KR101106617B1 - A composition having anti-proliferative activity against cancer cell lines containing natural 6,7-dihydroxy-2,4-dimethoxy phenanthrene compound from D. batatas Decne - Google Patents

Abstract

The present invention relates to a pharmaceutical composition and health food composition having 6,7-dihydroxy-2,4-dimethoxy phenanthrene, which is derived from the juvenile (young woman) of raw horses, having various cancer cell proliferation inhibitory activities. 6,7-dihydroxy-2,4-dimethoxy phenanthrene according to the present invention is a mouse MC3T3-E1 (bone) derived from normal cells, not cancer cell lines Progenitor cells, osteoblasts) and adipocytes The growth of uterine cancer cells (HeLa), liver cancer cells (HepG2) and colon cancer cells (HCT-116) was shown to be almost nontoxic to the 3T3-L1 (fat progenitor) cell lines. It can be effectively suppressed at a low concentration of ˜40 ug / mL. In addition, it is confirmed that such cancer cell growth inhibition is shown through the activation of NAG-1 known as an anticancer gene, it can be expected to inhibit the growth of cancer cells and the effect of inhibiting cancer cell growth of the known phytochemical.

6,7-dihydroxy-2,4-dimethoxy phenanthrene, young girl, cancer cell growth inhibitory activity

Description

A composition having anti-proliferative activity against cancer cell lines containing natural 6,7-dihydroxy from 6,7-dihydroxy-2,4-dimethoxy phenanthrene natural compound -2,4-dimethoxy phenanthrene compound from D. batatas Decne}

The present invention relates to a cancer cell proliferation inhibitory active composition containing a natural substance 6,7-dihydroxy-2,4-dimethoxy phenanthrene compound derived from jurassic (young female) of Dioscorea batadas Decne, more specifically The present invention relates to a pharmaceutical composition and a health food composition having 6,7-dihydroxy-2,4-dimethoxy phenanthrene derived from a juvenile (young woman) of raw horses having various cancer cell proliferation inhibitory activity. .

Young woman (산 子) is a juvenile (mountain), which is partly used as seed for the next year's cultivation, but most of it is discarded pesticide-insoluble resources. Currently, about 5,000 tons of mountain chemicals are produced annually in Korea, and about 2,000 ~ 2500 tons of young women are produced annually. Geum, Eun-Ju et al., Korean Journal of Life Science, 2006, 16, 647-652]. However, young girls are not recognized as food ingredients of the Korea Food and Drug Administration, and are not edible, and when used as seeds of pesticides, they are discarded without special use due to the fact that it takes one more year to harvest than when using raw horse muscle. It's happening.

To date, the research on young women is insignificant in the world, and only limited studies on inflation and differentiation of young women and subsequent changes in diosgenin content have been reported [Narula et al., 2003, Plant Med, 69, 778-779; Sung Nak-sul, 1995, Journal of the Korean Society of Breeding, Vol. 27, 56-57]. Recently, the present inventors prepared a methanol extract from a young woman, a pesticide-insoluble resource, and separated three phenanthrenes and two phenanthraquinones, among which 6-hydroxy-2,4,6-trimethoxy phenane. Tren (6-hydroxy-2,4,6-trimethoxy phenanhrene) shows antifungal activity and 6,7-dihydroxy-2,4-dimethoxy phenanthrene (6,7-dihydroxy-2,4-dimethoxyphenanthrene) In this case, it has been confirmed that it exhibits a wide range of antifungal and antibacterial activity [Kum Eun-ju et al., 2006, Korean Journal of Life Science, 16, 647-652]. However, there are no reports of substances showing various cancer cell growth inhibitory activity in young women.

To date, most of the studies on the isolation of phenanthrene substances have been carried out in orchid plants, and 3,7-dihacioxy-2,4-dimethoxy phenanthrene in Scaphyglottis livida, an orchid species. (3,7-dihydroxy-2,4-dimethoxy phenanthrene) and 3,7-dihydroxy-2,4,8-trimethoxy phenanthrene (3,7-dihydroxy-2,4,8-trimethoxyphenanthrene) [Estrada et al., 1999, Planta Med, Vol. 65, 109-114], 1,5,7-trimethoxy-9,10-dihydrophenanthrene-2,6-diol in Nidema boothii (1,5,7-trimethoxy-9,10-dihydrophenanthrene-2,6-diol) and 1,5,7-trimethoxyphenanthrene-2,6-diol (1,5,7-trimethoxyphenanthrene-2, 6-diol) [Hernandez-Romero et al., 2004, J. Natural Product. 67, 160-167], 2,5-dihydroxy-3,4-dimethoxyphenanthrene and 9,10 in Maxillaria densa -Dihydro-2,5-dihydroxy-3,4-dimethoxyphenanthrene (9,10-dihydro-2,5-dihydroxy-3,4-dimethoxyphenanthrene) [Estrada et al., 1999, J. Natural Product , Vol. 62, 1175-1178, and 2,5-dihydroxy-4,9,10-trimethoxyphenanthrene in Dendrobium plicatile (2,5-dihydroxy-4,9, 10- trimethoxyphenanthrene) and 2,5-dihydroxy-4-methoxy-9,10-dihydrophenanthrene (2,5-dihydroxy-4-methoxy-9,10-dihydrophenanthrene) reported [Honda and Yamaki, 2000, Phytochemistry, Vol. 53, 987-990, which have been reported to have anti-convulsive and anticonvulsive activity against bacteria and fungi in part.
However, some of the five derivative compounds of phenanthrene derived from Tamus communis have been shown to be toxic to HeLa cells (Rethy et al., Planta medica 72 (8) 767-770, 2006). However, the present report that the specific phenanthrene compound 6,7-dihydroxy-2,4-dimethoxy phenanthrene derived from the young woman of the cultivated horse (Dioscorea batatas Decne) shows growth inhibitory activity against various cancer cells. Is the first time.

As such, some of the phytochemicals which are bioactive substances derived from plants have been reported to exhibit cancer cell proliferation inhibitory activity. Resveratrol, which is mainly present in grapes, has a proliferative inhibitory effect on colorectal and breast cancers, and this process involves activation of nonsteroidal anti-inflammatory drug-activated gene-1 (NAG-1) genes [Baek et al., 2002, Carcinogenesis, Vol. 23, 425-434], indole-3-carbinol, which is present in cabbage and broccoli, can effectively inhibit colon cancer, liver cancer and skin cancer, and this process is also related to the activation of NAG-1 gene. Lee et al., 2005, Biochem. Biophys. Res. Comm. 328, 63-69. Epicatechin gallate, a green tea component that inhibits the development of cancer and inhibits the growth of various cancer cells, is also associated with the activation of the NAG-1 gene [Baek et al., 2004, Carcinogenesis, 25, 2425-2432. Therefore, it has been confirmed that the NAG-1 gene is a cancer suppressor gene that inhibits the proliferation of cancer cells, and that some of the plant-derived phytochemicals that inhibit the proliferation of cancer cells are associated with the activation of the NAG-1 gene. . However, to date, there are no reports that natural substances derived from young females of the horses are involved in the activation of the NAG-1 gene.

Accordingly, the present inventors have separated various phenanthrene and phenanthromequinone substances from young females for efficient use as a biological resource for young females of discarded cultivated horses (Dioscorea batatas Decne). 16 (4), 647-652, 2006). Among them, Candida albicans showed the strongest antifungal activity. The present inventors further went through the anti-cancer activity of these compounds and found that 6,7-dihydroxy-2,4-dimethoxy phenanthrene can strongly inhibit the growth of various cancer cells, and such growth inhibition By confirming that the activity is related to the activation of the NAG-1 gene, it has been confirmed that the young girl can be used as a high value-added biological resource exhibiting a new cancer cell proliferation inhibitory activity, thus completing the present invention.

The purpose of the present invention is to show the effect of inhibiting cancer cell proliferation of uterine cancer, liver cancer and colon cancer cells by activating the expression of NAG-1, a cancer suppressor gene, with little toxicity to normal cells. A novel cancer cell proliferation inhibitory active pharmaceutical composition and a health food composition containing hydroxy-2,4-dimethoxy phenanthrene are provided.

The present invention is a step of separating the phenanthrene compound from the young donor (Diocorea batatas Decne), confirming the structure of the 6,7-dihydroxy-2,4-dimethoxy compound in the isolated natural phenanthrene compound Evaluating various cancer cell proliferation inhibitory ability, evaluating proliferation inhibition of normal cells of 6,7-dihydroxy-2,4-dimethoxy phenanthrene to confirm selective toxicity and 6,7-di Treatment with hydroxy-2,4-dimethoxy phenanthrene to cancer cells and then confirming the induction of expression of NAG-1 known as a cancer suppressor gene.

The present invention provides a variety of compounds containing 6,7-dihydroxy-2,4-dimethoxy phenanthrene (6,7-dihydroxy-2,4-dimethoxyphenanthrene) as an active ingredient isolated from the young horseshoe donor It provides a cancer cell proliferation inhibitory active pharmaceutical composition.

<Formula 1>

In the present invention, the 6,7-dihydroxy-2,4-dimethoxy phenanthrene is characterized in that it is derived from the young donor.

In the present invention, the term "active ingredient" refers to a substance or a group of substances (a pharmacologically active ingredient or the like which is not known to express the efficacy or effect of the drug directly or indirectly by intrinsic pharmacological action). It means containing a main component).

The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.

Dosage forms of the pharmaceutical compositions of the present invention may be used in the form of their pharmaceutically acceptable salts, and may be used alone or in combination with other pharmaceutically active compounds as well as in a suitable collection.

In addition, the present invention is a cancer cell proliferation inhibitory active health food composition containing 6,7-dihydroxy-2,4-dimethoxy phenanthrene (6,7-dihydroxy-2,4-dimethoxyphenanthrene) of the formula (1) as an active ingredient To provide.

"Health functional food" as defined in the present invention means a food manufactured and processed using raw materials or ingredients having functional properties useful for the human body according to the Health Functional Food Act No. 6767, and "functional" means a human body It means the ingestion for the purpose of obtaining a useful effect in health use such as nutrient control or physiological action on the structure and function of.

In the present invention, methanol extract was prepared from the young woman, and the phenanthrene compound was separated by methylene chloride organic solvent fraction and silica gel chromatography (Example 1, FIG. 1), and the structure of the separated compound was determined by various instrumental analysis ( Example 2, Formula 1), Various concentrations of 6,7-dihydroxy-2,4-dimethoxy phenanthrene dissolved in dimethyl sulfoxamide were treated to human cervical cancer cells, liver cancer cells and colon cancer cells to treat IC ₅₀ (50% growth inhibition concentration) was determined (Example 3, Figure 2 and Table 1), finally confirmed the IC ₅₀ (50% growth inhibition concentration) for normal cells (Example 4, Figure 3 and Table 2) It was confirmed that 6,7-dihydroxy-2,4-dimethoxy phenanthrene isolated from the young woman exhibited growth inhibitory activity specifically to cancer cells.

The present invention shows that the phytochemical 6,7-dihydroxy-2,4-dimethoxy phenanthrene isolated from the donor of the live horse exhibits potent cancer cell proliferation inhibitory activity in various cancer cells, but almost no cell in a cell line derived from normal cells. It was confirmed that no toxicity was shown. In addition, it was confirmed that the inhibition of cell proliferation is related to the activation of NAG-1, a cancer suppressor gene. Therefore, the present invention provides a phytochemical, 6,7-dihydroxy-2,4-dimethoxy phenanthrene having a novel cancer inhibitory activity, which activates the expression of the NAG-1 gene from the discarded young horses. There is an excellent effect to provide.

Hereinafter, preferred embodiments of the present invention will be described in more detail with reference to Examples. However, the scope of the present invention is not limited to these examples.

Example 1 Isolation of a Phenanthrene Compound from Young Women

Young woman was recovered in Andong, Gyeongbuk in November 2002 and November 2007, cut into 0.2 ~ 0.3 cm thick, and used dry for a week. The moisture content was about 70%, and the sufficiently dried young female sections were coarsely ground with a grinder. Finally 65 kg of powder was recovered from 216 kg of young woman. Thereafter, 300 liters of methanol was added for 2 days, followed by extraction with 300 liters of methanol for 1 day, and the extract was dried under reduced pressure with a rotary depressurizer (Rotavapor R-220, Buchi, Swiss) to recover 1.03 kg of extract. It was. At this time, the extraction rate was 1.58% based on the dry weight. Thereafter, 0.198 kg of the lysate fraction was recovered through methylene chloride solvent fraction to purify the phenanthrene compound, which was finally purified by sequential silica gel chromatography (Kieselgel 60, Merck Co., Ltd.) to about 12 g of the purified phenanthrene compound. (See FIG. 1). In this case, the final yield was 0.018% of the dry weight of young woman. In this case, the yield is low, but practical application is difficult, but the structure of the compound is confirmed, and accordingly, it is determined that mass production of the compound is possible through chemical and enzymatic modification of the phenanthrene nucleus.

Example 2 Structure Analysis of Isolated Phenanthrene Compounds

In order to examine the structure of the purified phenanthrene compound separated in Example 1, the structure of the separated compound was confirmed through various instrumental analysis. Melting points were measured without calibrating the Fisher instrument, and optical rotation was performed using Rudolph autopol III. Infrared and ultraviolet spectroscopic spectra were used on Bruker FT-IR and Hitachi U-3010 spectrometers, respectively. NMR analysis was performed using Varian Unity INOV A500, and electroionization was analyzed using JEOL JMS-750 MSTATION. As a result of the synthesis of the analytical data, 6,7-dihydroxy-2 having a hydroxyl group at carbon 6 and 7 in the phenanthrene mother nucleus and a methoxy group at carbon 2 and 4 as shown in the following formula (1): It was confirmed that it has a, 4-dimethoxy phenanthrene structure.

<Formula 1>

Example 3 Evaluation of Growth Inhibitory Activity of 6,7-Dihydroxy-2,4-dimethoxyphenanthrene in Various Human Cancer Cells

The 6,7-dihydroxy-2,4-dimethoxy phenanthrene isolated in Example 1 was used to inhibit cancer cell growth in human uterine cancer cells, liver cancer cells and colon cancer cells by MTS method [Kim et al., 2005 Year, Molecular Cancer Therapeutics, Vol. 4, 487-493].

First inoculate 1 × 10 ⁴ cells per well of 96 well microplates and incubate in RPMI 1640 (Biofittak, USA) medium containing 10% FBS for 24 hours, followed by 6,7-dihydroxy- Final concentrations of 2,4-dimethoxy phenanthrene were treated at concentrations of 0, 10, 20, 30, 40, 50, and 100 μg / mL. After 24 hours of incubation and exposure to various concentrations of 6,7-dihydroxy-2,4-dimethoxy phenanthrene, MTS (Promega, USA, [3- (4,5-dimethylthiazol-2-yl) 20 μl of -5- (3-carboxymethoxphenyl) -2- (4-sulfophenyl) -2H-tetrazolium]) solution was added to each well and reacted at 37 ° C. in a 5% carbon dioxide incubator for 4 hours. After the reaction was completed, absorbance was measured at 490 nm using a 96-well microplate (Expert 96 UV ASYS Hitech, Austria). Results are shown as the average of the values performed in four independent wells. As a result, 6,7-dihydroxy-2,4-dimethoxy phenanthrene showed potent cell proliferation inhibitory activity at a low concentration of 11.1 ug / mL in colorectal cancer, and 36-40 ug / in uterine and liver cancer cell lines. 50% growth inhibition was shown at the mL concentration (see Table 1).

TABLE 1

50% proliferation inhibitory concentration of 6,7-dihydroxy-2,4-dimethoxy phenanthrene in various human cancer cell lines

Human cancer cell line 50% growth inhibitory concentration (IC ₅₀ : ug / mL) Uterine Cancer (HeLa) 39.6 Liver Cancer (HepG2) 36.3 Colon Cancer (HCT-116) 11.1

Example 4: Evaluation of growth inhibitory activity of normal cells of 6,7-dihydroxy-2,4-dimethoxy phenanthrene

To assess cancer cell specific toxicity, 6,7-dihydroxy-2, using mouse MC3T3-E1 (osteoblastic progenitor, osteoblast) and adipocyte 3T3-L1 (fat progenitor) cell lines derived from normal cells, The cytotoxicity of 4-dimethoxy phenanthrene was evaluated. The experiment was conducted in the same manner as in Example 3, using alpha-MEM containing 10% FBS for MC3T3-E1 cell line and DMEM medium containing 10% Bovine serum for 3T3-L1 cell line. . The final concentrations of 6,7-dihydroxy-2,4-dimethoxy phenanthrene were treated to 0, 25, 50, and 100 μg / mL, followed by incubation for 24 hours, followed by MTS solution in the same manner as in Example 3. Was added and the absorbance was measured at 490 nm. Results are shown as the average of the values performed in four independent wells. As a result, 6,7-dihydroxy-2,4-dimethoxy phenanthrene showed no cell proliferation inhibition at the concentration of 100 ug / mL in MC3T3-E1 osteoblastic progenitor cell line and 442 in 3T3-L1 adipocyte cell line. It was calculated to show 50% cell proliferation inhibition at the concentration of ug / mL. Therefore, it can be seen from Examples 3 and 4 that 6,7-dihydroxy-2,4-dimethoxy phenanthrene exhibits high cell proliferation inhibitory activity specifically for cancer cells.

Example 5 Confirmation of Induction of Expression of NAG-1 Known as Cancer Suppression Gene after Treatment of Human Uterine Cancer Cells with 6,7-Dihydroxy-2,4-dimethoxyphenanthrene

The expression of NAG-1, known as a cancer suppressor gene, is due to the activation of several transcription factors such as EGR1 and ATF3, and the activation of transcription factor genes such as EGR1 and ATF3 includes grape resveratrol, soybean Zenithen, and garlic diallyl. Various phytochemicals are directly involved, such as indole-3-carbinol, which is found in disulfide, cabbage and broccoli. In this Example, 20 ug / mL to determine whether the cancer cell proliferation inhibitory activity by 6,7-dihydroxy-2,4-dimethoxy phenanthrene isolated from hemp young donor is shown by the activation of the NAG-1 gene After 24 hours of treatment with 6,7-dihydroxy-2,4-dimethoxy phenanthrene at a concentration of human uterine cancer cells HeLa, the expression of NAG-1, a known cancer suppressor gene, Expression changes of EGR-1 and ATF-3 transcription factors were confirmed. The base sequences of the primers used in the experiment are shown in Table 2, and ACT1 was used as a control anchoring gene (Housekeeping gene). From the treated cells, total RNA was extracted using Quiagen's RNeasy kit, cDNA was prepared using Oligo-dT30 (TakaRa Co., Japan), and a specific gene was amplified using each primer to compare expression changes. It was. Gene amplification included 250 ng cDNA, 10 mM MgCl _2, 0.5 uM primer set and PCR master mix at 20 uL reaction, 1 time (95 ° C, 5 minutes), 35 times (95 ° C, 1 Min; 58 ° C., 1 min: 72 ° C. 1 min). As a result, as shown in Table 2, NAG-1 gene increased 3.18-fold expression by 6,7-dihydroxy-2,4-dimethoxy phenanthrene treatment at a concentration of 20 ug / mL. Phosphorus EGR-1 was 11.55-fold and ATF-3 was 4.89-fold. Therefore, it was confirmed that cancer cell proliferation inhibitory activity of 6,7-dihydroxy-2,4-dimethoxy phenanthrene is related to the activation of NAG-1, a cancer suppressor gene.

TABLE 2

Primer sequences used and product size after nucleic acid amplification

name order Sequence (5 '-> 3') Product size (base pair) Remarks ACT1 F AAATCTGGCACCACACCTTC 206 Cytoskeletal maintenance R    AACGGCAGAAGAGAGAACCA NAG1 F CTCCAGATTCCGAGAGTTGC 169 NSAID enabled
gene R           GAGATACGCAGGTGCAGGT EGR1 F TGACCGCAGAGTCTTTTCCT 203 Early Growth Reactivity 1 R GGGTTGGTCATGCTCACTA ATF3 F CAAGTGCATCTTTGCCTCAA 167 Activation electronic factor 3 R  CCACCCGAGGTACAGACACT

TABLE 3

Changes in NAG-1 Expression and NAG-1 Expression Known as Cancer Suppressor Genes after Treatment with Human Uterine Cancer Cells for 24 hours with 6,7-dihydroxy-2,4-dimethoxyphenanthrene at 20 ug / mL Expression of EGR-1 and ATF-3 Transcription Factors

gene Relative expression level Control Treatment ACT1 1.00 1.00 NAG1 1.00 3.18 EGR1 1.00 11.55 ATF3 1.00 4.89

1 is a process for separating and purifying 6,7-dihydroxy-2,4-dimethoxy phenanthrene from young donors.

Figure 2 is a photograph showing the cell growth inhibition after treatment with 6,7-dihydroxy-2,4-dimethoxy phenanthrene at various concentrations in human uterine cancer cells HeLa for 24 hours.

Figure 3 shows a variety of 6,7-dihydroxy-2,4-dimethoxy phenanthrene in mouse MC3T3-E1 (osteoblastic progenitor, osteoblast) and adipocyte 3T3-L1 (fat progenitor) cell lines derived from normal cells. It is a figure which shows the cell growth degree after 24 hours of treatment.

4 is a photograph showing the expression of genes after treatment of human uterine cancer cells (HeLa) with 6,7-dihydroxy-2,4-dimethoxy phenanthrene at a concentration of 20 ug / mL for 24 hours.

Claims (3)

6,7-dihydroxy-2,4-dimethoxyphenanthrene compound of formula 1 isolated from the young donor of Dioscorea batatas Decne as an active ingredient A pharmaceutical composition having selective antiproliferative activity against human uterine cancer, liver cancer or colorectal cancer cells. <Formula 1>

delete delete

Images