KR101077942B1 - High throughput vector for transient expression in plant and uses thereof - Google Patents

Abstract

The present invention provides a Ligation Independent Cloning vector comprising a right adapter, a SnaBI recognition site, a control of cell death B1 ( ccdB 1) gene, a SnaBI recognition site, a left adapter, and a hemagglutinin gene. The present invention relates to a method of cloning foreign genes independently using the vector, a host cell transformed with the vector, and a method for producing a transient transgenic plant using the vector.

High Throughput, Ligation Independent Cloning, Vector, LIC, ccdB1, HA

Description

High throughput vector for transient expression in plant and uses according}

The present invention relates to a high throughput vector for plant transient expression and its use, and more particularly, to a right adapter, a SnaBI recognition site, a control of cell death B1 ( ccdB 1) gene, a SnaBI recognition site, a left adapter, and a hemagglutinin ( Ligation Independent Cloning Vectors Containing Haemagglutinin Genes, Methods of Cloning Foreign Genes Ligation Independently Using the Vectors, Host Cells Transformed with the Vectors, and Transients Using the Vectors It relates to a method for producing a transgenic plant.

Recombinant cloning is highly efficient, but it is time consuming, requires complex cloning procedures, and the need for enzymes makes expensive gene cloning expensive. Recent studies also show that the recombinant proteins produced tend to be properly folded in plant cells instead of yeast or E. coli cells to produce active plant proteins.

Transient expression is an easy, rapid and powerful technique for producing target proteins in plants. For the expression of recombinant proteins in plants, many transient expression systems are useful. Moreover, the technically simplest transient expression in plants takes advantage of the ability of Agrobacterium to transfer DNA into plant cells. Agrobacterium mediated transformation is easy to use, efficient and inexpensive, making it a very commonly used method for protein production in plants (Lindbo (2007) BMC Biotech 7: 52-62). .

One of the transient expression approaches is based on plant viruses such as the Tobacco Mosaic Virus (TMV). Recently, Lindbo (2007, Pl Physiol 145: 1232-1240; 2007, BMC Biotech 7: 52-62) described an enhanced agro infection called the TMV RNA-Based Overexpression Vector (TRBO). It was reported that an agroinfection-compatible Tobacco Mosaic Virus (TMV) vector was constructed. Lindbo also demonstrated that this vector can express higher agroinfection efficiency and higher levels of recombinant protein in plants than a transient expression system via agroinfiltration. Thus, those skilled in the art have determined that the vector will be a transient expression vector useful for the production of recombinant proteins in plants.

However, there are drawbacks such as highly consuming complex cloning processes, labor intensive processes, and large-scale gene cloning, such as high consumption of expensive enzymes.

The present invention has been made in accordance with the above requirements, it is possible to Ligation Independent Cloning (ligation Independent Cloning) to the pJL-TRBO vector, ccdB 1 (control of cell death B1) gene and hemagglutinin (Haemagglutinin) The present invention was completed by constructing a pJL-CLIC vector having a sequence inserted therein and transiently transforming nicotiana ventamiana with agro infection to check the efficiency of the vector.

In order to solve the above problems, the present invention provides a pJL-CLIC vector capable of inserting a control of cell death B1 ( ccdB 1) gene and a hemagglutinin sequence, and capable of ligation-independent cloning. to provide.

The present invention also provides a method of ligation-independent cloning of foreign genes using the vector.

The present invention also provides a host cell transformed with the vector.

The present invention also provides a method for producing a transient transgenic plant using the vector.

The pJL-CLIC (pJL- ccdB 1 and Ligation Independent Cloning) vector of the present invention does not require any prior information, restriction enzymes or conjugation enzymes for cloning, so cloning is easy, fast, and cost-effective. In addition, since the ccdB 1 gene is included, it is possible to select recombinant colonies without antibiotics, and since hemagglutinin sequences are included, there is an advantage that the production of proteins as well as expression of the target genes can be confirmed using antibodies. Therefore, it is very useful for mass cloning of genes of interest, and is a highly processed vector system for transient expression of plants.

The LIC vectors of the present invention will provide a powerful tool for high throughput cloning and transient expression analysis for functional genomics in plants.

In order to achieve the object of the present invention, the present invention provides a vector capable of insertion of a control of cell death B1 ( ccdB 1) gene and a hemagglutinin sequence, and enabling Ligation Independent Cloning. do. More specifically, the vector includes a right adapter, a SnaBI recognition site, a control of cell death B1 ( ccdB 1) gene, a SnaBI recognition site, a left adapter, and a hemagglutinin gene in a 5 'to 3' direction. can do. In addition, the chloramphenicol resistance gene may be further included between the ccdB1 gene and the SnaBI recognition site. More preferably, the vector may be the pJL-CLIC vector disclosed in FIG. 1, but is not limited thereto.

In the vector of the present invention, the right adapter and the left adapter are located at both SnaBI recognition sites, and serve as a template on which T4 DNA polymerase can act. SnaBI recognition site is a sequence that can be recognized by SnaBI restriction enzyme and consists of the base sequence of TACGTA. After cleaving the vector with SnaBI, treatment with T4 DNA polymerase cuts off a portion of the single strand of double-stranded DNA at the adapter site, resulting in the single-stranded DNA of several nucleotides to be conjugated with the insert to be cloned. do. ccdB 1 (control of cell death B1) gene is introduced to efficiently screen cloning after transformation into Escherichia coli.In the case where ccdB 1 gene is not cut by SnaBI restriction enzyme, the ccdB1 gene is normally expressed. When E. coli is not inserted, E. coli with inserted insert survives when ccdB 1 gene is cut by SnaBI restriction enzyme and ccdB1 gene is not normally expressed.

The hemagglutinin gene is not directly related to cloning the gene of interest, but may be used to check expression of the gene of interest after cloning. That is, by adding the hemagglutinin gene to the vector, there is an advantage in that not only the expression of the target gene but also the production of the protein can be confirmed using the antibody.

Vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the vector of the present invention is an expression vector and the prokaryotic cell is a host, a strong promoter (for example, a pLλ promoter, a trp promoter, a lac promoter, a T7 promoter, a tac promoter, etc.) capable of promoting transcription, It is common to include ribosomal binding sites and transcription / detox termination sequences for initiation of translation. When E. coli is used as a host cell, a promoter and an operator site of the E. coli tryptophan biosynthetic pathway, and a phage λ left promoter (pLλ promoter) can be used as regulatory sites.

The vector of the present invention may preferably be a plant expression vector, a preferred example of which is Ti, which is capable of transferring a portion of itself, a so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. -Plasmid vector. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is used to transfer hybrid DNA sequences to protoplasts from which current plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce into a plant host are viral vectors such as those that can be derived from double stranded plant viruses (eg, CaMV) and single stranded viruses, gemini viruses, etc., for example incomplete plant viruses. Can be selected from a vector. The use of such vectors can be advantageous, especially when it is difficult to properly transform a plant host.

The expression vector preferably comprises one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by a chemical method, which corresponds to all genes capable of distinguishing transformed cells from non-transformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol It doesn't happen.

In the plant expression vector according to an embodiment of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.

The plant expression vector of the present invention may use a conventional terminator, and examples thereof include nopalin synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens ( Agrobacterium tumefaciens) Terminator of the octopine gene, but is not limited thereto. With regard to the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.

The present invention also comprises the steps of cleaving the vector of the present invention with SnaBI restriction enzyme;

Treating the cleaved vector with the product to be cloned with T4 DNA polymerase in a separate reaction; And

It provides a ligation-independent cloning method comprising mixing each of the treated reactants to induce conjugation.

The ligation-independent cloning method of the present invention includes cleaving the vector of the present invention with SnaBI restriction enzyme. Preferably, after cleavage of the SnaBI restriction enzyme, a dephosphorylation process may be performed. Subsequently, the cleaved vector and the product to be cloned are treated with T4 DNA polymerase in a separate reaction, wherein only one of dNTPs is added to perform the T4 DNA polymerase reaction. Subsequently, each of the treated reactants is mixed to induce conjugation. This process is performed by mixing the vector of the present invention and a product to be cloned, applying heat at 65 ° C. for 1 minute, and then allowing the reaction to stand at room temperature to induce conjugation. , Conjugate enzymes (eg, T4 DNA ligase) are not used.

The present invention also provides a host cell transformed with the vector of the present invention. The host cell capable of continuously cloning and expressing the vector of the present invention in a stable manner can be used in any host cell known in the art, for example, E. coli JM109, E. coli BL21, E. coli RR1, E. strains of the genus Bacillus, such as coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcensons, and various Pseudomonas species. Enterobacteria and strains. The host cell is preferably Agrobacterium .

In addition, when transforming the vector of the present invention into eukaryotic cells, plant cells and the like can be used as host cells. The plant is Arabidopsis, potato, eggplant, tobacco, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower, spinach, chard, sweet potato, celery, carrot, buttercup, parsley, cabbage, cabbage, gatchi, watermelon, melon, cucumber, And dicotyledonous plants such as pumpkins, gourds, strawberries, soybeans, green beans, kidney beans, peas, or monocotyledonous plants such as rice, barley, wheat, rye, corn, sugar cane, oats, and onions.

The method of carrying the vector of the present invention into a host cell is performed by the CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973), when the host cell is a prokaryotic cell). ), Hanahan method (Hanahan, D., J. Mol. Biol., 166: 557-580 (1983)) and electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16: 6127-6145 (1988)) and the like. In addition, when the host cell is a eukaryotic cell, microinjection method (Capecchi, MR, Cell, 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et al., Virology, 52: 456 (1973)), Electroporation (Neumann, E. et al., EMBO J., 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87 (1980)), DEAE- Dextran treatment (Gopal, Mol. Cell Biol., 5: 1188-1190 (1985)), and gene balm (Yang et al., Proc. Natl. Acad. Sci., 87: 9568-9572 (1990)) The vector can be injected into the host cell.

The present invention also provides a method for producing a transgenic plant expressing a gene of interest comprising the step of recombining the gene of interest in a vector of the present invention, and then introducing it into plant cells. The target gene to be recombined into the vector of the present invention may be any gene, and the method of introducing the recombinant vector into the plant cell is as described above.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

One. pJL - CLIC  Vector production

The pJL48 (pJL-TRBO) vector (Lindbo (2007) Physiol 145: 1232-1240) has a cloning site with two CaMV 35S promoters, restriction sites of Pac I and Not I, CaMV polyA singnal sequence / terminator, and ribozyme. .

Primer pair (5'-TCAGGATCC TTAATTAA AGCCAATCCCTC TACGTA GGAGGATACCCATACGATGTTCCAGATTACGCTTGATAGGGTA-3GG) with a restriction region of Pac I (TTAATTAA) at the N-terminus and Sna BI (TACGTA) at the intermediate region for the easy and rapid plant transient expression vector. SEQ ID NO: 1) and (5'-ACCGGTACCCTATCAAGCGTAATCTGGAACATCGTATGGGTATCCTCC TACGTA GAGGGATTGGCT TTAATTAA GGATCCTGA-3 ': SEQ ID NO: 2) and, in particular, double-stranded DNA comprising an HA tag (YPYDVPDYA: SEQ ID NO: 3) at the C-terminus Cloning to 2.1 (invitorgen, USA) produced a TOPO2.1: HA (LIC) vector.

An attempt was made to clone the ccdB 1 gene into the vector. To obtain the ccdB 1 gene, the following PCR primer pairs ( ccdB -forward primer: 5'-TGC TACGTA AATTCTCGACTAAGTTGGCAGCATCACCCGACG-3 ': SEQ ID NO: 4 and ccdB -reverse primer: 5 from the pTRV2-GATEWAY vector (provided by Dr. Dinesh-Kumar)) CcdB 1 gene fragment was amplified using '-CGC TACGTA CTCGAGCAGACTGGCTGTGTATA AGGGAGCCTG-3': SEQ ID NO: 5). TOPO2.1: was cloned by joining the HA 1 ccdB gene fragment (LIC) Vector: HA (LIC), and by cutting the vector was 1 ccdB gene fragment amplified by PCR with Sna B1 restriction TOPO2.1. The cloned vector plasmid was transformed into E. coli strain DB3.1 and stored.

Finally, to insert the ccdB 1-HA (LIC) DNA fragment into the pJL48 vector, the pJL vector was cut using Pac I and Not I restriction sites of the multi-cloning sites of the pJL48 vector. In addition, the ccdB 1-HA (LIC) DNA fragment inserted into the TOPO2.1: ccdB 1-HA (LIC) plasmid was cleaved using Pac I and Not I restriction sites inside the TOPO2.1 vector. The ccdB 1-HA (LIC) DNA fragment was cloned into the cleaved pJL48 vector using a conjugated enzyme.

The cloned pJL- ccdB 1-HA (LIC) plasmid was transformed into E. coli strain DB3.1 and suspended in 10% glycerol and stored at -80 ° C. In addition, the inserted gene was sequenced to confirm that the ccdB 1-HA gene fragment was correctly cloned, and the vector was named pJL-CLIC ( ccdB 1 and Ligation Independent Cloning).

E. coli strain DB3.1 used in the present invention can live even if the ccdB 1 gene is expressed, but the strain DH5α or DH10B is killed, it was confirmed that the ccdB 1 gene was cloned using this, it was possible to increase the selection efficiency.

2. PCR product amplification

LIC forward primer (5'-CCAATCCCTCTACGAAATG-gene specific sequence-3 ': SEQ ID NO: 6) and LIC reverse primer (5'-) to amplify the gene to be inserted into the pJL-CLIC vector from the cDNA library or the base sequence of a known gene TATCCTCCTACGAT-gene specific sequence-3 ': SEQ ID NO: 7) was used. The PCR primers were constructed to be complementarily conjugated with the LIC cloning site inserted into the pJL-CLIC vector.

3. Ligation Independence Cloning  Way

The pJL-CLIC vector was digested with Sna B1 restriction enzyme for 4 hours, dephosphorylated with CIAP (Roche, Germany), and the DNA was purified with gel purification kit (ZYMOGEN, Germany). 360 ng of the vector was reacted in T4 DNA polymerase (Invitorgen, USA) 1 U, dGTP 2.5 mM and T4 DNA polymerase buffer at 22 ° C. for 30 minutes, followed by heat treatment at 70 ° C. for 20 minutes to deactivate the enzyme.

PCR products were also treated with restriction enzymes and purified in the same manner, and then reacted with T4 DNA polymerase 1 U and dCTP 2.5 mM. The two reactant pJL-CLIC vectors (20-60 ng) and PCR products (5-15 ng) were mixed and heated at 65 ° C. for 1 minute, followed by standing reaction until the temperature reached room temperature to allow conjugation.

Finally, a portion of the reaction was taken and transformed into E. coli strains (DH5α or DH10B) and plated on selective medium (LB agar medium containing 50 mg / L kanamycin) and incubated at 37 ° C. E. coli colonies were taken and PCR confirmed that the target gene was inserted into the pJL-CLIC vector.

4. Plant  Pause  Expression analysis

The identified plasmids were transformed into Agrobacteria strain GV3101 using the Freeze thaw method. To confirm the transient expression analysis in plants, the transformed Agrobacterium (pJL-CLIC: RD40) and the already transformed Agrobacterium (containing pBINplus: Rpiblb2 gene) were loaded with YEP liquid medium (10 g of yeast extract, 10 g of peptone). , 5 g of NaCl, 50 mg / L of kanamycin, and 25 mg / L of rifampicin were agitated at 200 rpm at 28 ° C.

Cultured Agrobacterial cells are collected by centrifugation and then suspended in 10 mM MES, pH 5.7, 10 mM MgCl ₂ , 200 μM acetosyringone solution. The cell solution was adjusted to 0.3 at ₆₀₀ nm of OD, and induced at room temperature for 2-3 hours.

Two Agrobacteria, each with a different gene, are mixed, inoculated with bacterial solution with a syringe that removes needles from Nicotiana and Ventamiana, and then grown in a culture room at 24 ° C. As a control, it was observed by injection of a mixture of pJL-CLIC and pBINplus: Rpiblb2.

Example 1: Construction of ligation-independent cloning vector pJL-CLIC

(1) pJL-CLIC Vector Construction

The pJL-CLIC vector in the present invention was produced by modifying it based on pJL-TRBO produced by Lindbo (2007, Pl Physiol 145: 1232-1240).

In particular (Ligation Independent Cloning) LIC method to produce a vector for cloning the efficient and low-cost, quick, easy to gene: We apply the (Aslanidis & Jong (1990) Nucleic Acids Res 18 6069-6074), also the ccdB gene 1 By insertion, cloning after transformation into E. coli was confirmed more efficiently.

In order to construct a cloning site for the LIC method in the pJL vector, a primer including a ccdB 1 gene sequence and Sna B1 restriction enzyme was constructed at the N- or C-terminus. Primer ccdB - Sna B1 sequence (5'-TGC TACGTA AATTCTCGACTA AGTTGGCAGCATCACCCGACG-3 ': SEQ ID NO: 4) for N- terminal site and primer ccdB-Sna B1 sequence (5'-CGC TACGTA CTCGAGCAGACTGGCTGTGTATAAGGGAGCCTG for C-terminal site) ': SEQ ID NO: 5) was produced. Using the primers, the ccdB 1 gene in the pTRV2-GATEWAY vector was amplified by PCR and cloned into the TOPO-2.1 vector.

The cloned TOPO- ccdB 1 ( Sna B1) was re-amplified using a primer as a template. The primers used included an adapter for LIC, the N-terminus being 5'-TCC TTAATTAA AGCCAATCCCTC TACGTA AATTCTCGACTAAGTTGGCAGC-3 '(SEQ ID NO: 8) containing Pac I, and the C-terminus being 5'- containing HA tag sequence. TATCAAGCGTAATCTGGAACATCGTATGGGTA TACGTA CTCGAGCAGACTGGC-3 '(SEQ ID NO: 9) was used. PCR fragments amplified with these two primers were cloned back into the TOPO-2.1 vector, digested with Pac I and Not I (already present in the TOPO-vector) restriction enzyme, and pJL-TRBO cut with Pac I and Not I in advance. Cloned to vector. This modified vector, pJL-CLIC vector, was confirmed to be correctly constructed through sequencing.

In addition, the function of ccdB 1 gene was confirmed using E. coli with two different genotypes. Among the E. coli DB3.1 strain can live even if the ccdB 1 gene is expressed, but the DH5α strain is killed, thereby increasing the selection efficiency.

(2) Advantages of pJL-CLIC Vector

In the present invention, pJL-TRBO vector (Lindbo (2007) Pl Physiol 145: 1232-1240) was modified to produce a vector for transient expression in plants. The pJL-TRBO vector is based on tobacco mosaic virus and is characterized by a very strong expression in transient expression in plants. However, in order to clone the vector, the nucleotide sequence of the gene to be cloned must be analyzed. In addition, based on this base sequence, a specific region must be cleaved using restriction enzymes, and then a complex cloning method using a conventional cloning method using a ligase must be used.

In the present invention, it was intended to modify the pJL-TRBO vector. As shown in FIG. 1, the modified pJL-CLIC (pJL- ccdB 1 and Ligation Independent Cloning) vector does not require the nucleotide sequence of the gene to be cloned and is easy to clone since it does not require a specific restriction enzyme or conjugation enzyme. It is fast and can save money. In addition, since the ccdB 1 gene (control of cell death B) was inserted into the vector, E. coli cells are killed when the plasmid carrying the gene is transformed into E. coli. Therefore, the gene was used to maximize the selection of E. coli. In addition, it is very simple selection method than the existing method because it can be selected without using antibiotics. In addition, HA (hemagglutinin) was fused to the C-terminal region to be cloned to determine whether the protein expression of the inserted gene using an antibody. This also has the advantage that the expression of the target gene as well as the generation of the protein of the target gene can be found together.

Example 2: Easy and Fast without Restriction and Conjugation Enzymes Cloning  Way

The present invention has been designed to clone easily and quickly from large quantities of genes to be selected from plants and pathogens or other organisms, in particular EST (cDNA library), and to clone at near 100% selection efficiency and low cost. The method of cloning to the vector will be described in detail.

Primers for N- and C-terminus including the plasmid sequence of the cDNA library to be cloned were prepared (FIG. 2A). For example, when a large number of genes inserted into pBluescript SK-phagemid are to be cloned, the primer may include an adapter sequence, including the N-terminal forward primer of pBluescipt (5'-CCAATCCCTCTACGAAATG-pBluscript vector nucleotide-3 ': SEQ ID NO: 6 ) And a C-terminal reverse primer (5'-TATCCTCCTACGAT-pBluscript vector SEQ ID NO: 3 ': SEQ ID NO: 7) to amplify the PCR fragment. The amplified gene fragment was reacted with T4 DNA polymerase and dCTP having 3 '→ 5' exonuclease activity and dCTP for about 30 minutes at room temperature (25 ° C), and then reacted for 20 minutes at 72 ° C. Was deactivated. The PCR fragment thus removed removes other bases from the 3′-end to the Ged portion.

The vector from the pJL-CLIC also use after removing the ccdB gene 1, dGTP and T4 DNA polymerase using the Sna B1 thus also removing any other base C until the base appeared (B in Fig. 2). The PCR fragment reacted with the T4 DNA polymerase and the pJL-CLIC vector are mixed and cultured and annealed. At this time, the vector and the PCR fragments are allowed to be conjugated only by the temperature hydrogen bonding reaction without using a ligase as in the conventional method. At this time, the temperature is left to slowly lower to room temperature starting at 75 ℃.

The reaction reacted in this way is transformed into E. coli DH5α or DH10B in about 2 μl, and then imbedded in LB agar medium containing kanamycin. If E. coli grows in colony form in the medium, it has been successfully cloned. If an attempt was made to remove ccdB 1 from the pJL-CLIC vector using Sna B1 but was not completely removed, self-ligation resulted in E. coli transformed by the expression of the ccdB 1 gene. Therefore, it can be seen that E. coli grown in the selection medium has a target gene fragment inserted. That is, the pJL-CLIC vector can be easily and quickly cloned and has an advantage of high efficiency.

Example 3: Efficiency Analysis of Ligation Independent Cloning Method Using pJL-CLIC Vector

(1) The pJL-CLIC vector prepared in the present invention was cloned using a plant cDNA library (genes contained in the pBluescript SK-phagemid vector) and a PCR fragment amplified by the gene of the late blight bacteria as a template using the LIC method. The cloned plasmids were transformed into Escherichia coli, and 5-10 colonies were selected and amplified again by PCR.

All selected colonies were confirmed to be amplified to the correct size, showing a transformation rate close to 100% (A of FIG. 3). That is, the LIC cloning method using the ccdB 1 gene showed very high efficiency and also shortened the time required for cloning. As a result of examining the nucleotide sequence of the cloned gene, it was confirmed that the cloned gene was 100% identical to the nucleotide sequence of the cloned gene.

(2) Also, the number of colonies of Escherichia coli generated after cloning was different for each gene (Fig. 3B), but randomly selected and PCR PCR fragments were examined to confirm that 100% EST gene fragments were inserted. . All genes cloned by the LIC method and transformed into E. coli show almost 100% ligation, cloning and transformation rate regardless of the number of colonies. Therefore, the cloning method using the LIC and ccdB 1 genes using the pJL-CLIC vector was found to be very effective, and the vector system of the present invention is considered to be very useful for cloning other genes.

Example 4: Analysis of transient expression patterns in plants using pJL-CLIC vector

The expression patterns of the genes inserted into the pJL-CLIC vector were analyzed. It was known that pJL-TRBO vectors based on the present invention are very strongly expressed when transiently expressed in plants (Lindbo (2007) Pl Physiol 145: 1232-1240). Since Lindbo used the GFP gene to see whether it was expressed, in the present invention, two different genes were simultaneously expressed in a plant and the expression level in the plant was examined.

It was observed whether the RD40 gene cloned into the pJL-CLIC vector was normally expressed in plants. Agrobacterium was transformed by cloning the Rpiblb2 gene, which is one of the late blight resistance genes of pBINplus, and the cloning of the RD40 gene, which is one of the effectors of the late blight of potato, on pJL-CLIC vector. These two genes (Rpiblb2 and RD40) are referred to as Nicotiana Ventamiana When expressed in plants, hypersensitivity reactions cause rapid cell death after 3-5 days. When Agrobacteria containing two other genes were injected into Nicotiana Ventamiana by syringe at the same time, the reaction was observed and the rapid death of cells in Nicotiana Ventamiiana plants was observed. Cloning with the -CLIC vector confirms that it can be used to investigate plant responses.

Example 5: Analysis of the size and efficiency of genes cloned into pJL-CLIC vector

The pJL-CLIC vector of the present invention is a very useful system for mass cloning of genes of interest. Especially for high efficiency, short time and low cost, the results were very satisfactory.

However, since the size of the target gene is non-uniform, we wanted to find out the size of the gene fragment that can be cloned into the pJL-CLIC vector. Gene fragments used in the present invention were cloned and selected using the characteristics of the LIC method and ccdB 1 gene by amplifying genes of various sizes up to 300-4000 bp by PCR. As a result of confirming the size and accuracy of the cloned gene, it could be seen that the clone was all irrespective of the number of E. coli transformed, and the efficiency was very high regardless of the gene size (Table 1). It was also confirmed that it was not significantly affected by the amount of gene fragments used for cloning (Table 1). However, if the initial amount of the pJL-CLIC vector is used at 100 ng or more, there was no problem in efficiency, and in the present invention, the amount of the vector was fixed at 360 ng.

Table 1. Size of inserted genes and efficiency of modified ligation-independent cloning

Clone ID Insertion gene (bp) vector
(ng) Insertion gene
(ng) enzyme Colony count Insertion rate
(%) PcRD14
PcRD08
PcRD01
CaRGA49
CaRGA56
CaRGA06
CaRGA41
CaRGA10
CaRGA09
CaRGA01
CaRGA27 300 bp
400 bp
600 bp
1000 bp
1500 bp
2000 bp
2500 bp
2800 bp
3200 bp
3600 bp
4000 bp 360
360
360
360
360
360
360
360
360
360
360 32
18
246
80
49
50
100
50
120
45
120 T4 poly
T4 poly
T4 poly
T4 poly
T4 poly
T4 poly
T4 poly
T4 poly
T4 poly
T4 poly
T4 poly 28
34
246
25
18
51
9
40
86
231
8 99.9%
99.9%
99.9%
99.9%
99.9%
99.9%
99.9%
99.9%
99.9%
99.9%
99.9%

1 is a map of the ligation-independent cloning vector pJL-CLIC used in the present invention. The vector is a modification of the pJL-TRBO (Lindbo (2007) BMC Biotech 7: 52-62; Pl Physiol 145: 1232-1240) vector and includes a ccdB 1 (control of cell death B1) gene. pJL-CLIC vectors include the CaMV35S promoter; Replicaases; TMV 126K / 183K; MP (mobile protein); NPTII: kanamycin resistance gene; R-AP: right adapter primer; L-AP: left adapter primer; HA: contains Hemagglutinin.

2 shows a Ligation Independent Cloning (LIC) procedure. A is the preparation of PCR products for LIC. The gene of interest is amplified by PCR with a gene specific primer having a LIC sequence attached to the 5 'end. PCR products are purified and incubated with T4 DNA polymerase and dCTP to make LIC inserts with singlet 5 'overhangs. B is the preparation of LIC plasmid for cloning the gene of interest. Restriction treatment and ligation reactions to the pJL-CLIC vector produce a pJL-CLIC vector with a cassette containing two Sna BI restriction sites and an adapter. pJL-LIC vectors are cleaved with Sna BI. The linearized vector is purified and incubated with T4 DNA polymerase and dGTP to generate single 5 'terminal overhangs. C shows a process where the purified vector and the target gene (EST clone) are mixed and annealed without DNA ligase at room temperature. This mixture is transformed with E. coli strain DH5α.

3 shows the efficiency of ligation-independent cloning. A is 100% cloning efficiency of the target gene into the pJL-CLIC vector as shown by PCR amplification with colony or purified DNA of the pJL-CLIC vector (vector containing several target gene fragments) transformed with the PCR product. Shows. The size of the PCR amplification products of all colonies (or purified DNA) showed the size of the insert gene. M is DNA size marker and C is negative control DNA. B shows the transformation efficiency. Marked amount of inserted plasmid and number of colonies obtained after transformation of the LIC reaction in E. coli.

4 shows the activation of Phytophthora effector-induced cell death in Nicotiana benthamiana induced potato RB gene. Agrobacterium cultures containing phytophthora effectors and R constructs were infiltrated at OD 600 nm = 0.3. The photograph was taken 5 days after Agro infiltration.

<110> SNU R & DB FOUNDATION <120> High throughput vector for transient expression in plant and uses          the <130> PN08268 <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tcaggatcct taattaaagc caatccctct acgtaggagg atacccatac gatgttccag 60 attacgcttg atagggtacc ggt 83 <210> 2 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 accggtaccc tatcaagcgt aatctggaac atcgtatggg tatcctccta cgtagaggga 60 ttggctttaa ttaaggatcc tga 83 <210> 3 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> HA tag <400> 3 Tyr Pro Tyr Asp Val Pro Asp Tyr Ala   1 5 <210> 4 <211> 42 <212> DNA <213> Artificial Sequence <220> Cc dB-forward primer <400> 4 tgctacgtaa attctcgact aagttggcag catcacccga cg 42 <210> 5 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> ccdB-reverse primer <400> 5 cgctacgtac tcgagcagac tggctgtgta taagggagcc tg 42 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> 223 LIC forward primer <400> 6 ccaatccctc tacgaaatg 19 <210> 7 <211> 14 <212> DNA <213> Artificial Sequence <220> 223 LIC reverse primer <400> 7 tatcctccta cgat 14 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tccttaatta aagccaatcc ctctacgtaa attctcgact aagttggcag c 51 <210> 9 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tatcaagcgt aatctggaac atcgtatggg tatacgtact cgagcagact ggc 53  

Claims (8)

5 'to 3' orientation, including operably linked right adapter, SnaBI recognition site, control of cell death B1 ( ccdB 1) gene, SnaBI recognition site, left adapter and Hemagglutinin gene Ligation Independent Cloning vector, characterized in that the pJL-CLIC vector disclosed in 1. delete Cutting the vector of claim 1 with SnaBI restriction enzyme; Treating the cleaved vector with the product to be cloned with T4 DNA polymerase in a separate reaction; And Mixing each of the reactants to induce conjugation. A host cell transformed with the vector of claim 1. The host cell of claim 4, wherein the host cell is Agrobacterium . The host cell according to claim 4, which is a plant. The host cell according to claim 6, wherein the plant is a monocotyledonous or dicotyledonous plant. A method for producing a transgenic plant expressing a gene of interest comprising the step of recombining the gene of interest in the vector of claim 1 and then introducing it into plant cells.

Images