KR101069101B1 - mTOR targeting siRNA with cross-species activity, and expression vector and pharmaceutical composition comprising the same - Google Patents

mTOR targeting siRNA with cross-species activity, and expression vector and pharmaceutical composition comprising the same Download PDF

Info

Publication number
KR101069101B1
KR101069101B1 KR1020090110639A KR20090110639A KR101069101B1 KR 101069101 B1 KR101069101 B1 KR 101069101B1 KR 1020090110639 A KR1020090110639 A KR 1020090110639A KR 20090110639 A KR20090110639 A KR 20090110639A KR 101069101 B1 KR101069101 B1 KR 101069101B1
Authority
KR
South Korea
Prior art keywords
cancer
mtor
sirna
disease
carcinoma
Prior art date
Application number
KR1020090110639A
Other languages
Korean (ko)
Other versions
KR20100062914A (en
Inventor
이희란
김승후
안정현
김성진
이휘선
이윤선
Original Assignee
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 울산대학교 산학협력단 filed Critical 울산대학교 산학협력단
Priority to PCT/KR2009/007175 priority Critical patent/WO2010064851A2/en
Publication of KR20100062914A publication Critical patent/KR20100062914A/en
Application granted granted Critical
Publication of KR101069101B1 publication Critical patent/KR101069101B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 종간 교차활성을 지닌 mTOR을 표적으로 하는 siRNA, 이를 포함하는 재조합벡터 및 이를 유효성분으로 함유하는 약학조성물에 관한 것으로, 상기 mTOR 표적 siRNA는 mTOR 유전자의 일부와 상보적인 서열을 가짐으로써, mTOR 유전자의 mRNA를 분해하거나, 번역을 억제할 수 있기 때문에 mTOR을 표적으로 하는 다양한 질환, 예를들어 암, 신경변성질환, 면역질환, 감염질환, 노화, 심장질환, 간질환 및 크론병으로 이루어진 군에서 선택된 질환, 특히 암질환을 예방하거나 치료할 수 있다.The present invention relates to siRNA targeting mTOR having cross-linking activity, a recombinant vector comprising the same, and a pharmaceutical composition containing the same as an active ingredient.The mTOR target siRNA has a sequence complementary to a part of the mTOR gene, Because it can degrade mRNA or inhibit translation of mTOR gene, it is composed of various diseases that target mTOR, such as cancer, neurodegenerative disease, immune disease, infectious disease, aging, heart disease, liver disease and Crohn's disease. Diseases selected from the group, in particular cancer diseases, can be prevented or treated.

mTOR, siRNA, 재조합벡터, 약학조성물, 암질환 mTOR, siRNA, recombinant vector, pharmaceutical composition, cancer disease

Description

종간 교차활성을 지닌 mTOR을 표적으로 하는 siRNA, 이를 포함하는 재조합벡터 및 이를 함유하는 약학조성물{mTOR targeting siRNA with cross-species activity, and expression vector and pharmaceutical composition comprising the same}MIR targeting siRNA with cross-species activity, and expression vector and pharmaceutical composition comprising the same}

본 발명은 mTOR을 표적으로 하는 다양한 질환, 예를들어 암, 신경변성질환, 면역질환, 감염질환, 노화, 심장질환, 간질환 및 크론병으로 이루어진 군에서 선택된 질환, 특히 암질환을 예방하거나 치료할 수 있는, 종간 교차활성을 지닌 mTOR을 표적으로 하는 siRNA, 이를 포함하는 재조합벡터 및 이를 유효성분으로 함유하는 약학조성물에 관한 것이다.The present invention is to prevent or treat a variety of diseases targeting mTOR, for example, cancer, neurodegenerative diseases, immune diseases, infectious diseases, aging, heart disease, liver disease and Crohn's disease, in particular cancer disease The present invention relates to siRNAs targeting mTOR having cross-linking activity, a recombinant vector comprising the same, and a pharmaceutical composition containing the same as an active ingredient.

mTOR(포유동물의 라파마이신 표적; mammalian Target of rapamycin)은 사이토카인-자극 세포 증식, 세포주기의 G1 위상을 조절하는 몇몇 중요 단백질을 위한 mRNA의 번역(translation), 및 인터루킨-2(IL-2) 유도 전사(transcription)를 포함하는, 다양한 신호 전환 경로에 있어서 중요한 효소이다. mTOR (mammalian Target of rapamycin) is a cytokine-stimulated cell proliferation, translation of mRNA for several important proteins that regulate G1 phase of the cell cycle, and interleukin-2 (IL-2) ) Is an important enzyme in a variety of signal transduction pathways, including induced transcription.

mTOR의 억제는 세포주기의 G1으로부터 S까지의 진행의 억제를 야기한다. 스트렙토마이세스 히그로스코피커스(Streptomyces hygroscopicus)에 의해 제조된 항 생제인 라파마이신(SirolimusTM으로서 상업적으로 이용가능함)은 중요한 mTOR 억제제로 밝혀져 있다.Inhibition of mTOR causes inhibition of progression from G1 to S in the cell cycle. The antibiotic rapamycin (commercially available as Sirolimus ) manufactured by Streptomyces hygroscopicus has been found to be an important mTOR inhibitor.

mTOR 억제제는 면역억제, 항증식 및 항암 활성을 나타내므로, 이러한 질환의 치료를 위하여 mTOR이 표적으로 되고 있다(Current Opinion in Lipidology, 16: 317-323, 2005). 또, mTOR은 자가소화(autophage) 조절에 중요한 인자로서, 자가소화 경로를 조절하는 mTOR을 표적으로 하여 다양한 질환 예를들어, 암, 신경변성 질환, 심장 질환, 노화, 면역질환, 감염 질환 및 크론병 등을 치료할 수 있다(Immunology, 7: 767-777; Nature 451: 1069-1075, 2008). Since mTOR inhibitors exhibit immunosuppressive, antiproliferative and anticancer activity, mTOR is targeted for the treatment of these diseases (Current Opinion in Lipidology, 16: 317-323, 2005). In addition, mTOR is an important factor in regulating autophage, and targets mTOR that regulates the autophagy pathway, thereby targeting various diseases such as cancer, neurodegenerative diseases, heart disease, aging, immune diseases, infectious diseases and Crohn's disease. Diseases and the like can be treated (Immunology, 7: 767-777; Nature 451: 1069-1075, 2008).

한편, 리보핵산 매개 간섭현상(RNAi)은 21-25개의 뉴클레오타이드 크기의 이중나선 구조를 가진 작은 간섭 리보핵산이 상보적인 서열을 가지는 전사체(mRNA transcript)에 특이적으로 결합하여 해당 전사체를 분해하여 특정 단백질의 발현을 억제하는 현상이다. 최근 이 리보핵산 매개 간섭현상이 기존의 화학 합성 의약 개발에서 발생되는 문제의 해결책을 제시하면서 전사체 수준에서 특정 단백질의 발현을 선택적으로 억제하여 각종 질병 치료제, 특히 종양 치료제 개발에 이용하려는 연구가 진행되고 있다. On the other hand, ribonucleic acid mediated interference phenomenon (RNAi) is a small interference ribonucleic acid having a double-helix structure of 21-25 nucleotides, specifically binding to a transcript having a complementary sequence (mRNA transcript) to degrade the transcript. This is the phenomenon of inhibiting the expression of a specific protein. In recent years, studies on the use of ribonucleic acid-mediated interference phenomena in the development of chemical synthetic medicines have been conducted to selectively inhibit the expression of specific proteins at the transcript level and to use them in the development of various therapeutic drugs, especially tumor therapies. It is becoming.

작은 분자량의 화학 약물(small molecule chemical drugs)의 경우 특정한 단백질 표적에 최적화되기까지 오랜 동안의 개발 기간 및 개발 비용이 소요되는 반면, 리보핵산 매개 간섭현상을 이용한 siRNA 의약의 가장 큰 장점은 의약화가 불가능한 표적 물질을 포함한 모든 단백질 표적에 대하여 최적화된 리드 화합물의 개발 이 신속히 진행될 수 있다는 것이다. Small molecule chemical drugs require long development time and development costs to be optimized for specific protein targets, while the biggest advantage of siRNA medicine using ribonucleic acid mediated interference is that The development of optimized read compounds for all protein targets, including the target material, can proceed quickly.

단백질이나 항체 약물이 복잡한 제조공정으로 생산의 어려움을 겪는데 반해 siRNA는 합성 및 분리정제의 용이성으로 대량생산이 비교적 쉽고, 핵산 소재의 특징상 단백질 의약보다 보관상 안정성이 높은 장점이 있다. 또한 기존의 약물과는 달리 특정 분자 표적에 오직 길항작용만 할 수 있다는 점 등 여러 장점에 기반하여 새로운 의약 후보군으로서 부상하고 있다.While protein and antibody drugs suffer from a complicated manufacturing process, siRNA is relatively easy to mass-produce due to its ease of synthesis and separation and purification, and has a higher storage stability than protein drugs due to the characteristics of nucleic acid materials. In addition, unlike conventional drugs, it is emerging as a new drug candidate based on several advantages, such as being able to antagonize specific molecular targets only.

본 발명자는 다양한 질환의 표적으로 알려져 있는 mTOR 유전자의 일부와 상보적인 서열을 가짐으로써, mTOR 유전자의 mRNA를 분해하거나, 번역을 억제할 수 있는 종간 교차활성을 지닌 siRNA를 개발하여 본 발명을 완성하였다.The present inventors have a sequence complementary to a portion of the mTOR gene known as targets of various diseases, thereby completing the present invention by developing siRNA having cross-linking activity that can degrade mRNA or inhibit translation of mTOR gene. .

따라서, 본 발명의 목적은 다양한 질환의 표적으로 알려진 mTOR 유전자의 발현을 억제할 수 있는 종간 교차활성을 지닌 mTOR 표적 siRNA, 상기 siRNA를 포함하는 재조합벡터 및 상기 siRNA를 유효성분으로 포함하는 약학조성물을 제공하는 데에 있다.Accordingly, an object of the present invention is to provide a mTOR target siRNA, a recombinant vector comprising the siRNA and a pharmaceutical composition comprising the siRNA as an active ingredient having an interstitial cross-linking activity that can suppress the expression of mTOR genes known as targets for various diseases. To provide.

또한, 본 발명의 다른 목적은 mTOR 유전자의 발현을 억제할 수 있는 종간 교차활성을 지닌 mTOR 표적 siRNA를 유효성분으로 포함하는 암질환 치료 및 예방용 약학조성물을 제공하는 데에 있다.In addition, another object of the present invention to provide a pharmaceutical composition for the treatment and prevention of cancer diseases comprising mTOR target siRNA having an interspecies cross-activity that can inhibit the expression of mTOR gene as an active ingredient.

상기 목적을 달성하기 위하여, 본 발명은 서열번호 1 내지 서열번호 4 중에서 선택된 어느 하나의 염기서열을 갖는 siRNA를 제공한다.In order to achieve the above object, the present invention provides an siRNA having any one nucleotide sequence selected from SEQ ID NO: 1 to SEQ ID NO: 4.

본 발명에서 mTOR을 표적으로 하는 siRNA는 인간, 원숭이, 랫트의 mTOR 유전자의 일부와 100% 상보적인 서열을 가지고, mTOR 유전자의 mRNA를 분해하거나, 번역을 억제할 수 있다. 상보성이 80-90%인 경우에는 mRNA의 번역을 억제할 수 있고, 100%인 경우에는 mRNA를 분해시킬 수 있다. SiRNA targeting mTOR in the present invention has a sequence 100% complementary to a part of the mTOR gene of humans, monkeys, and rats, and can degrade mRNA or inhibit translation of the mTOR gene. Complementarity of 80-90% can inhibit the translation of mRNA, and 100% can degrade mRNA.

또한, 본 발명에 따른 mTOR을 표적으로 하는 siRNA는 서열번호 1 내지 서열 번호 4로 표시되는 염기서열과 80%, 바람직하게는 90%, 보다 바람직하게는 100%의 상동성을 갖는 염기서열을 포함할 수 있다. 상기 각각의 염기서열은 5 내지 15bp의 루프 영역에 의해 회문적으로 연결되어 헤어핀 구조를 형성할 수도 있다.In addition, siRNA targeting mTOR according to the present invention comprises a nucleotide sequence having a homology of 80%, preferably 90%, more preferably 100% with the nucleotide sequence represented by SEQ ID NO: 1 to SEQ ID NO: 4 can do. Each base sequence may be linked to each other by a loop region of 5 to 15bp to form a hairpin structure.

본 발명의 siRNA는 당업계에 공지된 RNA 분자의 제조방법에 따라 제조할 수 있다. RNA 분자의 제조방법으로는 화학적 합성 방법 및 효소적 방법을 사용할 수 있다. 예를 들면, RNA 분자의 화학적 합성은 문헌에 개시되어 있는 방법을 사용할 수 있으며(Verma and Eckstein, Annu. Rev. Biochem. 67, 99-134, 1999), RNA 분자의 효소적 합성은 T7, T3 및 SP6 RNA 폴리머라제와 같은 파아지 RNA 폴리머라제를 이용하는 방법이 문헌에 개시되어 있다(Milligan and Uhlenbeck, Methods Enzymol. 180: 51-62, 1989).The siRNA of the present invention can be prepared according to the preparation method of RNA molecules known in the art. As a method for preparing RNA molecules, chemical synthesis methods and enzymatic methods can be used. For example, the chemical synthesis of RNA molecules can use the methods described in the literature (Verma and Eckstein, Annu. Rev. Biochem. 67, 99-134, 1999), and the enzymatic synthesis of RNA molecules is T7, T3. And phage RNA polymerases such as SP6 RNA polymerase are disclosed in the literature (Milligan and Uhlenbeck, Methods Enzymol. 180: 51-62, 1989).

또한, 본 발명은 서열번호 1 내지 서열번호 4 중에서 선택된 어느 하나의 염기서열을 갖는 siRNA를 포함하는 재조합벡터를 제공한다.The present invention also provides a recombinant vector comprising an siRNA having any one base sequence selected from SEQ ID NO: 1 to SEQ ID NO: 4.

상기 재조합벡터는 도 1에 도시된 개열지도를 나타내며, 바람직하게는 pSP72-scAAV-GFP-mTOR이다.The recombinant vector shows a cleavage map shown in Figure 1, preferably pSP72-scAAV-GFP-mTOR.

본 발명의 재조합벡터는 당해 분야에 공지된 재조합 DNA 방법에 의해 제조될 수 있다.Recombinant vectors of the present invention can be prepared by recombinant DNA methods known in the art.

본 발명에서 mTOR에 대한 siRNA를 전달하기에 유용한 바이러스 또는 바이러스 벡터로는 바쿨로비리디애(baculoviridiae), 파르보비리디애(parvoviridiae), 피코르노비리디애(picornoviridiae), 헤레페스비리디애(herepesviridiae), 폭스비리디애(poxviridiae), 아데노비리디애(adenoviridiae) 등이 있지만, 이에 제한되는 것은 아니다.Viral or viral vectors useful for delivering siRNA to mTOR in the present invention include baculoviridiae, parvoviridiae, picornoviridiae, herpesviridiae, Poxviridiae, adenoviridiae, and the like, but are not limited thereto.

본 발명에서는 아데노 부속 바이러스(Adeno Associated Virus, AAU)를 이용하는 것이 가장 바람직하다. 아데노 부속 바이러스는 면역반응과 세포독성을 거의 유발하지 않는다. 특히, 아데노 부속 바이러스 혈청형 2(serotype 2)는 CNS의 신경세포로 효율적인 유전자 전달을 할 수 있으며, 또한 신경계에서 형질전환 유전자(transgene)를 효과적으로 장기간 발현할 수 있다.In the present invention, it is most preferable to use an Adeno Associated Virus (AAU). Adeno-associated viruses rarely cause immune responses and cytotoxicity. In particular, adeno-associated virus serotype 2 can efficiently deliver genes to neurons of the CNS, and also can efficiently express transgenes in the nervous system for a long time.

또한, 본 발명에서 mTOR에 대한 siRNA를 전달하기에 유용한 비바이러스 벡터로는 전술한 바이러스 벡터를 제외한 통상적으로 유전자 요법에 사용되는 모든 벡터를 포함하며, 예를들어 진핵세포에서 발현 가능한 다양한 플라스미드 및 리포좀 등이 있다.In addition, non-viral vectors useful for delivering siRNA for mTOR in the present invention include all vectors commonly used for gene therapy, except for the aforementioned viral vectors, for example, various plasmids and liposomes that can be expressed in eukaryotic cells. Etc.

한편, 본 발명에서 mTOR을 표적으로 하는 siRNA는 전달된 세포에서 적절히 전사되기 위하여 적어도 프로모터에 작동가능하게 연결되는 것이 바람직하다. 상기 프로모터는 진핵세포에서 기능할 수 있는 프로모터라면 어떤 것이든지 무방하나, 사람 H1 폴리머라제-III 프로모터가 보다 바람직하다. mTOR을 표적으로 하는 siRNA의 효율적인 전사를 위하여 필요에 따라 리더 서열, 폴리아데닐화 서열, 프로모터, 인핸서, 업스트림 활성화 서열, 신호 펩타이드 서열 및 전사 종결인자를 비롯한 조절서열을 추가로 포함할 수도 있다. Meanwhile, in the present invention, siRNA targeting mTOR is preferably operably linked to at least a promoter in order to be properly transcribed in delivered cells. The promoter may be any promoter capable of functioning in eukaryotic cells, but a human H1 polymerase-III promoter is more preferable. For efficient transcription of siRNA targeting mTOR it may further comprise regulatory sequences, including leader sequence, polyadenylation sequence, promoter, enhancer, upstream activation sequence, signal peptide sequence and transcription terminator.

또한, 본 발명은 서열번호 1 내지 서열번호 4 중에서 선택된 어느 하나의 염기서열을 갖는 siRNA를 유효성분으로 함유하는 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition containing siRNA having any one of nucleotide sequences selected from SEQ ID NO: 1 to SEQ ID NO: 4 as an active ingredient.

상기 약학조성물은 암, 신경변성질환, 면역질환, 감염질환, 노화, 심장질환, 간질환 및 크론병으로 이루어진 군에서 선택된 질환을 예방하거나 치료할 수 있다.The pharmaceutical composition may prevent or treat a disease selected from the group consisting of cancer, neurodegenerative disease, immune disease, infectious disease, aging, heart disease, liver disease and Crohn's disease.

또한, 본 발명은 서열번호 1 내지 서열번호 4 중에서 선택된 어느 하나의 염기서열을 갖는 siRNA를 유효성분으로 함유하는 암질환 치료 및 예방용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for the treatment and prevention of cancer diseases, containing as an active ingredient siRNA having any one selected from SEQ ID NO: 1 to SEQ ID NO: 4.

상기 암질환은 간암, 폐암, 비소세포성폐암, 결장암, 골암, 췌장암, 피부암, 두부 또는 경부 암, 피부 또는 안구내 흑색종, 자궁암, 난소암, 직장암, 위암, 항문부근암, 결장암, 유방암, 나팔관암종, 자궁내막암종, 자궁경부암종, 질암종, 음문암종, 호지킨병(Hodgkin's disease), 식도암, 소장암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 방광암, 신장 또는 수뇨관 암, 신장세포 암종, 신장골반 암종, 중추신경계 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 및 뇌하수체 선종으로 이루어진 군에서 선택된 하나 이상의 암질환을 예방하거나 치료할 수 있다.The cancer diseases include liver cancer, lung cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, gastric cancer, anal muscle cancer, colon cancer, breast cancer, Fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, Prostate cancer, chronic or acute leukemia, lymphocyte lymphoma, bladder cancer, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary CNS lymphoma, spinal cord tumor, brain stem glioma and pituitary adenoma Abnormal cancer disease can be prevented or treated.

본 발명에 따른 mTOR 표적 siRNA를 약학조성물로 사용할 경우에는 약학조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 또는 희석제를 더 포함할 수 있다. When the mTOR target siRNA according to the present invention is used as a pharmaceutical composition, it may further include a suitable carrier, excipient or diluent commonly used in the preparation of the pharmaceutical composition.

본 발명에서 사용가능한 담체, 부형제 또는 희석제로는, 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등을 들 수 있다.Carriers, excipients or diluents usable in the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.

상기 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.The compositions can be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral formulations, suppositories, and sterile injectable solutions, respectively, according to conventional methods.

제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 화합물은 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제한다. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and the solid form preparations include at least one excipient such as starch, calcium carbonate, sucrose ( Prepare by mixing sucrose or lactose, gelatin, etc.

또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. .

비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

상기 조성물의 사용량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으나, 0.1 내지 2.0 ㎎/㎏의 양을 일일 1회 내지 수회 투여할 수 있다. The amount of the composition may vary depending on the age, sex, and weight of the patient, but the amount of 0.1 to 2.0 mg / kg may be administered once to several times daily.

또한, 이러한 조성물의 투여량은 투여경로, 질병의 정도, 성별, 체중, 나이 등에 따라서 증감될 수 있다.  따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.In addition, the dosage of such compositions may be increased or decreased depending on the route of administration, the severity of the disease, sex, weight, age, and the like. Thus, the dosage amounts are not intended to limit the scope of the invention in any manner.

상기 조성물은 쥐, 생쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내(intracerebroventricular)주사에 의해 투여될 수 있다.The composition can be administered to mammals such as mice, mice, livestock, humans, and the like by various routes. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

본 발명에 따른 mTOR을 표적으로 하는 siRNA는 다양한 종 예를들어 인간, 원숭이 및 랫트의 mTOR 유전자의 일부와 상보적인 서열을 가짐으로써, mTOR 유전자의 mRNA를 분해하거나, 번역을 억제할 수 있기 때문에 mTOR을 표적으로 하는 다양한 질환, 예를들어 암, 신경변성질환, 면역질환, 감염질환, 노화, 심장질환, 간질환 및 크론병으로 이루어진 군에서 선택된 질환, 특히 암질환을 예방하거나 치료할 수 있다.The siRNA targeting mTOR according to the present invention has a sequence complementary to a portion of mTOR genes of various species, for example, humans, monkeys, and rats, thereby degrading mRNA or inhibiting translation of mTOR genes. It can prevent or treat a variety of diseases, for example cancer, neurodegenerative diseases, immune diseases, infectious diseases, aging, heart disease, liver disease and Crohn's disease, especially cancer diseases.

본 발명의 이해를 돕기 위하여 바람직한 실시예를 하기에 제시한다. 그러나 이러한 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐 본 발명이 하기의 실시예에 한정되는 것은 아니다.Preferred examples are provided below to aid in the understanding of the present invention. However, these examples are only provided to more easily understand the present invention, the present invention is not limited to the following examples.

<실시예 1> siRNA의 설계Example 1 Design of siRNA

다양한 종의 mTOR에서의 완전 보존 서열 패턴(completely conserved squence pattern)으로부터 표적 서열을 선정하였다. 이때, 사용된 종은 인간(LOCUS: NM_004958), 원숭이(XR_014791), 랫트(NM_019906) 및 마우스(NM_020009)를 포함한다.Target sequences were selected from a completely conserved squence pattern in various species of mTOR. At this time, the species used include human (LOCUS: NM_004958), monkey (XR_014791), rat (NM_019906) and mouse (NM_020009).

효과적인 siRNA의 설계를 위하여, MWG Biotech AG 소프트웨어 (www.mwgbiotech.com) 또는 CAPSID(Convenient Application Program for siRNA Design)라고 하는 교내에서 개발된 siRNA 설계 소프트웨어를 이용하였다. For the design of effective siRNAs, siRNA design software developed in-house, called MWG Biotech AG software (www.mwgbiotech.com) or CAPSID (Convenient Application Program for siRNA Design) was used.

siRNA의 서열을 결정한 후, 비특이적인 대조군 siRNA를 Bioneer (Seoul, Korea)으로부터 구입하였다. siRNA 이중가닥 올리고뉴클레오타이드는 제조업자에 의해 지시된 바에 따라 뉴클레아제가 없는 물에 재현탁하였다. 세포로 형질감염 효율을 조사하기 위하여 Cy3-형광 염료로 표지된 비특이적인 siRNA가 대조군으로서 이용되었다. 본 실시예에서 이용된 모든 siRNA의 서열은 표 1과 같다.After determining the siRNA sequence, nonspecific control siRNA was purchased from Bioneer (Seoul, Korea). siRNA double stranded oligonucleotides were resuspended in nuclease-free water as directed by the manufacturer. Nonspecific siRNAs labeled with Cy3-fluorescent dye were used as controls to investigate transfection efficiency into cells. The sequences of all siRNAs used in this example are shown in Table 1.

siRNAsiRNA 표적서열(5'→3')Target sequence (5 '→ 3') 시작start siRNA-점수siRNA-score 서열번호SEQ ID NO: mTOR-1mTOR-1 GGAGUCUACUCGCUUCUAUGGAGUCUACUCGCUUCUAU 253253 9.59.5 1One mTOR-2mTOR-2 GAAGAAGGUCACUGAGGAUGAAGAAGGUCACUGAGGAU 56775677 99 22 mTOR-3mTOR-3 ACAACCUCCAGGAUACACUACAACCUCCAGGAUACACU 57725772 8.58.5 33 mTOR-4mTOR-4 GAAUGUUGACCAAUGCUAUGAAUGUUGACCAAUGCUAU 72217221 1313 44

<실시예 2> 세포 배양 및 형질감염Example 2 Cell Culture and Transfection

HeLa, Vero 및 H9C2 세포는 ATCC(American Type Culture Collection)으로부터 구매하였다. 상기 세포는 5% CO2 배양기에서 37℃에서 10% FBS(fetal bovine serum), 글루타맥스-1(2mM), 페니실린(100 IU/ml) 및 스트렙토마이신(50㎍/ml)으로 보충된 DMEM(Dulbecco's modified Eagle's medium; Gibco BRL, Carlsbad, CA) 배지에서 배양하였다.HeLa, Vero and H9C2 cells were purchased from the American Type Culture Collection (ATCC). The cells were supplemented with 10% FBS (fetal bovine serum), glutamax-1 (2 mM), penicillin (100 IU / ml) and streptomycin (50 μg / ml) at 37 ° C. in a 5% CO 2 incubator. (Dulbecco's modified Eagle's medium; Gibco BRL, Carlsbad, Calif.) Medium.

일시적인 형질감염을 위하여, 무혈청 상태에서 올리고펙타민 시약(Invitrogen)을 이용하여 세포를 100nM siRNA으로 4시간 동안 배양한 후, 10% 혈청을 함유한 신선한 배지를 첨가하였다. 추가 실험을 위해 형질감염 24시간 후 세포를 수확하였다.For transient transfection, cells were incubated with 100 nM siRNA for 4 hours using oligofectamine reagent (Invitrogen) in the serum-free state, followed by addition of fresh medium containing 10% serum. Cells were harvested 24 hours after transfection for further experiments.

<실시예 3> Real-time RT-PCRExample 3 Real-time RT-PCR

총 RNA는 HeLa, Vero 및 H9C2 세포로부터 트리졸 시약(Invitrogen, Carlsbad, CA)을 이용하여 추출하였다. 역전사(RT)는 올리고-dT 프라이머(Invitrogen)를 이용하여 55℃에서 슈퍼스크립트 III(Invitrogen, Carlsbad, CA)로 수행하였다. 합성된 cDNA는 iQ SYBR 그린 수퍼믹스(Bio-rad, Hercules, CA)를 이용하여 real-time RT-PCR에 의해 증폭되었다.Total RNA was extracted from HeLa, Vero and H9C2 cells using Trizol reagent (Invitrogen, Carlsbad, Calif.). Reverse transcription (RT) was performed with Superscript III (Invitrogen, Carlsbad, Calif.) At 55 ° C. using oligo-dT primer (Invitrogen). Synthesized cDNA was amplified by real-time RT-PCR using iQ SYBR Green Supermix (Bio-rad, Hercules, CA).

상기 반응은 폴리머라아제 활성화를 위한 95℃에서 3분, 및 [95℃에서 15초(변성), 60℃에서 30초(어닐링), 72℃에서 30초(연장)]의 39회 주기로 구성되었다. β-액틴은 상대적인 유전자 발현의 정도를 평가하기 위한 정상 대조군으로 사용되었다. The reaction consisted of 39 cycles of 3 minutes at 95 ° C. for polymerase activation and [15 seconds at 95 ° C. (denature), 30 seconds at 60 ° C. (annealing), 30 seconds at 72 ° C. (extended)]. . β-actin was used as a normal control to assess the relative degree of gene expression.

이때, 사용된 프라이머는 랫트-mTOR-센스 및 안티센스 프라이머(서열번호 5 및 6), 인간-mTOR-센스 및 안티센스 프라이머(서열번호 7 및 8), 일반 β-액틴-센스 및 안티센스 프라이머(서열번호 9 및 10)였고, 원숭이 mTOR 프라이머는 인간의 것과 동일하였다. At this time, the primers used were rat-mTOR-sense and antisense primers (SEQ ID NOs 5 and 6), human-mTOR-sense and antisense primers (SEQ ID NOs 7 and 8), general β-actin-sense and antisense primers (SEQ ID NO: 9 and 10), and monkey mTOR primers were identical to those of humans.

상대적인 유전자 발현은 GeneXpression Macro chromo4 software(Bio-Rad)에 의해 평가되었다. 그 결과, 도 1의 상단과 같이 4종의 siRNA 모두 HeLa 세포주에서 mTOR mRNA 발현을 억제하였고, 도 3a 및 도 3b와 같이 Vero 세포주 및 H9C2 세포주에서도 역시 mTOR mRNA 발현을 억제하였다.Relative gene expression was assessed by GeneXpression Macro chromo4 software (Bio-Rad). As a result, all four siRNAs suppressed mTOR mRNA expression in HeLa cell lines as shown in the upper part of FIG. 1, and also suppressed mTOR mRNA expression in Vero cell lines and H9C2 cell lines as shown in FIGS. 3A and 3B.

<실시예 4> 웨스턴 블롯 분석Example 4 Western Blot Analysis

세포를 회수하여 100㎕의 용균 완충용액(Intron, Seoul, Korea)으로 용균하The cells were recovered and lysed with 100 μl of lysis buffer (Intron, Seoul, Korea).

였다. 용균물은 5X 시료 완충용액과 함께 100℃에서 5분간 끓여주고 변성 단백질은 10% SDS-폴리아크릴아미드 겔 전기영동(SDS-PAGE)에 의해 분리한 후 semi-drier(Bio-Rad)를 이용하여 20V에서 30분간 PVDF 멤브레인으로 전달시켰다.It was. The lysate was boiled with 5X sample buffer at 100 ° C for 5 minutes and the denatured protein was separated by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and then semi-drier (Bio-Rad) was used. Transfer to PVDF membrane at 20V for 30 minutes.

실온에서 1시간 동안 블록 용액(0.4 % Tween 20 및 5 % dry milk in PBS)으로 처리한 후 멤브레인을 일차 항체: mTOR (1:1000, Cell signaling, Boston, MA), β-actin(1:5000, Sigma, St. Louis, MI) 및 GFP (1:1000, Santa Cruz)와 하룻밤 동안 정치하였다. PBST 또는 TBST로 세척한 후 호스 라디쉬 퍼옥시다제가 접합된 이차 항체(Jackson laboratory)는 적용되었고 블롯은 개선된 화학발광 시약(Pierce Biotechnology, Rockford, IL)으로 발현시켰다. After treatment with block solution (0.4% Tween 20 and 5% dry milk in PBS) for 1 hour at room temperature, the membrane was treated with primary antibodies: mTOR (1: 1000, Cell signaling, Boston, MA), β-actin (1: 5000). , Sigma, St. Louis, MI) and GFP (1: 1000, Santa Cruz) overnight. After washing with PBST or TBST, a secondary antibody (Jackson laboratory) conjugated with horse radish peroxidase was applied and the blot was expressed with an improved chemiluminescent reagent (Pierce Biotechnology, Rockford, IL).

그 결과, 도 1의 하단과 같이 4종의 siRNA 모두 HeLa 세포주에서 mTOR 단백질 발현을 억제하였고, 도 3a 및 도 3b와 같이 Vero 세포주 및 H9C2 세포주에서도 역시 mTOR 단백질 발현을 억제하였다.As a result, all four siRNAs suppressed mTOR protein expression in HeLa cell lines as shown in the lower part of FIG. 1, and also inhibited mTOR protein expression in Vero cell lines and H9C2 cell lines as shown in FIGS. 3A and 3B.

<실시예 5> 플로우 사이토메트릭 분석Example 5 Flow Cytometry Analysis

mTOR 발현을 웨스턴 블롯 분석 이외의 다른 방법으로 분석하기 위하여, 플로우 사이토메트릭 분석을 수행하였다. 플로우 사이토메트리를 위해서는, 세포를 모으고, PBS에 용해된 4% 파라포름알데히드로 고정하였다. 0.05% TritonX-100로 투과한 후, 세포를 mTOR 프라머리(Cell Signaling, Boston, MA) 및 FITC-접합 2차 항체(in 1% BSA)로 배양하였다. 그후, 표식세포를 플로우사이토메트리(FACSCalibur, Becton Dickinson, San Jose, CA)에 의해 분석하였다.Flow cytometric analysis was performed to analyze mTOR expression by methods other than Western blot analysis. For flow cytometry, cells were pooled and fixed in 4% paraformaldehyde dissolved in PBS. After permeation with 0.05% TritonX-100, cells were incubated with mTOR primers (Cell Signaling, Boston, Mass.) And FITC-conjugated secondary antibody (in 1% BSA). Marker cells were then analyzed by flow cytometry (FACSCalibur, Becton Dickinson, San Jose, Calif.).

그 결과, 도 2에 도시된 바와 같이 4종의 siRNA 모두 mTOR 유전자를 넉다운 시켰다.As a result, as shown in Figure 2 all four siRNA knocked down the mTOR gene.

<실시예 6> mTOR shRNA를 발현하는 재조합 벡터의 구축Example 6 Construction of Recombinant Vector Expressing mTOR shRNA

6-1: pSP72-pH1의 작제 6-1: Construction of pSP72-pH1

shRNA 발현을 위한 프로모터로서 사람 H1 폴리머라제 -III 프로모터 (pH1)는 PCR을 기반으로 한 방법에 의해 증폭되었다. 즉, pH1의 서열은 HeLa 세포로부터 분리된 사람의 지노믹 DNA로부터 프라이머 5'-CCA TGG AAT TCG AAC GCT GA-3' (서열번호: 11) 및 5'-GGG AAA GAG TGG TCT CAT AC-3'(서열번호: 12)를 이용하여 PCR에 의해 증폭되었다. 이렇게 증폭된 PCR 산물을 주형으로 센스 프라이머 (EcoRI 링커)5'-ATC GAA TTC ATA TTT GCA TGT CGC TAT GTG-3'(서열번호: 13) 및 안티센스 프라이머(BamHI 링커)5'-ATC GGA TCC GAG TGG TCT CAT ACA GAAC-3'(서열번호: 14)를 이용하여 이차 PCR을 실시하였다. PCR 산물은 EcoRI/BamHI으로 소화시킨 후 아가로스 겔로부터 분리하였다. 그 다음 클로닝 벡터 pSP72 (Promega, Madison, WI)의 EcoRI/BamHI 위치로 클로닝하여 pSP72-pH1을 제조하였다.Human H1 polymerase-III promoter (pH1) as a promoter for shRNA expression was amplified by PCR based methods. That is, the sequence of pH1 is primer 5'-CCA TGG AAT TCG AAC GCT GA-3 '(SEQ ID NO: 11) and 5'-GGG AAA GAG TGG TCT CAT AC-3 from human genomic DNA isolated from HeLa cells. (SEQ ID NO: 12) was amplified by PCR. The PCR product thus amplified was used as a template for sense primer (EcoRI linker) 5'-ATC GAA TTC ATA TTT GCA TGT CGC TAT GTG-3 '(SEQ ID NO: 13) and antisense primer (BamHI linker) 5'-ATC GGA TCC GAG Secondary PCR was performed using TGG TCT CAT ACA GAAC-3 '(SEQ ID NO: 14). PCR products were digested with EcoRI / BamHI and isolated from agarose gels. PSP72-pH1 was then made by cloning to the EcoRI / BamHI position of the cloning vector pSP72 (Promega, Madison, Wis.).

6-2: pSP72-pH1-shmTOR#1 또는 pSP72-pH1-shmTOR#4 의 작제6-2: Construction of pSP72-pH1-shmTOR # 1 or pSP72-pH1-shmTOR # 4

서열번호 1 또는 서열번호 4의 mTOR를 표적으로 하는 siRNA 'mTOR sh #1' 또는 'mTOR sh #4'가 BamHI 및 HindIII 5'- 또는 3'- 오버행을 포함하도록 작제한 후 pSP72-pH1 벡터에 라이게이션하여 siRNA 'mTOR sh #1' 또는 'mTOR sh #4'를 제조하였다. mTOR sh #1를 위한 BamHI 링커를 갖는 센스 프라이머 서열은 5'-GATCC GGAGTCTACTCGCTTCTAT TTCAAGAGA ATAGAAGCGAGTAGACTCC TTTTTT GGAAA-3'(서열번호: 15)이며, HindIII 링커를 갖는 안티센스 프라이머 서열은 5'-AGCTT TTCC AAAAAA GGAGTCTACTCGCTTCTAT TCTCTTGAA ATAGAAGCGAGTAGACTCC G-3'(서열번호: 16)이다. 또한, mTOR sh #4 를 위한 BamHI 링커를 갖는 센스 프라이머 서열은 5'-GATCC GAATGTTGACCAATGCTAT TTCAAGAGA ATAGCATTGGTCAACATTC TTTTTT GGAAA-3'(서열번호: 17)이며, HindIII 링커를 갖는 안티센스 프라이머 서열은 5'-AGCTT TTCC AAAAAA GAATGTTGACCAATGCTAT TCTCTTGAA ATAGCATTGGTCTTCTTTC G-3'(서열번호: 18)이다. 상기 서열에 있어서 mTOR 유전자에 특이적인 뉴클레오타이드는 밑줄로 표시하였고 루프 구조는 굵은체로 나타내었다.SiRNA 'mTOR sh # 1' or 'mTOR sh # 4' targeting mTOR of SEQ ID NO: 1 or SEQ ID NO: 4 was constructed to include BamHI and HindIII 5'- or 3'- overhangs and then added to the pSP72-pH1 vector Ligation to prepare siRNA 'mTOR sh # 1' or 'mTOR sh # 4'. The sense primer sequence with BamHI linker for mTOR sh # 1 is 5'-GATCC GGAGTCTACTCGCTTCTAT TTCAAGAGA ATAGAAGCGAGTAGACTCC TTTTTT GGAAA-3 '(SEQ ID NO: 15), and the antisense primer sequence with HindIII linker is 5'-AGCTT TTCC AAAATCTC ATAGAAGCGAGTAGACTCC G-3 '(SEQ ID NO .: 16). In addition, the sense primer sequence with BamHI linker for mTOR sh # 4 is 5'-GATCC GAATGTTGACCAATGCTAT TTCAAGAGA ATAGCATTGGTCAACATTC TTTTTT GGAAA-3 '(SEQ ID NO: 17), and the antisense primer sequence with HindIII linker is 5'-AGCTT TTCC AAAAAA GAATGTTGACCAATGCTAT TCTCTTGAA ATAGCATTGGTCTTCTTTC G-3 '(SEQ ID NO: 18). Nucleotide specific for the mTOR gene in the sequence is underlined and the loop structure is shown in bold.

6-3: pSP72-XP-rAAV-MCS의 작제 6-3: Construction of pSP72-XP-rAAV-MCS

자가-상보적인 AAV의 본래 백본인 pHpa-Trs-SK는 McCarty (오하이오주립대)에 의해 제공받았다. 다중 클로닝 위치(multi-cloning site)를 갖는 새로운 벡터로 변형하였다. 먼저 pSP72-XP-rAAV 벡터를 작제하였다. 이는 pHpa-Trs-SK로부터 ITR(internal repeat), CMV 프로모터, 리포터 유전자 GFP 및 SV40 폴리 A 시그날을포함하는 AAV의 필수 영역을 XhoI 및 PvuII를 이용하여 절단한 후, pSP72 벡터로 라이게이션함으로써 작제되었다. PHpa-Trs-SK, the original backbone of self-complementary AAV, was provided by McCarty (Ohio State University). Modifications were made to new vectors with multi-cloning sites. First, a pSP72-XP-rAAV vector was constructed. This was constructed by cleaving essential regions of AAV, including internal repeat (ITR), CMV promoter, reporter gene GFP, and SV40 poly A signal from pHpa-Trs-SK using XhoI and PvuII, and then ligating with pSP72 vector. .

다음으로는 다중 클로닝 위치를 갖는 링커를 제작하였다. 이 링커는 Kpn I 제한효소 자리를 갖는 센스 올리고뉴클레오타이드 서열인 5'- CGG GAG ATC TTC CTG CAG GAT ATC TGG ATC CAC GAA GCT TCC CAC CGG TTC TAG AGC G-3'(서열번호: 19)과, Sal I 제한효소 자리를 갖는 안티센스 올리고뉴클레오타이드 서열인 5'-TCG ACG CTC TAG AAC CGG TGG GAA GCT TCG TGG ATC CAG ATA TCC TGC AGG AAG ATC TCC CGG TAC-3'(서열번호: 20)으로 구성하였다. 이 링커를 앞서 작제한 pSP72-XP-rAAV로부터 절단한 부분이 KpnI 및 SalI을 갖도록 작제한 후 링커를 라이게이션하여 pSP72-XP-rAAV-MCS를 제조하였다.Next, a linker with multiple cloning positions was produced. This linker is 5'- CGG GAG ATC TTC CTG CAG GAT ATC TGG ATC CAC GAA GCT TCC CAC CGG TTC TAG AGC G-3 '(SEQ ID NO: 19), which is a sense oligonucleotide sequence having a Kpn I restriction enzyme site; 5'-TCG ACG CTC TAG AAC CGG TGG GAA GCT TCG TGG ATC CAG ATA TCC TGC AGG AAG ATC TCC CGG TAC-3 '(SEQ ID NO: 20). The linker was constructed from the previously prepared pSP72-XP-rAAV with KpnI and SalI, and then the linker was ligated to prepare pSP72-XP-rAAV-MCS.

6-4: rAAV-shmTOR#1 또는 rAAV-shmTOR#4의 작제6-4: Construction of rAAV-shmTOR # 1 or rAAV-shmTOR # 4

pSP72-XP-rAAV-MCS로부터 CMV 프로모터를 KpnI and XbaI 소화에 의해 제거하CMV promoter from pSP72-XP-rAAV-MCS was removed by KpnI and XbaI digestion.

고, 이어서 DNA 폴리머라제 (New England BioLabs, Beverly, MA)로 둔단(blunt end)을 만들었다. pH1-shmTOR#1 또는 pH1-shmTOR#4 는 (pSP72-XP-rAAV-MCS에 존재하는) BGH 폴리 A 위치 다음에 인접하게 놓이도록 하였다. 그 다음 pSP72-XP-rAAV-MCS 벡터는 폴리 A 테일을 Sal I으로 절단하였다. And then blunt ends were made with DNA polymerase (New England BioLabs, Beverly, Mass.). pH1-shmTOR # 1 or pH1-shmTOR # 4 were allowed to lie adjacent to the BGH poly A position (present in pSP72-XP-rAAV-MCS). The pSP72-XP-rAAV-MCS vector then cleaved the poly A tail with Sal I.

shmTOR#1 또는 shmTOR#4 발현을 위한 삽입물, 즉 pH1-shmTOR#1 또는 pH1-shmTOR#4 은 pSP72-pH1-shmTOR#1 또는 pSP72-pH1-shmTOR#4 벡터로부터 EcoRV 및 XhoI로 소화하여 얻었다. 이어서 상기 벡터와 삽입물은 DNA 폴리머라제 (New England BioLabs, Beverly, MA)로 둔단을 만들었다.Inserts for expressing shmTOR # 1 or shmTOR # 4, ie pH1-shmTOR # 1 or pH1-shmTOR # 4, were obtained by digesting with EcoRV and XhoI from pSP72-pH1-shmTOR # 1 or pSP72-pH1-shmTOR # 4 vectors. The vector and insert were then blunted with DNA polymerase (New England BioLabs, Beverly, Mass.).

이렇게 제조된 벡터와 삽입물은 둔단 라이게이션하였다. 이는 GFP는 발현하지 않으며, 단지 shmTOR#1 또는 shmTOR#4 만을 발현할 수 있도록 고안되었다. 이를 플라스미드의 경우에는 pSP72-XP-rAAV-pH1-shmTOR#1 또는 pSP72-XP-rAAV-pH1-shmTOR#4 이라고 명명하고, 바이러스의 경우에는 rAAV-shmTOR#1 또는 rAAV-shmTOR#4 라고 명명하였다.The thus prepared vector and insert were blunt ligated. It does not express GFP and is designed to express only shmTOR # 1 or shmTOR # 4. This was named pSP72-XP-rAAV-pH1-shmTOR # 1 or pSP72-XP-rAAV-pH1-shmTOR # 4 for plasmids and rAAV-shmTOR # 1 or rAAV-shmTOR # 4 for viruses. .

6-5: rAAV-GFP-shmTOR#1 또는 rAAV-GFP-shmTOR#4 의 작제6-5: Construction of rAAV-GFP-shmTOR # 1 or rAAV-GFP-shmTOR # 4

벡터가 도입된 세포를 검출하기 위하여 최종적으로 shmTOR#1 또는 shmTOR#4의 발현을 위한 pH1과 독립적으로 GFP 발현 카세트의 발현을 위한 CMV 프로모터를 포함하는 GFP와 shmTOR#1 또는 shmTOR#4 의 이중 유전자 발현 rAAV 벡터를 작제하였다. 클로닝 전략은 다음과 같다: pSP72-XP-rAAV-MCS 벡터(또는 pSP72-XP-rAAV-GFP 벡터라고도 명명함)를 EcoRI로 절단하고 삽입물인 pH1-shmTOR#1 또는 pH1-shmTOR#4 은 pSP72-pH1-shmTOR#1 또는 pSP72-pH1-shmTOR#4 벡터로부터 EcoRV and XhoI로 소화하여 얻었다. 그 다음 벡터와 삽입물을 DNA 폴리머라제 (New England BioLabs, Beverly, MA)로 둔단을 만들었다. 이 벡터는 shmTOR#1 또는 shmTOR#4 및 GFP를 발현할 수 있다.Dual genes of GFP and shmTOR # 1 or shmTOR # 4 containing CMV promoter for expression of GFP expression cassette finally independent of pH1 for expression of shmTOR # 1 or shmTOR # 4 to detect cells into which the vector has been introduced Expression rAAV vectors were constructed. The cloning strategy is as follows: The pSP72-XP-rAAV-MCS vector (also called the pSP72-XP-rAAV-GFP vector) was digested with EcoRI and the insert pH1-shmTOR # 1 or pH1-shmTOR # 4 was pSP72- Obtained by digestion with EcoRV and XhoI from pH1-shmTOR # 1 or pSP72-pH1-shmTOR # 4 vectors. The vectors and inserts were then blunted with DNA polymerase (New England BioLabs, Beverly, Mass.). This vector may express shmTOR # 1 or shmTOR # 4 and GFP.

이 벡터는 플라스미드의 경우에 pSP72-scAAV-GFP-shmTOR#1 또는 pSP72-scAAV-GFP-shmTOR#4 라고 명명하고(도 4a 및 도 4b), 바이러스의 경우에 scAAV-GFP-shmTOR#1 또는 scAAV-GFP-shmTOR#4 라고 명명하였다. 또한, 상기 pSP72-scAAV-GFP 벡터는 바이러스의 경우에 scAAV-GFP라고 명명하였다.This vector is named pSP72-scAAV-GFP-shmTOR # 1 or pSP72-scAAV-GFP-shmTOR # 4 for plasmids (FIGS. 4A and 4B) and scAAV-GFP-shmTOR # 1 or scAAV for viruses. It was named -GFP-shmTOR # 4. The pSP72-scAAV-GFP vector was also named scAAV-GFP in the case of viruses.

<실시예 7> real-time RT-PCR을 이용한 mTOR shRNA의 mTOR 발현 억제효과 검토<Example 7> Examination of mTOR expression inhibitory effect of mTOR shRNA using real-time RT-PCR

총 RNA는 HeLa 세포로부터 실시예 3 과 같이 트리졸 시약(Invitrogen, Carlsbad, CA)을 이용하여 추출하였다. 역전사(RT)와 real-time RT-PCR 역시 실시예 3과 동일하게 진행되었다. 이때 사용된 프라이머는 인간-mTOR-센스 및 안티센스 프라이머(서열번호 7 및 8)와 일반 β-액틴-센스 및 안티센스 프라이머(서열번호 9 및 10) 였다. Total RNA was extracted from HeLa cells using Trizol reagent (Invitrogen, Carlsbad, CA) as in Example 3. Reverse transcription (RT) and real-time RT-PCR were also performed in the same manner as in Example 3. The primers used were human-mTOR-sense and antisense primers (SEQ ID NOS: 7 and 8) and general β-actin-sense and antisense primers (SEQ ID NOs: 9 and 10).

상대적인 유전자 발현 역시 실시예 3과 같이 GeneXpression Macro chromo4 software(Bio-Rad)에 의해 평가되었다. 그 결과, 도 5와 같이 mTOR shRNA#1 또는 mTOR shRNA#4 는 siRNA 와 비슷하거나 더 좋은 효과로 HeLa 세포주에서 mTOR mRNA 발현을 억제하였다. Relative gene expression was also evaluated by GeneXpression Macro chromo4 software (Bio-Rad) as in Example 3. As a result, as shown in FIG. 5, mTOR shRNA # 1 or mTOR shRNA # 4 inhibited mTOR mRNA expression in HeLa cell lines with a similar or better effect than siRNA.

<실시예 8> mTOR shRNA에 의한 인간 암 세포 주기의 변화 분석Example 8 Analysis of Changes in Human Cancer Cell Cycle by mTOR shRNA

mTOR shRNA에 의한 암 세포 주기의 변화를 분석하기 위하여, 프로피디움 아이오다이드(propidium iodide) 염색을 실시하여 플로우 사이토메트리를 이용하였다. 사용한 암 세포주로서는 인체 폐암 세포주인 A549, 인체 간암 세포주인 sk-hep-1을 이용하였다. In order to analyze the change in the cancer cell cycle by mTOR shRNA, propidium iodide staining was performed to use flow cytometry. The cancer cell line used was A549, a human lung cancer cell line, and sk-hep-1, a human liver cancer cell line.

각각의 암 세포주에 rAAV2-mTOR shRNA를 감염시키고 나흘 후에 세포를 모으고 PBS에 용해된 차가운 75% 에탄올을 한방울씩 떨어뜨려가며 고정하였다. 그 후 프로피디움 아이오다이드와 RNAse를 각각 2㎍/ml, 10㎍/ml 농도로 첨가하여 30분간 37℃ 인큐베이터에서 배양하였다. 그후, 플로우사이토메트리(FACSCalibur, Becton Dickinson, San Jose, CA)에 의해 세포주기 즉 G1기, S기 및 G2기를 측정하였다. Each cancer cell line was infected with rAAV2-mTOR shRNA and four days later, the cells were collected and fixed dropwise by dropping cold 75% ethanol dissolved in PBS. Thereafter, propidium iodide and RNAse were added at 2 µg / ml and 10 µg / ml, respectively, and incubated in a 37 ° C incubator for 30 minutes. Thereafter, cell cycles, namely G1, S and G2 phases, were measured by flow cytometry (FACSCalibur, Becton Dickinson, San Jose, Calif.).

그 결과, 도 6a 및 도 6b에 도시된 바와 같이 각각의 세포가 mTOR shRNA 에 의해 S phase가 줄어들면서 G1 arrest를 일으킴을 확인하였다. As a result, as shown in Figures 6a and 6b it was confirmed that each cell causes G1 arrest by reducing the S phase by mTOR shRNA.

<실시예 9> mTOR shRNA에 의한 세포내 형태의 변화 관찰 Example 9 Observation of Intracellular Morphology by mTOR shRNA

mTOR shRNA에 의해 mTOR를 저해함으로써 나타나는 현상 중 하나인 자기소화현상(autophagy)은 암세포의 세포 사멸에 영향을 준다고 보고되고 있다. autophagy는 세포사멸의 한 기전으로서, 세포질 내에 이중막을 가진 소포(vesicle)가 증가하는 현상을 관찰할 수 있다. Autophagy, one of the phenomena caused by mTOR inhibition by mTOR shRNA, has been reported to affect cancer cell death. Autophagy is a mechanism of cell death, in which the vesicles with double membranes in the cytoplasm increase.

mTOR shRNA에 의해 세포질 내의 자기소화성 소포(autophagic vesicle)의 증가 등과 같은 형태학적인 변화를 관찰하기 위해 투과형 전자현미경(TEM)을 이용하였다. 이를 위하여 A549 및 sk-hep-1 세포주에 rAAV2-scramble shRNA 와 rAAV2-mTOR shRNA 를 각각 감염시킨 후 나흘에 세포를 모아 투과형 전자현미경으로 세포 내를 관찰하였다. Transmission electron microscopy (TEM) was used to observe morphological changes such as increase of autophagic vesicles in cytoplasm by mTOR shRNA. For this, rAAV2-scramble shRNA and rAAV2-mTOR shRNA were infected with the A549 and sk-hep-1 cell lines, and the cells were collected four days, and the cells were observed with a transmission electron microscope.

그 결과, 도 7a 및 도 7b와 같이 rAAV2-mTOR shRNA를 감염시킨 세포는 rAAV2-scramble shRNA를 감염시킨 세포에 비해 세포질 내에 이중막을 가진 자기소화성 소포(autophagic vesicle)가 상당히 증가함을 볼 수 있었다. 또한, 핵의 형태 역시 비정상적으로 응집된 것을 확인하였다. 이는 mTOR shRNA에 의해 암세포의 생존이 매우 위협을 받고 있음을 증명하는 것이다.As a result, the cells infected with rAAV2-mTOR shRNA, as shown in Figure 7a and 7b it can be seen that the autophagic vesicle (biphalic vesicle) having a double membrane in the cytoplasm significantly compared to the cells infected with rAAV2-scramble shRNA. In addition, it was confirmed that the shape of the nucleus was also abnormally aggregated. This proves that the survival of cancer cells is threatened by mTOR shRNA.

도 1은 인간 세포주(HeLa)에서 mTOR 특이적 siRNA 4종에 의한 mTOR 유전자 발현 억제효과에 관한 것으로, 상단은 real-time RT-PCR을 이용하여 측정된 내인성 mTOR의 RNA 수준 및 하단은 웨스턴블롯 분석을 이용하여 측정된 내인성 mTOR의 단백질 수준을 나타낸 것이고, Figure 1 relates to the inhibitory effect of mTOR gene expression by four mTOR-specific siRNA in the human cell line (HeLa), the top of the RNA level of the endogenous mTOR measured using real-time RT-PCR and the bottom of the Western blot analysis Shows the protein level of the endogenous mTOR measured using,

도 2는 VP1에 특이적인 플로우 사이토메트리 분석 결과를 나타낸 것이고,Figure 2 shows the flow cytometry analysis results specific for VP1,

도 3a 및 도 3b는 원숭이 세포주(Vero) 및 랫트 세포주(H9C2)에서 mTOR-4 siRNA에 의한 mTOR 유전자 발현 억제효과를 나타낸 것이고,3a and 3b show the inhibitory effect of mTOR gene expression by mTOR-4 siRNA in monkey cell line (Vero) and rat cell line (H9C2),

도 4a 및 도 4b는 본 발명에 따른 재조합벡터인 pSP72-scAAV-GFP-mTOR의 개열지도를 나타낸 것이고,4a and 4b show a cleavage map of the recombinant vector pSP72-scAAV-GFP-mTOR according to the present invention,

도 5는 인간 세포주(HeLa)에서 mTOR shRNA의 mTOR 발현 억제효과를 나타낸 것이고,Figure 5 shows the inhibitory effect of mTOR expression of mTOR shRNA in human cell line (HeLa),

도 6a 및 도 6b는 mTOR shRNA에 의한 인간 암 세포 주기 변화를 분석한 것이고,6a and 6b analyze the human cancer cell cycle change by mTOR shRNA,

도 7a 및 도 7b는 mTOR shRNA에 의한 인간 암 세포 내 형태 변화를 나타낸 것이다.7A and 7B show morphological changes in human cancer cells by mTOR shRNA.

<110> UNIVERSITY OF ULSAN FOUNDATION FOR INDUSTRY COOPERATION <120> mTOR targeting siRNA, and expression vector and pharmaceutical composition comprising the same <130> dp-2009-0558 <160> 20 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mTOR-1 <400> 1 ggagucuacu cgcuucuau 19 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mTOR-2 <400> 2 gaagaagguc acugaggau 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mTOR-3 <400> 3 acaaccucca ggauacacu 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mTOR-4 <400> 4 gaauguugac caaugcuau 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Rat-mTOR-sense primer <400> 5 ccactgtgcc agaatccatc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Rat-mTOR-antisense primer <400> 6 gagaaatccc gaccagtgag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human-mTOR-sense primer <400> 7 ccacagtgcc agaatctatt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Human-mTOR-antisense primer <400> 8 gagaagtccc gaccagtgag 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Universal beta-actin-sense primer <400> 9 tgaagatcaa gatcattgct c 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Universal beta-actin-antisense primer <400> 10 tgaagatcaa gatcattgct c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pH1-sense primer <400> 11 ccatggaatt cgaacgctga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pH1-antisense primer <400> 12 gggaaagagt ggtctcatac 20 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pH1-sense-EcoRI primer <400> 13 atcgaattca tatttgcatg tcgctatgtg 30 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> pH1-antisense-BamHI primer <400> 14 atcggatccg agtggtctca tacagaac 28 <210> 15 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> mTOR sh #1-sense-BamHI primer <400> 15 gatccggagt ctactcgctt ctatttcaag agaatagaag cgagtagact ccttttttgg 60 aaa 63 <210> 16 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> mTOR sh #1-antisense-HindIII primer <400> 16 agcttttcca aaaaaggagt ctactcgctt ctattctctt gaaatagaag cgagtagact 60 cc 62 <210> 17 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> mTOR sh #4-sense-BamHI primer <400> 17 gatccgaatg ttgaccaatg ctatttcaag agaatagcat tggtcaacat tcttttttgg 60 aaa 63 <210> 18 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> mTOR sh #4-antisense-HindIII primer <400> 18 agcttttcca aaaaagaatg ttgaccaatg ctattctctt gaaatagcat tggtcttctt 60 tcg 63 <210> 19 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> AAV-sense-KpnI primer <400> 19 cgggagatct tcctgcagga tatctggatc cacgaagctt cccaccggtt ctagagcg 58 <210> 20 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> AAV-antisense-SalI primer <400> 20 tcgacgctct agaaccggtg ggaagcttcg tggatccaga tatcctgcag gaagatctcc 60 cggtac 66 <110> UNIVERSITY OF ULSAN FOUNDATION FOR INDUSTRY COOPERATION <120> mTOR targeting siRNA, and expression vector and pharmaceutical          composition comprising the same <130> dp-2009-0558 <160> 20 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mTOR-1 <400> 1 ggagucuacu cgcuucuau 19 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mTOR-2 <400> 2 gaagaagguc acugaggau 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mTOR-3 <400> 3 acaaccucca ggauacacu 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mTOR-4 <400> 4 gaauguugac caaugcuau 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Rat-mTOR-sense primer <400> 5 ccactgtgcc agaatccatc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Rat-mTOR-antisense primer <400> 6 gagaaatccc gaccagtgag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human-mTOR-sense primer <400> 7 ccacagtgcc agaatctatt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human-mTOR-antisense primer <400> 8 gagaagtccc gaccagtgag 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Universal beta-actin-sense primer <400> 9 tgaagatcaa gatcattgct c 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Universal beta-actin-antisense primer <400> 10 tgaagatcaa gatcattgct c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pH1-sense primer <400> 11 ccatggaatt cgaacgctga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pH1-antisense primer <400> 12 gggaaagagt ggtctcatac 20 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pH1-sense-EcoRI primer <400> 13 atcgaattca tatttgcatg tcgctatgtg 30 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> pH1-antisense-BamHI primer <400> 14 atcggatccg agtggtctca tacagaac 28 <210> 15 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> mTOR sh # 1-sense-BamHI primer <400> 15 gatccggagt ctactcgctt ctatttcaag agaatagaag cgagtagact ccttttttgg 60 aaa 63 <210> 16 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> mTOR sh # 1-antisense-HindIII primer <400> 16 agcttttcca aaaaaggagt ctactcgctt ctattctctt gaaatagaag cgagtagact 60 cc 62 <210> 17 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> mTOR sh # 4-sense-BamHI primer <400> 17 gatccgaatg ttgaccaatg ctatttcaag agaatagcat tggtcaacat tcttttttgg 60 aaa 63 <210> 18 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> mTOR sh # 4-antisense-HindIII primer <400> 18 agcttttcca aaaaagaatg ttgaccaatg ctattctctt gaaatagcat tggtcttctt 60 tcg 63 <210> 19 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> AAV-sense-KpnI primer <400> 19 cgggagatct tcctgcagga tatctggatc cacgaagctt cccaccggtt ctagagcg 58 <210> 20 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> AAV-antisense-SalI primer <400> 20 tcgacgctct agaaccggtg ggaagcttcg tggatccaga tatcctgcag gaagatctcc 60 cggtac 66  

Claims (9)

서열번호 1 내지 서열번호 4 중에서 선택된 어느 하나의 염기서열을 가지며, mTOR과 결합하여 그 발현을 억제하는 것을 특징으로 하는, 종간 교차활성을 지닌 siRNA.SiRNA having a cross-linking activity, characterized in that having one of the nucleotide sequence selected from SEQ ID NO: 1 to SEQ ID NO: 4, and binds to mTOR to inhibit the expression. 삭제delete 청구항 1에 따른 siRNA를 포함하는 재조합벡터.Recombinant vector comprising siRNA according to claim 1. 청구항 3에 있어서, 상기 재조합벡터는 도 4a 또는 도 4b에 도시된 개열지도를 갖는 것을 특징으로 하는 재조합벡터.The recombinant vector according to claim 3, wherein the recombinant vector has a cleavage map shown in FIG. 4A or 4B. 청구항 3 또는 청구항 4에 있어서, 상기 재조합벡터는 pSP72-scAAV-GFP-shmTOR#1 또는 pSP72-scAAV-GFP-shmTOR#4인 것을 특징으로 하는 재조합벡터.The recombinant vector according to claim 3 or 4, wherein the recombinant vector is pSP72-scAAV-GFP-shmTOR # 1 or pSP72-scAAV-GFP-shmTOR # 4. 삭제delete 삭제delete 청구항 1에 따른 siRNA를 유효성분으로 함유하는 암질환 치료 및 예방용 약학조성물.A pharmaceutical composition for treating and preventing cancer diseases containing siRNA according to claim 1 as an active ingredient. 청구항 8에 있어서, 상기 암질환은 간암, 폐암, 비소세포성폐암, 결장암, 골암, 췌장암, 피부암, 두부 또는 경부 암, 피부 또는 안구내 흑색종, 자궁암, 난소암, 직장암, 위암, 항문부근암, 결장암, 유방암, 나팔관암종, 자궁내막암종, 자궁경부암종, 질암종, 음문암종, 호지킨병(Hodgkin's disease), 식도암, 소장암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 방광암, 신장 또는 수뇨관 암, 신장세포 암종, 신장골반 암종, 중추신경계 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 및 뇌하수체 선종으로 이루어진 군에서 선택된 하나 이상의 암질환인 암질환 치료 및 예방용 약학조성물.The method of claim 8, wherein the cancer disease is liver cancer, lung cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, anal muscle cancer , Colon cancer, breast cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethra Cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocyte lymphoma, bladder cancer, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary CNS lymphoma, spinal cord tumor, brain stem glioma and pituitary adenoma A pharmaceutical composition for treating and preventing cancer diseases, which is at least one cancer disease selected from the group consisting of:
KR1020090110639A 2008-12-02 2009-11-17 mTOR targeting siRNA with cross-species activity, and expression vector and pharmaceutical composition comprising the same KR101069101B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2009/007175 WO2010064851A2 (en) 2008-12-02 2009-12-02 Mtor-targeted sirna having an interspecific cross reaction, recombination vector containing same, and pharmaceutical composition containing same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20080121507 2008-12-02
KR1020080121507 2008-12-02

Publications (2)

Publication Number Publication Date
KR20100062914A KR20100062914A (en) 2010-06-10
KR101069101B1 true KR101069101B1 (en) 2011-09-30

Family

ID=42363106

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020090110639A KR101069101B1 (en) 2008-12-02 2009-11-17 mTOR targeting siRNA with cross-species activity, and expression vector and pharmaceutical composition comprising the same

Country Status (1)

Country Link
KR (1) KR101069101B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019017713A3 (en) * 2017-07-20 2019-04-11 ㈜큐리진 NUCLEIC ACID SIMULTANEOUSLY INHIBITING EXPRESSION OF AR GENE AND mTOR GENE

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Experimental cell research, Vol. 312, pp. 2726-2734 (2006.05.12.)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019017713A3 (en) * 2017-07-20 2019-04-11 ㈜큐리진 NUCLEIC ACID SIMULTANEOUSLY INHIBITING EXPRESSION OF AR GENE AND mTOR GENE
US10947542B2 (en) 2017-07-20 2021-03-16 Curigin Co., Ltd. Nucleic acid simultaneously inhibiting expression of AR gene and mTOR gene

Also Published As

Publication number Publication date
KR20100062914A (en) 2010-06-10

Similar Documents

Publication Publication Date Title
US20100105134A1 (en) Nucleic acid compounds for inhibiting gene expression and uses thereof
EP2471920A2 (en) Nucleic acid compounds for inhibiting WNT gene expression and uses thereof
JP5976643B2 (en) Methods and compositions for specific inhibition of beta-catenin by double stranded RNA
JP2009515523A (en) Splice-switching oligomers for TNF superfamily receptors and use of the oligomers in disease treatment
WO2011101869A1 (en) Adeno-associated virus 2/8 - micro rna-101 therapy for liver cancer
US20100015706A1 (en) Nucleic acid compounds for inhibiting hif1a gene expression and uses thereof
US20110136233A1 (en) Nucleic acid compounds for inhibiting plk1 gene expression and uses thereof
AU773641B2 (en) The novel antisense-oligos with better stability and antisense effect
US20100055783A1 (en) Nucleic acid compounds for inhibiting ras gene expression and uses thereof
US20100055782A1 (en) Nucleic acid compounds for inhibiting myc gene expression and uses thereof
CN110201172B (en) Application of YY1 expression inhibitor in preparation of medicine for treating breast cancer
US20110236972A1 (en) Nucleic acid compounds for inhibiting birc5 gene expression and uses thereof
WO2010064851A2 (en) Mtor-targeted sirna having an interspecific cross reaction, recombination vector containing same, and pharmaceutical composition containing same
KR101069101B1 (en) mTOR targeting siRNA with cross-species activity, and expression vector and pharmaceutical composition comprising the same
US20100055784A1 (en) Nucleic acid compounds for inhibiting wnt gene expression and uses thereof
CN104884096B (en) Composition for treating cancer related to human papillomavirus infection
CN107709561B (en) Modified siRNA and pharmaceutical composition containing same
AU2009212920A1 (en) Nucleic acid compounds for inhibiting gene expression and uses thereof
WO2008109366A2 (en) Nucleic acid compounds for inhibiting ccnd1 gene expression and uses thereof
KR101292924B1 (en) Recombinant Vector Containing siRNA Targeing GCH1 and Pharmaceutical Composition for Attenuating Neuropathic Pain Comprising The Same
WO2006003804A1 (en) Oligonucleotide inhibiting tumor cell proliferation and method therefor
US7902167B2 (en) Compounds and methods for down-regulating Wrap53 protein by RNA interference
KR102489708B1 (en) Composition for controlling expression of GDF11 gene comprising PCBP2 and microRNA
WO2022191661A1 (en) Nucleic acids simultaneously inhibiting expression of c-met gene and pd-l1 gene
WO2023014192A1 (en) Non-natural nucleic acid ligand, uses thereof, and pharmaceutical composition for preventing or treating cancer comprising same as active ingredient

Legal Events

Date Code Title Description
A201 Request for examination
A302 Request for accelerated examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20140923

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20150811

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20160908

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20180905

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20190814

Year of fee payment: 9