KR101108967B1 - Primer and probe for detection of Streptococcus mitis and method for detecting Streptococcus mitis using thereof - Google Patents

Abstract

The present invention relates to a primer for detecting Streptococcus mitic , a probe and a method for detecting Streptococcus mitic using the same, more specifically, to provide a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, the base sequence of SEQ ID NO: 1 by using a target of detection, designed to effectively detect the Streptococcus US teeth, Streptococcus US teeth of the base sequence of SEQ ID NO. 1 and thus complementary to the nucleotide of the sequence derived from the primer, probe, and Streptococcus US tooth using the same derived from It relates to a method of detection. Detection process according to the invention the advantages that can be distinguished from the Streptococcus, and a non-effect of the teeth can be detected only with specific, in particular Streptococcus US very similar to Streptococcus genus gyundeul and teeth (Streptococcus strains) and Streptococcus US tooth There is this.

Streptococcus mitis, Streptococcus, primers, probes, detection methods

Description

Primer and probe for detection of Streptococcus mitis and method for detecting Streptococcus mitis using immuno}

The present invention relates to a primer for detecting Streptococcus mitic , a probe and a method for detecting Streptococcus mitic using the same, and more specifically , to effectively detect Streptococcus mitic by using the base sequence of SEQ ID NO: 1 as a detection target. can, to a method for the detection of Streptococcus base of the SEQ ID NO 1 derived from the non-tooth sequence and the base sequence complementary thereto Streptococcus US tooth using primers, probes, and it's designed to be derived.

Streptococcus is a heterogeneous group of gram-positive bacteria present in the oral cavity and respiratory tract of humans. Its main pathogens are S. pneumoniae, Streptococcus pyogenes and S. agalactiae. ) , Including 48 species (Facklam et al., Clin Microbiol Rev , 15: 613-630, 2002).

In general, Streptococcus is composed of six taxonomic groups including 'pyogenic', 'mitis', 'salivarius', 'bovis', 'mutans' and 'anginosus' by 16S rDNA sequences (Kawamura et al., Int J Syst Bacteriol , 45: 406-408 (1995)), AH, KM and OV (Lancefield et al., J Exp Med , 145: 490-499 (1977)) based on serological characteristics Hemolytic (alpha, beta and gamma) and biochemical properties for each other (Coykendall, Clin Microbiol Rev , 2: 315-328 (1989); Whiley et al., Oral Microbiol Immunol , 13: 195-216 (1998) )).

The bacteria belonging to the group 'mitis' are S. mitis, S. pneumoniae, Streptococcus auraris, S. oralis, Streptococcus gordonii, Streptococcus S. sangius and Streptococcus parasaius . Streptococcus mitis and Streptococcus oraris have been known to cause caries in humans, but recent studies have reported that they cause diseases related to heart diseases such as subacute endocarditis and are of increasing importance (Whatmore et al. , Infect Immun , 68: 1374-1382 (2000)).

The identification of pathogenic streptococci has been performed by a series of physiological and serological tests based on culture (Freney et al., J Clin Microbiol , 30: 2657-2661, (1992)). However, identification of species at the species level takes about seven days for physiological and chemical tests due to the slow growth of bacteria, and the test results are sometimes inconsistent with the genetic results based on molecular evolutionary systematics. (Whiley et al., Oral Microbiol Immunol , 13: 195-216 (1998); Heath, Paediatr Respir Rev, 1: 4- 7 (2000)).

Streptococcus this method, such as non-tooth and Streptococcus Ora-less, the four characteristics Identification of alpha-haemolytic streptococci, such as, that is, colony morphology, opto-pro (optochin) sensitivity test, bile soluble and capsules aggregation response to polysaccharide antibody is used However, many isolates have had atypical responses to more than one standard test method, making it difficult to accurately identify them (Finland et al., J Clin Microbiol , 5: 154-166 (1997); Kontiainen et al., Eur J Clin Microbiol , 6: 422-424 (1987); Mundy et al., Microbiol Infect Dis , 109: 55-61 (1998); Munoz et al., Diagn Microbiol , 13: 63-66 (1990)).

Recently, in order to overcome these difficulties, many methods based on DNA analysis have been developed for the identification and detection of streptococci. For example, pneumococcal (Davis et al., J Clin Microbiol , 29: 2193-2196 (1991); Pozzi et al., J Clin Microbiol , 27: 370-372 (1989)), Streptococcus pyogenes, purulent Hybridization methods using specific probes for Streptococcus and Streptococcus bovis (Whitehead et al., J Clin Microbiol , 31: 2387-2391 (1993) have been developed, but the experimental methods are complex and time-consuming. There is a problem of specificity, and therefore, methods based on polymerase chain reaction (PCR) have been widely used (Salo et al., J Infect Dis , 171: 479-482 (1995)).

Therefore, there is still a need for a method for identifying a fast and effective Streptococcus mitis while overcoming the above problems.

On the other hand, SSH (suppressive subtractive hybridization), a method of comparative genome studies, was originally designed to investigate the difference in expression levels of cDNA libraries, but is now used by Helicobacter pylori (Akopyants et al., Proc Natl Acad Sci USA , 95: 13108-13113 (1998), Mycobacterium tuberculosis (Mahairas et al., J Bacteriol , 178: 1274-1282 (1996), Neisseria meningitidis (Tinsley et al., Proc Natl Acad Sci USA) , 93: 11109-11114 (1996)) and Bacillus anthracis (Kim et al., J Med Microbiol . 57: 279-286 (2008)) to identify genome differences of genetically related microorganisms. It is being used successfully.

The present inventors have found that this in view of the same point Streptococcus US teeth only detect and sympathy with it genomic SSH (genomic suppressive subtractive hybridization) techniques to identify the specific dielectric which can be used to result in Streptococcus major pathogens of oral streptococci was identified the dielectric difference between the non-tooth and Streptococcus pneumoniae Streptococcus US tooth was dig a specific nucleotide sequence, said specific nucleotide sequence that is a result of using the nucleotide sequence of SEQ ID NO: 1 as a target of detection making the primers and probes, Streptomyces by identifying from Rhodococcus Streptomyces very similar to the non-tooth Rhodococcus genus gyundeul (Streptococcus strains) can be detected only Streptococcus US tooth specifically to the present invention it has been completed.

Throughout this specification, numerous papers and patent documents are referenced and their citations are indicated. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

Accordingly, an object of the present invention is primers, probes derived from the base sequence of SEQ ID NO: 1 or a base sequence complementary thereto designed to effectively detect Streptococcus mitis by using targets derived from Streptococcus mitis as targets. And it provides a method for the detection of Streptococcus mytis using the same.

The objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

In order to achieve the object of the present invention as described above, the present invention provides a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a probe consisting of a nucleotide sequence of SEQ ID NO: 1, a base sequence complementary thereto and a nucleotide sequence derived therefrom, and a microarray for detecting Streptococcus mitis, wherein the probe is integrated on a substrate. to provide.

The present invention also provides a primer having a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 derived from the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a method for detecting Streptococcus mitis using the primer or probe.

The present invention also provides a composition for detecting Streptococcus mitus comprising the primer or probe.

Hereinafter, the present invention will be described in detail.

According to one aspect of the present invention, the present invention provides a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.

According to a preferred embodiment of the present invention, the nucleotide sequence of SEQ ID NO: 1 is a nucleotide sequence separated from Streptococos mitis .

The present invention provides a probe for detecting Streptococcus mitis . Probes provided in the present invention (a) the nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide sequence complementary to (a) above; And (c) may be derived from the base sequence of (a) or (b), and may have a sequence selected from the group consisting of 15 bp or more consecutive nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. Preferably, the base sequence of (c) is a 15-100bp base sequence derived from the base sequences of (a) and (b) and comprising the base sequence of SEQ ID NO: 2 or SEQ ID NO: 3, more preferably Is a contiguous sequence of 20-75 bp or less, and most preferably a contiguous nucleotide sequence of 30-45 bp or less. In addition, the probes of the present invention may be modified (eg, added, deleted, substituted) within a range that does not affect Streptococcus mitic specific detection.

The base sequence of SEQ ID NO: 1 is characterized in that it is specific for Streptococcus mitis . Thus probes of the invention nucleotide sequences of the SEQ ID NO: 1, The base sequence complementary or consists of a nucleotide sequence derived from these, Streptococcus include Streptococcus spp, except for non-tooth non-specific and Streptococcus specific US teeth only of Because of its characteristics, Streptococcus mitis can be detected efficiently. In an embodiment of the present invention it was confirmed that the specific base sequence with the base sequence linking are included in Streptococcus US tooth can not distinguish Streptococcus US tooth from Streptococcus spp, except for Streptococcus US tooth (Example 1).

The invention provides Streptococcus US tooth detection microarray according to claim that it is integrated on a base sequence and hence the probe, and the probe of the complementary nucleotide sequence derived from the substrate of SEQ ID NO: 1 that is included in Streptococcus US tooth do.

In the present invention, the term “probe” refers to a nucleic acid fragment corresponding to a few to several hundred bases, which is capable of specific binding with DNA or RNA, and is labeled to confirm the presence or absence of a specific DNA or RNA. . Probes can be prepared in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, and the like, and are labeled with biotin, FITC, rhodamine, DIG, etc. Or radiolabeled isotopes.

The present invention also provides a microarray for detecting Streptococcus mitis , wherein the probe is integrated on a substrate.

The microarray may include DNA or RNA polynucleotides. The microarray consists of conventional microarrays except that the polynucleotide of the present invention is included in the probe polynucleotide.

Methods of preparing microarrays by immobilizing probe polynucleotides on substrates are well known in the art. The term “probe polynucleotide” refers to a polynucleotide capable of hybridization, and refers to an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid.

The process of immobilizing probe polynucleotides associated with Streptococcus mitis of the present invention on a substrate can also be readily prepared using this prior art. In addition, the hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art. The detection is accomplished by labeling a nucleic acid sample with a labeling substance capable of generating a detectable signal comprising, for example, a fluorescent substance such as Cy3 and Cy5, and then hybridizing onto a microarray and generating from the labeling substance. The hybridization result can be detected by detecting the signal.

The present invention also provides a primer for detecting Streptococcus mitis .

Preferably, the primer provided by the present invention is the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. In addition, the primers of the present invention may be modified (eg, added, deleted, substituted) within a range that does not affect Streptococcus mitic specific detection. Primer of the present invention is a primer derived from the base sequence of SEQ ID NO: 1 contained in Streptococcus mitices and the base sequence complementary thereto.

In one embodiment of the present invention, a result of performing PCR using the primer combination of SEQ ID NO: 2 and SEQ ID NO: 3, Streptococcus US teeth and other Streptococcus spp, in particular taxonomic, the molecular Streptococcus US teeth with very Similar Streptococcus auris , Streptococcus pneumoniae (Streptococcus) , Streptococcus infantis, Streptococcus pyogenes , Streptococcus godoni, Streptococcus sinensis, Streptococcus rousus, Streptococcus constellatus, Streptococcus interstellar Medium, Streptococcus anginus , Lactococcus spawn , Enterococcus spawn And Tobago was confirmed that can be distinguished from the strains of microorganisms such as Rhodococcus (see Fig. 6).

As used herein, the term “primer” refers to a short nucleic acid sequence that can form base pairs with complementary templates and that serves as a starting point for template strand copying.

The primers may include restriction fragment length polymerphism (RFLP), randomly amplified polymorphic DNA (RAPD), DNA amplification fingerprinting (DAF), arbitrarily primed PCR (AP-PCR), sequence tagged site (STS), expressed sequence tag (EST), SCAR (sequence characterized amplified regions), inter-simple sequence repeat amplication (ISSR), amplified fragment length polymorphism (AFLP), cleaved amplified polymorphic sequence (CAPS), single-strand conformation polymorphism (PCR-SSCP), and the like. It can be designed to suit a variety of DNA analysis.

The present invention also (a) the nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide sequence complementary to (a) above; And (c) at least one probe or SEQ ID NO: 2 derived from the nucleotide sequence of (a) or (b) and selected from the group consisting of 15 bp or more consecutive nucleotide sequences comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 Or it provides a method for detecting Streptococcus mitis using a probe having a nucleotide sequence of SEQ ID NO: 3.

As a method for detecting Streptococcus mitis using the primer or probe of the present invention, PCR (polymerase chain reaction) analysis, DNA sequencing, hybridization by microarray, PCR-RFLP ( restriction fragment length polymerphism (RAPD) analysis, randomly amplified polymorphic DNA (RAPD), DNA amplification fingerprinting (DAF), arbitrarily primed PCR (AP-PCR), sequence tagged site (STS), expressed sequence tag (EST), sequence labeled amplified SCAR regions, inter-simple sequence repeat amplication (ISSR), amplified fragment length polymorphism (AFLP), cleaved amplified polymorphic sequence (CAPS), single-strand conformation polymorphism (PCR-SSCP), northern hybridization and southern hybridization It can be performed using a variety of DNA polymorphism assays known in the art such as, but not limited to, hybridization.

Specifically, in one embodiment of the present invention, a method of specifically detecting Streptococcus mitis by PCR using primers derived from Streptococcus mitic licD gene and its base sequence complementary thereto is illustrated. That is, PCR analysis was performed using primer combinations of SEQ ID NO: 2 and SEQ ID NO: 3. As a result, it was confirmed that the primer of the present invention can specifically detect Streptococcus mitis by specifically amplifying only the licD gene of Streptococcus mitis (see FIG. 6).

The present invention also (a) the nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide sequence complementary to (a) above; And (c) at least one probe or SEQ ID NO: 2 derived from the nucleotide sequence of (a) or (b) and selected from the group consisting of 15 bp or more consecutive nucleotide sequences comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 Or it provides a composition for detecting Streptococcus mitis comprising a probe having a nucleotide sequence of SEQ ID NO: 3.

The composition may include a variety of reagents, such as PCR reaction mixtures, restriction enzymes, and agarose, for the experimental procedures (eg, PCR, Southern blot, etc.) and the results required for detecting Streptococcus mitis using the primers or probes. In addition, a buffer solution for hybridization and / or electrophoresis may be further included.

A detection process according to the invention Streptococcus US teeth only has the effect that can be detected specifically, Streptococcus of Streptococcus spp, except the fine teeth, in particular Streptococcus proximity Su taxonomic, molecules as described above, the biological in much the same Streptococcus Ora-less, Streptococcus nyuko California, Streptococcus highly Thessaloniki, Streptococcus of the mouse and Streptococcus para there is an advantage that can not distinguish strains and Streptococcus US tooth, such as the mouse, Streptococcus US tooth It can be very useful for detection.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1 by Suppression subtractive hybridization (SSH) S. mitis  Identification of specific genomes

Example 1-1 Isolation of gDNA (Genomic DNA)

Methods of Ausubel et al. (Ausubel et al., Current protocols in molecular biology, section 22.4, John Wiely and Sons, New York ) from S. mitis KCTC 3556 ^T and S. pneumoniae KCTC 5080 ^T , NY, 1994).

First, the strains incubated in 3 ml of nutrient broth (Difco) were transferred to 1.5 ml microtubes and centrifuged at 15,000 rpm for 2 minutes to precipitate the cells. The precipitated cells were well suspended by adding 100 μl of TE buffer (pH 8.0), and 50 μl of 20 μl of 10% sodium dodecyl sulfate (SDS) and 10 μl of protease K (10 mg / ml (Sigma)). The reacted cells were mixed with 200 µl of 10% CTAB (cetyltrimethylammonium bromide) /0.7 M NaCl solution and mixed well, followed by reaction at 65 ° C. for 10 minutes, and the same amount of chloroform / isoamyl alcohol was added thereto. (24: 1), the solution was shaken for 5 minutes, centrifuged at 4 ° C. for 5 minutes, and only the supernatant was transferred to a new tube, to which 1 / 10-fold 3M sodium acetate and 2-fold 100% ethanol were added. The precipitated gDNA was washed with 70% ethanol, dissolved in 50 μl of TE buffer, RNase (Sigma) was added to a final concentration of 20 μg / ml, and then reacted at 42 ° C. for 30 minutes. The purified DNA was spectrometer (Model MBA). 2000, Perkin-Elmer, Norwalk, CN, USA) was used for the experiment while quantitating at 260 nm and stored at -20 ℃.

Example 1-2 Restriction Enzyme Cleavage

In order to connect an adapter to gDNA, the extracted gDNA was treated with Rsa I restriction enzyme. Restriction enzyme Rsa I (10 unit / μL, Roche ) to 2 μg of gDNA of S. mitis KCTC 3556 ^T and S. pneumoniae KCTC 5080 ^T isolated and purified in Example 1-1 Molecular Biochemicals, Mannheim, Germany) 1.5 μl and 5 μl 10 X buffer were added for 5-16 hours in a 37 ° C. constant temperature water bath, followed by 100 V on 1.0% LE agarose gel (FMC Bioproducts, Rockland, ME, USA). Electrophoresis for 20 minutes. After electrophoresis, staining was performed with EtBr (ethidium bromide) (10 mg / ml) for 10 minutes, and the presence or absence of cleavage was checked using a Gel Doc 2000 system (Bio-Rad, Hercules, CA, USA).

After confirming the cleavage, 2.5 µl of 0.2 M EDTA solution was added to stop the reaction. The cleaved DNA was purified using a solution of phenol / chloroform / isoamyl alcohol (25: 24: 1), precipitated by adding 0.5 times of 3 M sodium acetate and 2.5 times of 100% ethanol, washed with 80% ethanol and 6.5 It was dissolved in 3 μl of sterile distilled water.

Example 1-3: Suppressive Subtractive Hybridization (SSH)

Suppressive subtractive hybridization (SSH) used a hybridization kit (PCR-Select Bacterial Genome Subtractive Hybridization kit, Catalog #: K1809-1) from CLONTECH Laboratories (Palo Alto, CA USA), and the SSH process is shown in FIG. Represented by. First, in order to make adaptor-ligated tester DNA to which the test strain of Streptococcus mitis KCTC 3556 ^T was connected, 1.8 μl of distilled water was added to 1.2 μl of Streptococcus mitis gDNA digested with Rsa I, and diluted. A ligation master mix was prepared by adding 2 μl of 5 × ligation buffer, 1 μl of T4 DNA ligation (400 units / μl) and 1.8 μl of distilled water. The ligation reaction mixture is adjusted to a final volume of 10 μl by mixing 1 μl of diluted DNA, 2 μl of 10 μM adapter 1 or 2 μl of adapter 2R and 7 μl of ligation master mix into two tubes, respectively. The reaction was overnight in a constant temperature water bath.

2 μl of the comparative strain S. pneumoniae KCTC 5080 ^T gDNA, 1 μl of 1-adaptor-linked tester DNA and hybridization buffer for primary hybridization The total volume was adjusted to 4 μl and then denatured at 98 ° C. for 1 minute and 30 seconds, and hybridization was performed at 63 ° C. for 1 hour and 30 minutes. A 2R-adaptor-linked tester DNA sample was also performed in the same manner as above.

The second hybridization was denatured at 98 ° C. for 1 minute and 30 seconds by adding 1 μl of 2 × hybridization buffer to 1 μl of the comparative strain, S. pneumoniae KCTC 5080 ^T gDNA, followed by primary hybridization. The reaction solution (1 primary hybridization reaction solution using 1-adaptor-linked tester DNA and 2 primary hybridization reaction solutions using 2R-adaptor-linked tester DNA) was mixed well and reacted overnight at 63 ° C. 200 μl of dilution buffer was added thereto to react at 63 ° C. for 7 minutes and stored at −20 ° C.

Example 1-4 Nested PCR

Nested PCR was performed to identify specific genomes of 1.2 µl of Streptococcus mitic gDNA. 1 μl of PCR primer (adaptor sequence specific primer, SEQ ID NO: 5′-CTAATACGACTCACTATAGGGC-3 ′), 1 μl of 10X buffer, 1 μl of hybridization reaction solution of Example 1-3, Taq DNA polymerase (Roche) After 1 μl and 19.5 μl of distilled water were added and reacted at 72 ° C. for 2 minutes, the reaction was performed for 30 seconds at 94 ° C., 30 seconds at 66 ° C., and 1.5 minutes at 72 ° C. using a DNA thermal cycler (Model 480, Perkin Elmer). Again, 1 μl of PCR product and 39 μl of distilled water were mixed, followed by secondary PCR, and primers were nested primer 1 (5′-TCGAGCGGCCGCCCGGGCAGGT-3 ′; SEQ ID NO: 4) and nested primer 2R (SEQ ID NO: (5'-AGCGTGGTCGCGGCCGAGGT-3 '; SEQ ID NO: 5) was used to perform 12 reactions for 30 seconds at 94 ° C, 30 seconds at 68 ° C, and 1.5 minutes at 72 ° C. The PCR amplification product was 1.2% LE agarose. It was confirmed by electrophoresis on gel (FMC) (result not shown).

Example 1-5 Cloning

PCR amplification products were cloned into pCR 2.1 vector using TOPO TA cloning system (Invitrogen, Carlsbad, CA, USA) and transformed with E. coli TOP 10. First, 1 μl (1 U) of DNA ligase, 1 μl of 10 × buffer, 1 μl of 10 mM ATP, and 6 μl of DW were added sequentially to 1 μl (10 ng) of the PCR product of Example 1-4. Ligation was performed for a minute. 1 μl of ligation solution was taken, mixed well with 50 μl of E. coli TOP 10 competent cells, left for 30 minutes on ice and subjected to heat shock at 42 ° C. for 30 seconds to introduce DNA into cells. The transformed E. coli culture was shaken for 1 hour at 37 ° C. at 220 rpm, followed by LB plate medium (Sigma) containing ampicillin (50 μg / ml) and 12 μl of X-gal (50 mg / ml). -Aldrich, St. Louis, Mo, USA) and incubated for 16 hours at 37 ℃. In order to measure the presence of PCR amplification products, only white colonies were taken from the colonies grown after incubation, inoculated into 5 ml of LB broth, shake-cultured at 37 ° C. for 220 hours at 220 rpm, and then plasmid DNA purification kit (Plasmid DNA). The plasmid DNA was isolated using a purification kit, Promega, Madison, WI, USA). The isolated plasmid DNA was digested with restriction enzyme EcoR I (Roche) for 1 hour at 37 ° C and electrophoresed with 1.0% LE agarose gel (FMC) to observe the cloning of PCR amplification products.

Example 1-6 Reverse southern hybridization

Streptococcus mitis gDNA was amplified by PCR from nested plasmid DNA using the nested primer 1 and nested primer 2R used in Example 1-4. 30 μl of the amplified DNA was denatured by heating at 100 ° C. for 5 minutes, and then left on ice for 5 minutes, and the total volume was 100 μl by adding the same amount of 20 X SSC (USB Co., Cleveland, OH, USA). Southern blot was used with an ECL kit (ECL Direct Nucleic Acid Labeling and Detection System, Amersham Biosciences, Little Chafont, Buckinghamshire, UK). Hybond-N + membrane (Amersham Biosciences), which was previously settled on 6 X SSC, was placed in a Bio-Dot microfiltration device (Bio-Dot Microfitration Apparatus, Bio-Rad), and 500 μl of distilled water was dispensed into each well. It was. Dispense 50 μl of DNA solution into each well, wash with 2X SSC, remove the membrane, dry on Whatmann 3 MM paper, and then use a StratalinkerUV crosslinker (Stratagene, La Jolla, CA, USA) for 3 minutes at 1000 J. 30 Crosslinking for seconds. After crosslinking, 6 ml of ECL hybridization buffer was added and prehybridized at 42 ° C. for 30 minutes. Then, the labeled probe was added and reacted overnight.

The labeled probe was prepared by cutting 200 μl of Streptococcus mitis gDNA (100 μg / ml) with Rsa I (Roche), reacting at 37 ° C. for 1 hour, dissolving in 30 μl of distilled water, and then 10 minutes at 100 ° C. After the denaturation, the same amount of DNA labeling solution and glutaraldehyde solution was added and reacted for 20 minutes at 37 ° C. Meanwhile, after the reaction, the membrane was taken out, washed once in 20% at 0.4% SDS, 0.5 X SSC, and twice in 5 minutes at 2 X SSC, dried, and added with an ECL detection reagent to obtain a film cassette (Eastman Kodak, The membrane was placed in Rochester, NY, USA and developed on an ECL film (Eastman Kodak), and the results are shown in FIG. 4 (A).

On the other hand, the Streptococcus-specific clones in the non-tooth Streptococcus pneumoniae (S. pneumoniae) is the reverse and Southern hybridization in the same manner as described above except that to, S. pneumoniae in order to confirm that non-specifically with a genomic DNA as a probe And the results are shown in Figure 4 panel (B).

Above, there could be a selection of 43 clones specific and non-specific, Streptococcus pneumoniae (S. pneumoniae) in Fig result of comparing the panel (A) and (B) of 4, Streptococcus US tooth.

Example 1-7 Gene Sequence Analysis

43 clones that were positive for Streptococcus mitis through Southern hybridization in Example 1-6 were subjected to a sequencing kit (BigDye Terminatior Cycle Sequencing Kit, Applied Biosystems, Foster City, CA, USA). Gene sequencing was analyzed. Recombinant plasmid was purified from E. coli purely using Promega DNA purification kit (Promega), followed by sequencing with 8 μl of Bigdye terminator ready reaction mixture in 2 μl (50 ng) of plasmid DNA. 3.2 pM of sequencing primer (M13 or SP6) was added and the final volume was adjusted to 20 μl with distilled water, followed by 96 ° C 10 seconds, 50 ° C 5 seconds, 60 ° C 4 minutes in GeneAmp ™ PCR System 2700 (Applied Biosystems). 25 cycle cycle sequencing PCR was performed. 2 μl of 3 M sodium acetate (pH 4.6) and 50 μl of 95% ethanol were added thereto, and allowed to stand at room temperature for 15 minutes, followed by centrifugation at 15,000 rpm for 20 minutes to precipitate DNA, washed with 100 μl of 70% ethanol, and dried. Residual dye was removed. Purified DNA was dissolved in 13 μl of template suppression reagent (TSR), heated at 95 ° C. for 2 minutes, and allowed to stand on ice for 5 minutes and then developed on an ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

The analysis results, the analysis of the nucleotide sequence could be identified that the 5'-GGTGTTGACAGCTGTTCTGCAACAACTCAAGGATCCAACTAAACTCTTTACTGGATCAGAAGCATTAGGTAAGGTCTTTGGTATGACCTCTACGAATGTTCCCTATAGTTTCTTATTGACCAATGGCTTATCCTTCCTAGATGGAGCGCAAAATGGTATTGAGAGATTAACAGTTCCAGAACTAGGTGATTGGGTCGATGCCTATGATGTCTATGGAGGACAGGCACTCTTAGTAGACCAAAATAAATATCAAACCAAGCTATCTCAAATGGGAATGAGATAAGATAGAAAAATCAAAGTTTGAAGGCTATGTATCTAGCAGTCAGGCTTTGATTTTTTACAGTCTGCAATAAATTTTCATCCCTTATTTGTGGTATAATGGAACGATACGATAGAAAGAATAATGAACAATATGACTGATTTAAAAGCTATTCAGGCTCGAAGTCTGGAGATGGCTGAATATTTTGTGGCCTTTTGTAAAGAACATGATTTGCTTTGTTATCTCTGTGGTGGAGGTGCTATTGGTGCCCTTCGAAACAAGGGTTTTATTCCTTGGGATGATGATCTAGATTTTTTTATGCCCCGTAAGGATTATGAAAAATTGGCAGAATTATGGCCTCGTTATGCAGATGAACGTTATTTCTTGTCGAAGAGTAACAAGGATTTTGTCGACCGCAATCTTTTT-3 '(SEQ ID NO: 1).

Example 2 Using Polymerase Chain Reaction Streptococcus mitis  Specific gene detection

Example 2-1 Preparation of Streptococcus mitic specific primers

Primer 3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi based on gene sequences selected by SSH (suppressive subtractive hybridization) for detection of Streptococcus mitic specific genes The primers were designed using the program. The designed primer was commissioned by Genotech Co., Ltd. (Taejon, Korea) on a 200 pM scale and purified by PAGE. Synthesized primers were used for the experiment while diluting to 10 μM concentration and storing at -20 ° C (Table 1).

TABLE 1

Example 2-2 Polymerase Chain Reaction (PCR)

In order to confirm whether the synthesized primer can specifically detect only Streptococcus mitic gene, polymerase chain reaction (PCR) was performed using a primer combination of SEQ ID NO: 2 and SEQ ID NO: 3 of the synthesized primers. First, 1 μl (10 ng) of DNA of the isolated and purified Streptococcus mitis and the control strains described in Table 2 were reacted (2 μl of 10 × Taq buffer, 1 μl of 2.5 mM dNTPs, DW 13.7, 1 μl of 10 uM forward primer). , 1 μl of 10 uM reverse primer and 19 μl of Taq polymerase (Intron, South Korea) were added thereto, followed by reaction at 94 ° C for 5 minutes, 94 ° C for 30 seconds, 58 ° C for 30 seconds, and 72 ° C for 40 seconds. Repeated times and amplified by reaction for 10 minutes at 72 ° C. PCR products were electrophoresed on 1% LE agarose gel (FMC) and observed for amplification and size.

As the experimental results shown in Figure 6, wherein the primers are Streptococcus US tooth genes were amplified only the specific, other Streptococcus spp and genes of other similar species including pneumoniae strains was found to be amplified does not.

Table 2-1

Table 2-2

Table 2-3

Table 2-4

KCTC (Korea Collection for Type Culture): Korea Gene Bank (Daejeon, Korea), CCARM (Culture Collection of Antibiotics Resistant Microbe): Antibiotic Resistant Microbe (Korea), ChDC (Chosun University Dental College) KCOM (Korean Collection for Oral Microbiology ): Oral Microbial Resources Center, DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen): German Microbiological Conservation Center, American Type Culture Collection (ATCC): US Center for Microbiological Conservation (Manassas, VA, USA), Belgian Co-Ordinated Collection of Micro organism (BCCM / LMG Bacteria Collection), T: refers to the type strain (type strain).

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

1 is a result of the to genomic DNA of Streptococcus US tooth (Streptococos mitis) and pneumococcus (Streptococcus pneumoniae) to connect the adapter treated with Rsa I.

Figure 2 is a schematic diagram showing a process of crab (Suppression subtractive hybridization) SSH to genomic DNA of Streptococcus pneumoniae and non-tooth.

Figure 3 shows the result of PCR amplification of the plasmid confirmed cloning in order to reverse Southern hybridization.

FIG. 4 shows the results of reverse southern hybridization to select Streptococcus mitic specific clones. Panel (A) uses ECL labeled Streptococcus mitic genomic DNA as probe and panel (B) uses ECL labeled pneumococcal genomic DNA as probe.

5 is an image showing the results of PCR analysis using primer combinations of SEQ ID NO (1) and SEQ ID NO (2). The numbers on the resulting images mean the following strains respectively. 1: S. mitis KCTC 3556 ^T 2: S. mitis KCOM 1350 3: S. mitis KCOM 1379 4: S. mitis KCOM 1388 5: S. mitis KCOM 1050 6: S. mitis KCOM 1285 7: S. mitis KCOM 1286 8: S.oralis KCTC 13048 ^T 9: S.oralis ATCC 9811 10: S.oralis ATCC 700 233 11: S.oralis DSMZ 2006 6 12: S.oralis DSMZ 20395 13: S.oralis KCOM 1401 14: S.oralis KCOM 1407 15: S.oralis KCOM 1408 16: S.oralis KCOM 1414 17: S.oralis KCOM 1416 18: S. pneumoniae KCTC 5080 ^T 19: S. pneumoniae CCARM 4009 20: S. pneumoniae CCARM 4019 21: S. pneumoniae CCARM 4033 22: S. pneumoniae CCARM 4109 23: S. pneumoniae CCARM 4112 24: S. pneumoniae CCARM 4113 25: S. pneumoniae CCARM 4114 26: S. pneumoniae CCARM 4115 27: S. pneumoniae ChDC 4-0134 28: S. pneumoniae ChDC 4-0749 29: S. pneumoniae ChARM 6-4740 30: S. pneumoniae CCARM 4003 31: S. pneumoniae CCARM 4005 32: S. pneumoniae CCARM 4078 33: S. pneumoniae CCARM 4079 34: S. pneumoniae CCARM 4080 35: S pneumoniae CCARM 4084 36: S. pneumoniae CCARM 4085 37: S. pneumoniae CCARM 4088 38: S. pneumoniae CCARM 4 106 39: S. pneumoniae CCARM 4116 40: S. pneumoniae CCARM 4081 41: S. pneumoniae CCARM 4091 42: S. pneumoniae CCARM 4111 43: S. pneumoniae CCARM 4059 44: S. infantis KCOM 1358 45: S. infantis KCOM 1375 46: S. australis KCOM 1386 47: S. australis KCOM 1439 48: S. australis KCOM 1441 49: S. pyogenes KCTC 3984 ^T 50: S. pyogenes KCTC 3096 51: S. pyogenes KCTC 3208 52: S.godonii KCTC 3286 ^T 53: S.godonii KCOM 1347 54: S.godonii KCOM 1364 55: S.godonii KCOM1369 56: S.godonii KCOM 1387 57: S.godonii KCOM 1357 58: S. sinensis KCOM 1017 59: S. sinensis KCOM 1427 60 : S. sinensis KCOM 1018 61: S.sanguinis KCTC 3284 ^T 62: S.sanguinis KCOM 1567 63: S.sanguinis KCOM 1372 64: S.sanguinis KCOM 1422 65: S.sanguinis KCOM 1428 66: S.sanguinis KCOM 1019 67 : S.sanguinis KCOM 1070 68: S.parasanguinis KCTC 13046 ^T 69: S.parasanguinis ChDC B185 70: S.parasanguinis ChDC B195 71: S.parasanguinis ChDC B215 72: S.parasanguinis KCOM 1365 73: S.parasanguinis KCOM 1366 74 : S.parasanguinis KCOM 1370 75: S.parasanguinis K COM 1585 76: S.constellatus ATCC 27823 ^T 77: S.constellatus ChDC B280 78: S.constellatus ChDC B284 79: S.constellatus ChDC B290 80: S. intermidius KCTC 3268 ^T 81: S. intermidius KB 80 82: S. intermidius KB80 83: S. intermidius KB 717 84: S. anginosus ATCC 33397 ^T 85: S. anginosus YA1 86: S. anginosus YA3 87: S. anginosus YA5 88: S. anginosus YA6 89: S. anginosus YA7 90: S anginosus YA8 91: S. anginosus YA9 92: S. anginosus YA10 93: S. anginosus YA11 94: S. anginosus YA12 95: S. anginosus YA13 96: S. anginosus B181 97: S. anginosus YA201 98: S. anginosus B232 99: S. anginosus B248 100: S. anginosus B252 101: S. anginosus B263 102: S. anginosus B287 103: S. anginosus B311 104: S. anginosus B407-1 105: L. lactis sub sp cremoris DSMZ 40699 ^T 106: L. lactis sub sp hordiae KCTC 3768 ^T 107: L. lactis sub sp lactis KCTC 3769 ^T 108: L. lactis sub sp lactis KCTC 3191 109: L. lactis sub sp lactis KCTC 2013 110: L. lactis sub sp lactis KCTC 3894 111: L. lactis sub sp lactis KCTC 3926 112: E. soli tarius KCTC 3553 ^T 113: E. hirae KCTC 3554 ^T 114: E. mundtii KCTC 3555 ^T 115: E. malodoratus KCTC 3557 ^T 116: E. cecorum KCTC 3558 ^T 117: E. saccharolyticus KCTC 3559 ^T 118: E. villorum KCTC 3560 ^T 119: E. moraviensis KCTC 3562 ^T 120: E. phoeniculicola KCTC 3563 ^T 121: E. raffinosus KCTC 3565 ^T 122: E. avium KCTC 3566 ^T 123: E. faecalis KCTC 3567 ^T 124: L. garvieae LMG 8162 125 : L. garvieae LMG 8501 126: L. garvieae LMG 9472 127: L. garvieae LMG 14494 128: V.fluvialis LMG 9464 T 129: V. salmoninarum LMG 11491 T 130: V. lutrae LMG 19537 T. T means type strain.

<110> CHUNG ANG University Industry Academic Cooperation Foundation <120> Primer and probe for detection of Streptococcus mitis and method          for detecting Streptococcus mitis using <160> 5 <170> KopatentIn 1.71 <210> 1 <211> 685 <212> DNA <213> Streptococcus mitis <400> 1 ggtgttgaca gctgttctgc aacaactcaa ggatccaact aaactcttta ctggatcaga 60 agcattaggt aaggtctttg gtatgacctc tacgaatgtt ccctatagtt tcttattgac 120 caatggctta tccttcctag atggagcgca aaatggtatt gagagattaa cagttccaga 180 actaggtgat tgggtcgatg cctatgatgt ctatggagga caggcactct tagtagacca 240 aaataaatat caaaccaagc tatctcaaat gggaatgaga taagatagaa aaatcaaagt 300 ttgaaggcta tgtatctagc agtcaggctt tgatttttta cagtctgcaa taaattttca 360 tcccttattt gtggtataat ggaacgatac gatagaaaga ataatgaaca atatgactga 420 tttaaaagct attcaggctc gaagtctgga gatggctgaa tattttgtgg ccttttgtaa 480 agaacatgat ttgctttgtt atctctgtgg tggaggtgct attggtgccc ttcgaaacaa 540 gggttttatt ccttgggatg atgatctaga tttttttatg ccccgtaagg attatgaaaa 600 attggcagaa ttatggcctc gttatgcaga tgaacgttat ttcttgtcga agagtaacaa 660 ggattttgtc gaccgcaatc ttttt 685 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mitis-M89L <400> 2 tggcttatcc ttcctagatg g 21 <210> 3 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> mitis-M89R <400> 3 gattgcggtc gacaaa 16 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> nested primer 1 <400> 4 tcgagcggcc gcccgggcag gt 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> nested primer 2R <400> 5 agcgtggtcg cggccgaggt 20  

Claims (8)

Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of claim 1, wherein the nucleotide sequence of SEQ ID NO: 1 is a nucleotide sequence separated from Streptococos mitis . (a) the nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide sequence complementary to (a) above; And (c) one or more streptograms selected from the group consisting of 15 bp or more consecutive base sequences derived from the nucleotide sequences of (a) or (b) and comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 or SEQ ID NO: 3 Probe for detection of caucus metis . The microarray for detecting Streptococcus mitis , wherein the probe of claim 3 is integrated on a substrate. Primer for detecting Streptococcus mitis, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4. A method for detecting Streptococcus mitis using at least one selected from the group consisting of a probe of claim 3 and a primer of claim 5. The method of claim 6, wherein the detection is performed by PCR (Polymerase Chain Reaction) analysis, DNA sequencing (DNA sequencing), hybridization by microarray, PCR-RFLP (restriction fragment length polymerphism) analysis, randomly amplified polymorphic DNA DNA amplification fingerprinting (DAF), arbitrarily primed PCR (AP-PCR), sequence tagged site (STS), expressed sequence tag (EST), sequence characterized amplified regions (SCAR), inter-simple sequence repeat amplication (ISSR), One selected from the group consisting of amplified fragment length polymorphism (AFLP), cleaved amplified polymorphic sequence (CAPS), single-strand conformation polymorphism (PCR-SSCP), Northern hybridization and Southern hybridization Method carried out by the above method. A composition for detecting Streptococcus mitis comprising the probe of claim 3.

Images