA (50ng / ul) 1ul, 2X PCR Taqman mastermix 2.5ul, sense primer (20 pmols / ul) 0.15ul, antisense primer (20 pmols / ul) 0.15ul, probe (FAM-TAMRA, 5 pmols/ul) 0.1ul, 0.1 ul of probe (TET-TAMRA, 5 pmols / ul) and 1 ul of DW were mixed and reacted with a total of 5 ul. ABI 9700 was used as a PCR device, and the temperature conditions were 50 ° C. 2 minutes, 95 ° C. 10 minutes, 95 ° C. 15 seconds, 60 ° C. 1 minute, and the experiment was repeated after 40 cycles of these two steps. Finished. The primers used in the experiments are shown in Table 1.

gene SNP rs number Primer sequence forward reverse DUSP6 rs769700 CTTGCAGTCTGGTTGTCTGTGTAAA
(SEQ ID NO: 2) TCTGCCAACAAAAAACTCCTTAATG
(SEQ ID NO: 3) rs770087 CAGGTGGCTTCAGTAAGTTCCAA
(SEQ ID NO: 4) CTGCTACACGAGCCGTCTAGATT
(SEQ ID NO: 5) gene SNP rs number Probe Sequence FAM-TAMRA TET-TAMRA DUSP6 rs769700 AGGGTTTCTGGCATTCACATGCC
(SEQ ID NO: 6) AGGGTTTCTGGTATTCACATGCCGA
(SEQ ID NO: 7) rs770087 CCGAGTTCGCCCTGCATTGC
(SEQ ID NO: 8) CCGAGTTCTCCCTGCATTGCG
(SEQ ID NO: 9)

After PCR was completed, allelic discrimination was performed by reading through an ABI 7900HT instrument.

(3) Analysis result of allele frequency of SNP genotype

Table 2 shows the chi-square test results for the allele frequency of SNP.

In the dbSNP column, the rs number of each SNP is indicated. The column 'P value' refers to the probability level that is the result of the chi-square test on the 2-by-2 contingency table of allele frequencies of each SNP. When the P value is less than 0.05, the sample group means that the frequency of allele of each SNP according to the presence or absence of schizophrenia or bipolar disorder is statistically significant at the 95% confidence level. Two SNPs, rs769700 and rs770087, were significantly associated with bipolar disorder patients compared with normal controls. When sex was separated into males and females, a significant correlation between the bipolar disorder group and the SNPs disappeared in males. However, in women, the p value is lowered, so the association between the bipolar disorder group and the SNP is more significant.

'OD (odds ratio)' is the odds ratio, which is the probability of having a specific allele of the SNP in the patient group for the probability of having a specific allele of the SNP among the normal population based on the specific allele of the SNP. Indicates. If the odds ratio is greater than 1, the odds ratio itself is less than 1, which means the inverse of the odds ratio and the size of the SNP and the incidence of the disease. The larger the odds ratio, the higher the association. The column 'CI (95%)' refers to the lower and upper bounds of the 95% confidence interval with a 95% probability that the odds ratio exists in any interval. When the 95% confidence interval of the odds ratio does not include 1, it may be determined that the association of the SNP with the disease is statistically significant. In addition, when the frequency of the specific allele in the patient group is greater than the frequency of the specific allele in the normal group based on the specific allele of the SNP, that is, when the odds ratio is greater than 1, the specific allele is a risk allele. It means to act. In the opposite case, alleles other than the particular allele become risk alleles.

Two DUSP6 polymorphisms, rs769700 and rs770087, both of which were significantly associated with the bipolar patient group, were both OR = 2.21 (CI: 1.20-4.09), indicating that the minor allele of each SNP acts as a risk allele for bipolar disorder. do. For women who showed a more significant association, OR = 4.47 (CI: 1.79-11.17) is more likely to be associated with bipolar disorder.

(4) haplotype analysis

Haplotype analysis of the DUSP6 gene polymorphism showed that the G-G-C haplotype showed significant association with bipolar disorder when analyzed with three markers rs2279574-rs770087-rs769700. Analysis with two markers of rs770087-rs769700 showed significant association between the haplotypes of G-C and T-T and bipolar disorder. All of the haplotypes had lower p values in the analysis of women only.

Prediction example  1. According to the present invention Microarray  Diagnosis of Bipolar Disorder

(1) Fabrication of SNP-Finished Microarrays According to the Present Invention

The SNP selected in Example 1 may be fixed on a substrate to prepare a microarray. That is, the polynucleotides composed of 20 consecutive bases including the 1524 or 2683th base of SEQ ID 1, that is, AGCCGAGTTC G CCCTGCATT (SEQ ID NO: 10) and GGGTTTCTGG C ATTCACATG (SEQ ID NO: 11), respectively. (Located on the eleventh of twenty) is fixed on the substrate. Since there are two alleles at each SNP position, two polynucleotides are immobilized on the substrate for each sequence.

First, the N-terminus of each polynucleotide is substituted with an amine group and then spotted on a silylation slide (Telechem), wherein the spotting buffer may use 2 × SSC (pH 7.0). After spotting, the mixture was placed in a dryer to induce binding, followed by washing with 0.2% SDS for 2 minutes and tertiary distilled water for 2 minutes to remove unbound oligos. The slides were treated at 95 ° C. for 2 minutes to induce denaturation, followed by 15 minutes with blocking solution (1.0 g NaBH 4, 300 mL of PBS (pH 7.4), 100 mL EtOH), 1 minute with 0.2% SDS solution, and distilled water 2 minutes each, and dried at room temperature to produce a microarray.

(2) Diagnosis of bipolar disorder using microarray according to the present invention

Using the method described in step (2) of Example 1, the target DNA is separated from the blood of the subject to diagnose the onset or possibility of the bipolar disorder, and fluorescently labeled. Under the UniHyb hybridization solution (TeleChem), hybridization of the microarray prepared in Prediction Example 2 (1) and the fluorescently labeled target DNA was performed at 42 ° C. for 4 hours. Wash twice with 2 x SSC for 5 minutes at room temperature and dry in air. After drying, the slides were scanned with ScanArray 5000 (GSI Lumonics), and the scan results were analyzed with QuantArray (GSI Lumonics) and ImaGene software (BioDiscover), and the subjects were subjected to multiple SNPs according to the present invention. By confirming whether they have all or part, the likelihood of developing bipolar disorder and susceptibility to cardiovascular disease can be measured.

Figure 1 shows the configuration of the human DUSP6 gene in which the SNP of the present invention is located.

<110> SNU R & DB Foundation <120> Novel SNPs and method for diagnosing bipolar disorder using them <160> 11 <170> Kopatentin 1.71 <210> 1 <211> 4460 <212> DNA <213> Homo sapiens <400> 1 gagacgctcg ctgtttgtat ccattgagga gctgcctcgc gcagggggtg tgcgaggctg 60 agtccaagag atagcaaatc gagtcttaaa taatccgggg agaaagacgc ccgggtagat 120 ttgaggtgca gccttggagg gagggattag aagccgctag actttttttc ctcccctctc 180 agtagcacgg agtccgaatt aattggattt cattcactgg ggaggaacaa aaactatctg 240 ggcagcttca ttgagagaga ttcattgaca ctaagagcca gcggctgcag ctgggtgcag 300 agagaacctc cggctttact tctgtctcgt ctgccccaac cgctagcctc ggcttgggta 360 aggcgaggcg gaattaaacc ccgctccgag agcggcagct tcgcgcgcgg tgcgctcggc 420 ctatgcctgc cccgaggggc gtctggtagg caccccgccc tctcccgcag ctcgaccccc 480 atgatagata cgctcagacc cgtgcccttc gcgtcggaaa tggcgatcag caagacggtg 540 gcgtggctca acgagcagct ggagctgggc aacgagcggc tgctgctgat ggactgccgg 600 ccgcaggagc tatacgagtc gtcgcacatc gagtcggcca tcaacgtggc catcccgggc 660 atcatgctgc ggcgcctgca gaagggtaac ctgccggtgc gcgcgctctt cacgcgcggc 720 gaggaccggg accgcttcac ccggcgctgt ggcaccgaca cagtggtgct ctacgacgag 780 agcagcagcg actggaacga gaatacgggc ggcgagtcgg tgctcgggct gctgctcaag 840 aagctcaagg acgagggctg ccgggcgttc tacctggaag gtacgcgccc agggaactcc 900 gcgcgcgggg cagggctagg ggcgcagggc tgcgggcggg gcgcgtggat tgaaaatacc 960 tctgctccgc tcagctggag cttcggagcc gcgctgcccg cctagggacc ggcagccggc 1020 gaggtagggg ccgcgaaccg cgcgttccgc accagagaac cgggccggct cagaatccac 1080 tcgcttccgg ctgcgggtac cggcggtttc tttctaacgg gttctgcgcc ttcttagcca 1140 gaacatcctc caccatcacc ctgttttcta tcgttcgatt ttgaattaag atttgcagga 1200 cgggagagat tgttggggat gcaaattggc acatcttagc tctcaaaata ttccaaaaag 1260 ttgccatttt gtctatttcc ggattcaagc gaataagggt tccctggcga ggcgggcccg 1320 ttcgttccat tcccgatggt gcacatttaa agtgtgtttc tcttatagat ggttctgtat 1380 gtagggggtt cgtaggatgc ttgtggtgtt tcttgcgccg ggctgcggtt cttacaagct 1440 gtgaaaacta ctacggcttc tcaggttaga tgattgcttt tctcgttctg gcaggtggct 1500 tcagtaagtt ccaagccgag ttctccctgc attgcgagac caatctagac ggctcgtgta 1560 gcagcagctc gccgccgttg ccagtgctgg ggctcggggg cctgcggatc agctctgact 1620 cttcctcgga catcgagtct gaccttgacc gagaccccaa tagtgcaaca gactcggatg 1680 gtagtccgct gtccaacagc cagccttcct tcccagtgga gatcttgccc ttcctctact 1740 tgggctgtgc caaagactcc accaacttgg acgtgttgga ggaattcggc atcaagtaca 1800 tcttgaacgt cacccccaat ttgccgaatc tctttgagaa cgcaggagag tttaaataca 1860 agcaaatccc catctcggat cactggagcc aaaacctgtc ccagtttttc cctgaggcca 1920 tttctttcat aggtgagact aattaatagt cgtcgctctg acatttaaat gcaaaattcc 1980 tagccattca tagagtttaa gctgttaatc gttcttgctg cttgctaatt tgtctgactg 2040 caggtctcta atgttcctag agcgtcctta attctggttt atcttcttgc taaaggaaga 2100 aaacctgcct tttgacatgg ctgcagatca caggtgtatt tgaaacgctg tttcttgaat 2160 ctttgaattc agtcattgac agtcgttcat aatcggacaa cagatttttc cccccagtct 2220 ttggactcag gggaagggtc agatagaagt actcactata gacaggaatt ccagcattgc 2280 tttataattt aaaaacatct aggagttatt ttaggacatc aagttagttg ttggaaagca 2340 gtatgaatgc tgaatgttat ccagttgaat gatgcggtga tactggtaac agtgagacag 2400 tgggtaacct gagcccagca ggaagaactg tgggctggaa gcctgggaga agtgaatctc 2460 caggcattgt aatgcatttc ctattacaaa ggaactcatt ttcaggccgt gtcgacatcc 2520 tgttcctcct aatgggccgt cccctgtgac ttccctctct cttttaaaat gcctgaatac 2580 ctccattgtt agctgcacaa catttggagc ataatttaat agacccttgc agtctggttg 2640 tctgtgtaaa aggcattcac gaacatattg cagggtttct ggtattcaca tgccgaggca 2700 aagaatgcac ccattaagga gttttttgtt ggcagaaact taatacaaaa gctctctttt 2760 cagaaaatat ctgaaatatg taattgtgtc cagtgtacat gtttcatttc agtgatacat 2820 tttctgctgc ttgtagggct caactgccac acacaactat tattattatt atgttttcaa 2880 gttcagtttt tagactgatc attcacaaag ggtggttttc agtctgctga gatcttgctt 2940 ttctttttgt gttcacagat gaagcccggg gcaagaactg tggtgtcttg gtacattgct 3000 tggctggcat tagccgctca gtcactgtga ctgtggctta ccttatgcag aagctcaatc 3060 tgtcgatgaa cgacgcctat gacattgtca aaatgaaaaa atccaacata tcccctaact 3120 tcaacttcat gggtcagctg ctggacttcg agaggacgct gggactcagc agcccatgtg 3180 acaacagggt tccagcacag cagctgtatt ttaccacccc ttccaaccag aatgtatacc 3240 aggtggactc tctgcaatct acgtgaaaga ccccacaccc ctccttgctg gaatgtgtct 3300 ggcccttcag cagtttctct tggcagcatc agctgggctg ctttctttgt gtgtggcccc 3360 aggtgtcaaa atgacaccag ctgtctgtac tagacaaggt taccaagtgc ggaattggtt 3420 aatactaaca gagagatttg ctccattctc tttggaataa caggacatgc tgtatagata 3480 caggcagtag gtttgctctg tacccatgtg tacagcctac ccatgcaggg actgggattc 3540 gaggacttcc aggcgcatag ggtagaacca aatgataggg taggagcatg tgttctttag 3600 ggccttgtaa ggctgtttcc ttttgcatct ggaactgact atataattgt cttcaatgaa 3660 gactaattca attttgcata tagaggagcc aaagagagat ttcagctctg tatttgtggt 3720 atcagtttgg aaaaaaaaat ctgatactcc atttgattat tgtaaatatt tgatcttgaa 3780 tcacttgaca gtgtttgttt gaattgtgtt tgttttttcc tttgatgggc ttaaaagaaa 3840 ttatccaaag ggagaaagag cagtatgcca cttcttaaaa cagaacaaaa caaaaaaaga 3900 aaattgtgct cttttctaat ccaaagggta tatttgcagc atgcttgact ttaccaattc 3960 tgatgacatc tttacggaca ctattatcac taagaccttg ttatggcgaa gtctttagtc 4020 tttttcatgt attttcctca tgattttttc tctttatgta gtttgactat gccttacctt 4080 tgtaaatatt tttgcttgtg ttgtcgcaaa ggggataatc tgggaaagac accaaatcat 4140 gggctcactt taaaaaaaga aagaataaaa aaaccttcag ctgtgctaaa cagtatatta 4200 cctctgtata aaattcttca gggagtgtca cctcaaatgc aatactttgg gttggtttct 4260 ttcctttaaa aaaatttgta taaaactgga agtgtgtgtg tgtgagcatg ggtacccatt 4320 tgataagaga aatgcatttg attgtgaaga agggagagtt aaattctcca ttatgttcgt 4380 ggtgtaaagt ttagagctgg aatttattat aagaatgtaa aaccttaaat tattaataaa 4440 taactatttt ggctattgaa 4460 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 cttgcagtct ggttgtctgt gtaaa 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tctgccaaca aaaaactcct taatg 25 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 caggtggctt cagtaagttc caa 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ctgctacacg agccgtctag att 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agggtttctg gcattcacat gcc 23 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 agggtttctg gtattcacat gccga 25 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ccgagttcgc cctgcattgc 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ccgagttctc cctgcattgc g 21 <210> 10 <211> 20 <212> DNA <213> Homo sapiens <400> 10 agccgagttc gccctgcatt 20 <210> 11 <211> 20 <212> DNA <213> Homo sapiens <400> 11 gggtttctgg cattcacatg 20  

Claims (5)

delete delete delete In a polynucleotide consisting of the DNA sequence of SEQ ID NO: 1, the 1524 base (polymorphic site) is G and consists of 10 or more consecutive DNA sequences derived from the DNA sequence of SEQ ID NO: 1 comprising the 1524 base Polynucleotides; And In a polynucleotide consisting of the DNA sequence of SEQ ID NO: 1, the 2683th base (polymorphic site) is C and consists of 10 or more consecutive DNA sequences derived from the DNA sequence of SEQ ID NO: 1 comprising the 2683 base Polynucleotide Kit for diagnosing bipolar disorder comprising one or more polynucleotides or complementary polynucleotides thereof selected from the group consisting of: delete

Images