KR101036854B1 - Polypeptide for inducing apoptosis, dna encoding same and a pharmaceutical composition for inducing apoptosis containing same - Google Patents

Abstract

The present invention induces apoptosis despite not binding to myeloid cell leukemia-1 long (Mcl-1L), an anti-apoptotic protein, which is different from pro-apoptotic Bcl-2 family proteins. A polypeptide, DNA encoding the same and a pharmaceutical composition for inducing apoptosis comprising the same, the pharmaceutical composition of the present invention can be usefully used for the treatment of various cancers, including hematological cancer and solid cancer.

Apoptosis, Mcl-1L, Mcl-1ES BH3M, Anticancer Drug

Description

Polypeptide inducing apoptosis, DNA encoding the same and a pharmaceutical composition for inducing apoptosis comprising same {POLYPEPTIDE FOR INDUCING APOPTOSIS, DNA ENCODING SAME AND A PHARMACEUTICAL COMPOSITION FOR INDUCING APOPTOSIS CONTAINING SAME}

The present invention induces apoptosis despite not binding to myeloid cell leukemia-1 long (Mcl-1L), an anti-apoptotic protein, which is different from pro-apoptotic Bcl-2 family proteins. It relates to a polypeptide, DNA encoding the same and a pharmaceutical composition for inducing apoptosis comprising the same.

Programmed cell death or apoptosis is an important mechanism for cell replacement, tissue remodeling and removal of injured cells (Thomson, C. B., Science, 267: 1456-1462 (1995)). Misregulation of apoptosis leads to various diseases such as cancer, autoimmune diseases, neurorodegenerative disorders, and viral infections.

Proteins belonging to the Bcl-2 family characterized by having a Bcl-2 homology (BH) domain are known to play a pivotal role in this apoptosis (Adams JM, et al. , Science, 281 (5381): 1322-1326 (1998).

Bcl-2 family proteins can be divided into proteins that promote apoptosis and proteins that inhibit apoptosis, depending on the effects of cell survival. Pro-apoptotic proteins that promote apoptosis include Bcl-Xs and Bax, and anti-apoptotic proteins that inhibit apoptosis include Bcl-2 and Mcl-1. Etc.

Bcl-2 family proteins are known to regulate cell survival and death by forming heterodimers with each other via the BH3 domain (Kim H., et al., Nat Cell Biol., 8 (12): 1348-1358 (2006). In particular, pro-apoptotic Bcl-2 family proteins have been reported to induce apoptosis by binding to anti-apoptotic Bcl-2 family proteins such as Mcl-1 to sequester anti-apoptotic proteins. (Youle RJ, Strasser A., Nat. Rev. Mol. Cell Biol., 9 (1): 47-59 (2008); and Danial NN., Clin. Cancer Res., 13 (24): 7254-7263 ( 2007)). Accordingly, anticancer drugs that induce apoptosis by preventing binding of pro-apoptotic Bcl-2 family proteins to anti-apoptotic Bcl-2 family proteins have been developed (Labi V., et al., Cell Death Differ. , 15 (6): 977-987 (2008); and Adams JM, Cory S., Oncogene, 26 (9): 1324-1337 (2007).

Mcl-1 is expressed in two isoforms according to alternative splicing, Mycloid cell leukemia-1 long (Mcl-1L) and Myeloid cell leukemia-1 short (Mcl-1S). Mcl-1L promotes cell survival by inhibiting apoptosis while Mcl-1S promotes cell death by binding to Mcl-1L (Bae et al., J. Biol. Chem. 275 (33): 25255-25261 (2000).

The Mcl-1L protein is composed of Bcl-2 homologous first domain (BH1), second domain (BH2), third domain (BH3) and C-terminal transmembrane domains found in other Bcl-2 family proteins. TM) and have a PEST sequence with many proline, glutamic acid, serine, and threonine residues at the N-terminus. Mcl-1L was initially found as an early inducer in the differentiation of human myeloid leukemia cell lines (Kozopas, K. M. et al., Proc. Natl. Acad. Sci., U. S. A., 90: 3516-3520 (1993)).

Upregulation of Mcl-1L causes various cancers through immortalization and cancer cell conversion, and is associated with anticancer drug resistance, HIV infection, and rheumatoid arthritis. (Warr MR and Shore GC., Curr. Mol. Med., Mar. 8 (2): 138-147 (2008); Grelli S et al., Ann. NY Acad. Sci., 1090: 130- 137 (2006); and Liu H et al., J. Immunol., 175 (12): 8337-8345 (2005)).

The present inventors performed PCR using a primer of Mcl-1L, an anti-apoptotic protein belonging to the Bcl-2 family, in human embryonic stem cell lines, and then confirmed a small amount of transcript band and analyzed its sequencing. As a result, it was confirmed that most of the PEST domain was removed from the Mcl-1L splicing variant, and mutation of the BH3 domain of these variants resulted in apoptosis alone without binding to Mcl-1L. The present invention has been completed by discovering that it has effective inducing pro-cell killing activity and revealing that the pharmaceutical composition comprising the polypeptide or DNA encoding the same as an active ingredient can be usefully used for the treatment of cancer.

Accordingly, it is an object of the present invention to provide a polypeptide that induces cell death alone and a DNA encoding the same without binding to Mycloid cell leukemia-1 long (Mcl-1L).

Another object of the present invention to provide a pharmaceutical composition for inducing apoptosis comprising the polypeptide or DNA.

In accordance with the above object, the present invention provides a polypeptide represented by the amino acid sequence of SEQ ID NO: 2 and DNA encoding the same.

According to the above another object, the present invention provides a pharmaceutical composition for inducing apoptosis comprising a polypeptide represented by the amino acid sequence of SEQ ID NO: 2 or a DNA encoding the same as an active ingredient.

A novel polypeptide derived from Mcl-1L (Myeloid cell leukemia-1 long) of the present invention effectively induces apoptosis alone without binding to Mcl-1L and thus includes the polypeptide or DNA encoding the same as an active ingredient. The composition can be usefully used as a pharmaceutical composition for cancer cell death.

Mycloid cell leukemia-1 long (Mcl-1L) protein is an anti-apoptotic protein belonging to the Bcl-2 family and inhibits apoptosis, and the present inventors have identified splicing variants in which most of the PEST domain has been removed from Mcl-1L. Polypeptides obtained by mutating the BH3 domain of the splicing variant (hereinafter referred to as "Mcl-1ES") (hereinafter referred to as "Mcl-1ES BH3M") have been found to effectively induce apoptosis. Unlike Mcl-1ES that binds to Mcl-1L and induces apoptosis, Mcl-1ES BH3M can induce apoptosis alone without binding to Mcl-1L.

Thus, the present invention provides a polypeptide having the amino acid sequence of SEQ ID NO: 2.

Polypeptides that are substantially identical and functionally equivalent to the amino acid sequence of SEQ ID NO: 2 are also within the scope of the present invention. Substantially identical and functionally equivalent polypeptide is at least 70%, preferably at least 80%, more preferably at least 90 when the two polypeptides are properly arranged by computerized implementation of known algorithms or by irradiation. %, Most preferably at least 95% of sequence homology.

The invention also provides a DNA encoding the polypeptide.

The DNA may have a nucleotide sequence of SEQ ID NO: 1.

Mcl-1L and the structural difference of Mcl-1ES BH3M is schematically illustrated in Fig.

As a result of confirming binding of Mcl-1L and Mcl-1ES BH3M through immunoprecipitation (IP), it was confirmed that Mcl-1ES BH3M did not bind to Mcl-1L (see FIG. 3 ). It was confirmed that the apoptosis markers caspases 3 and 9 were activated (see FIG. 4 ), and that apoptosis was induced regardless of the expression of Mcl-1L that inhibited apoptosis (see FIG. 5 ). This is because Mcl-1ES BH3M of the present invention induces cancer cell-specific apoptosis by irrespective of whether Mcl-1L is directly or indirectly involved in cancer cell maintenance or induction, and without binding to Mcl-1L. Demonstrates effective use in therapy.

The present invention also provides a recombinant vector comprising a DNA encoding a polypeptide having an amino acid sequence of SEQ ID NO: 2 and a microorganism transformed with the recombinant vector.

By culturing the microorganism under appropriate conditions, a large amount of polypeptide having the amino acid sequence of SEQ ID NO: 2 can be produced.

The composition having a polypeptide having the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same may be used as a pharmaceutical composition for inducing apoptosis. In particular, the pharmaceutical composition can induce the death of cancer cells, and thus can be used as an anticancer agent for the treatment of various cancers, including blood cancer and solid cancer.

The pharmaceutical compositions of the present invention may contain sterile and / or preservatives, stabilizers, hydrating or emulsifying accelerators, auxiliaries such as salts and / or buffers for the control of osmotic pressure and other therapeutically useful substances, according to conventional methods. It may be formulated.

The pharmaceutical composition of the present invention may be orally administered or parenterally administered as desired, wherein the polypeptide having the amino acid sequence of SEQ ID NO: 2 or the DNA encoding the same is 1 ng to 10 mg / kg of adult body weight per day It can be administered in one to several doses. Dosage levels for a particular patient may vary depending on the patient's weight, age, sex, health condition, diet, time of administration, method and excretion, and drug mix and severity of the disease. The above dosage is an example of an average case and, of course, there may be individual examples having a higher or lower dosage range, which is also included in the protection scope of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited only to these examples.

Example 1 Preparation of Mcl-1ES BH3M Expression Vector

1 x PCR reaction solution (100 μl) (2.5 mM MgCl ₂ , 250 μM dNTP and 2.5 U recombinant Taq polymerase) using cDNA from human embryonic stem cell line CHA3 (CHA Stem Cell Institute, Pochon CHA University, Korea) as a template PCR was performed using 1 μM pcMcl-1L forward primer (5′-AGTGGATCCATGTTTGGCCTCAAAAGAAAC; SEQ ID NO: 3) and pcMcl-1L reverse primer (5′-TTCTATCGGAATGACATTCTTAAGATC; SEQ ID NO: 4), respectively. At this time, the PCR conditions, the primer pair and the template was denatured for 3 minutes at 95 ℃, 30 seconds at 95 ℃, 30 seconds at 55 ℃ and 30 minutes at 72 ℃ for 1 minute and then extended for 10 minutes at 72 ℃ The reaction was terminated.

The PCR product obtained above was digested with restriction enzymes BamHl / EcoRl, and then electrophoresed to separate about 600 bp fragments, which were then digested with the same enzyme pcDNA3 (Invitrogen, Carlsbad, CA; Cat # A-150228). Was cloned into multiple cloning sites of to obtain the recombinant plasmid pcMcl-1ES.

Then pcMcl-1ES was used as a template to obtain the pcFlag Mcl-1ES BH3M plasmid and pcFlag Mcl-1L forward primer (5'-AGTGGATCCATGGACTACAAAGACGACGACGACAAATTTGGCCTCAAAAGAAAC-3 '; SEQ ID NO: 5) and Mcl-1 BH3 7AA Mutant reverse primer (5'- Using GAGCACCAACGCGACGTGACGACGACGACGACGACGACGCCAGAGGTCGCGGAAGGACGA; SEQ ID NO: 6) in 1 X PCR reaction solution (100 μL) (2.5 mM MgCl ₂ , 250 μM dNTP and 2.5 U recombinant Taq polymerase), denature for 3 min at 95 ° C., 30 min at 95 ° C. The reaction was performed 30 times at 55 ° C. for 30 seconds and at 72 ° C. for 30 seconds, followed by PCR for 10 minutes at 72 ° C. to obtain a PCR product of about 200 bp, using plasmid pcMcl-1ES as a template and Mcl. 1 X PCR reaction solution (100 μl) (2.5 mM MgCl ₂ , 250 μM) using BH3 7AA Mutant forward primer (5′-GGTCTCCAGCGCCTTCCTGCT; SEQ ID NO: 7) and pcMcl-1L reverse primer (SEQ ID NO: 4) 95 ° C. in dNTP and 2.5 U recombinant Taq polymerase The mixture was denatured for 3 minutes at 30 ° C., 30 seconds at 55 ° C., 30 seconds at 30 ° C. and 30 seconds at 72 ° C., and then PCR was performed under conditions extending for 10 minutes at 72 ° C. to obtain 500 bp of PCR product.

Recombinant PCR was performed using the PCR products thus obtained as templates to finally obtain a PCR product of about 600 bp. At this time, pcFlag Mcl-1L forward primer (SEQ ID NO: 5) and pcMcl-1L reverse primer (SEQ ID NO: 4) were used, PCR conditions, the primer pair and the template denatured at 95 ℃ for 3 minutes, 95 ℃ The reaction was carried out 30 times at 30 seconds, 30 seconds at 55 ° C. and 1 minute at 72 ° C., and then extended at 72 ° C. for 10 minutes to terminate the reaction.

Multiple cloning sites of pcDNA3 (Invitrogen, Carlsbad, CA; Cat # A-150228) were treated with restriction enzymes BamHl / EcoRl, and then the PCR product obtained was cloned to obtain recombinant plasmid pcFlagMcl-1ES BH3M. A cleavage map of this recombinant plasmid is shown in FIG. 2 .

After sequencing by the Sanger method, it was confirmed that the recombinant plasmid pcFlagMcl-1ES BH3M contains a DNA having the nucleotide sequence of SEQ ID NO: 1.

Example 2 Confirmation of Mcl-1ES BH3M Protein and Mcl-1L Protein

While Mcl-1S and Mcl-1ES proteins bind to Mcl-1L to induce apoptosis, the Mcl-1ES BH3M protein of the present invention exhibits apoptosis activity alone without binding to Mcl-1L.

To confirm that the Mcl-1ES BH3M protein binds to the Mcl-1L protein, first the human embryonic kidney (HEK) 293T cell line (ATCC; 293T Cat # CRL-11268 ™) was used. After culturing for 24 hours at 36 ° C. in a 100 mm plate in an amount of 3 × 10 ⁶ cells, the pcFlag Mcl-1ES BH3M plasmid obtained in Example 1 and the pcFlagMcl-1ES and pcFlag A1 plasmids obtained from Pochon Medical Center Welfect-EX, which is a constituent protein of the anti-apoptotic Bcl-2 family, with a pcMcl-1L plasmid (Pocheon Jung-Myung University), which has the most similarity to Mcl-1L, is 6 μg of total DNA. Transfection was performed using a transfection kit (Welgene, Korea).

Proteins were then sampled using NP-40 lysis buffer (50 mM Tris-HCl (pH 8.0), 0.15 M NaCl, and 1% NP-40) followed by anti-Mcl antibody (sc-819, Santa Cruz Biotechnology) And immunoprecipitation (IP) using immuno-Flag M2 antibodies (F1804, Sigma) and protein-G-Agarose (Uptein, Charlottesville, VA) Blotting (Immunoblotting, IB) was performed.

As a result, it was confirmed that Mcl-1ES BH3M did not bind to Mcl-1L (see FIG. 3 ).

Example 3 Confirmation of Activation of Caspase

When apoptosis is induced, caspase is activated and caspase is used as a marker for cell death (Takahashi A, Earnshaw WC., Curr. Opin. Genet. Dev., 6 (1): 50-55 (1996) ).

To confirm that caspase is activated upon expression of Mcl-1ES BH3M, 293T cell line (ATCC; 293T Cat # CRL-11268 ™) was incubated for 24 hours at 36 ° C. in a 60 mm plate in an amount of 1 × 10 ⁶ cells, Here, pcFlagMcl-1ES BH3M obtained in Example 1, alone or in combination with pcFlagMcl-1L (Pocheon Jungmun Medical Center), was transfected using a Welfect-EX transfection kit (Welgene, Korea) so that the total DNA was 1.5 µg. I was.

Thereafter, proteins were sampled using NP-40 lysis buffer (50 mM Tris-HCl at pH 8.0, 0.15 M NaCl, and 1% NP-40), followed by Western blotting, to activate caspase 3 and 9 Was observed.

As a result, it was confirmed that caspases 3 and 9 are activated upon expression of Mcl-1ES BH3M (see FIG. 4 ), which is not necrosis due to expression of Mcl-1ES BH3M of the present invention (apoptosis). ) Is induced.

Example 4 Evaluation of Apoptosis Activity of Mcl-1ES BH3M

To determine the degree of apoptosis of Mcl-1ES BH3M with or without Mcl-1L expression, a 293T cell line (ATCC; 293T Cat # CRL-11268 ™) was run in 48-well plates in an amount of 3.5 x 10 ⁴ cells. After 24 hours of incubation at 36 ° C., the total DNA was 10, 30, 50, and 100 ng, alone or in combination with pcMcl-1L (Pocheon University Medical Center) prepared in Example 1 The transfection was performed using the Welfect-EX transfection kit (Welgene, Korea) as much as possible (a ratio of 1: 1 was used for the co-transfection of pcFlag Mcl-1ES BH3M and pcMcl-1L). At this time, the plasmid expressing 10 ng of green fluorescent protein (GFP) was transfected together and counted only for cells containing GFP after 24 hours to measure the degree of cell death.

As a result, it was confirmed that apoptosis was induced in the cells transfected with the Mcl-1ES BH3M expression vector regardless of the expression of Mcl-1L (see FIG. 5 ).

These results show that Mcl-1ES BH3M of the present invention effectively induces cell death alone with or without Mcl-1L expression and without binding to Mcl-1L.

1 is a schematic diagram showing structural differences between Mcl-1L and Mcl-1ES BH3M.

2 is a schematic cleavage map of the pcFlag Mcl-1ES BH3M plasmid according to the present invention.

Figure 3 shows the results confirmed by immunoblotting (Immunoblotting, IB) after performing immunoprecipitation analysis (Immunoprecipitaiton, IP) to show that Mcl-1L and Mcl-1ES BH3M protein does not bind.

4 is an immunoblotting result showing that apoptosis marker caspase is activated by Mcl-1ES BH3M regardless of the expression of Mcl-1L.

5 shows the degree of apoptosis induced in 293T cells transfected with Mcl-1ES BH3M expression vector alone or simultaneously with Mcl-1ES BH3M expression vector and Mcl-1L expression vector.

<110> ChungAng University Industry Academic Cooperation Foundation          Seoul National University Industry Foundation <120> POLYPEPTIDE FOR INDUCING APOPTOSIS, DNA ENCODING SAME AND A          PHARMACEUTICAL COMPOSITION FOR INDUCING APOPTOSIS CONTAINING SAME <130> FPD / 200807-0128 <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 594 <212> DNA <213> Artificial Sequence <220> <223> Mcl-1ES BH3M <220> <221> CDS (222) (1) .. (591) <400> 1 atg ttt ggc ctc aaa aga aac gcg gta atc gga ctc aac ctc tac tgt 48 Met Phe Gly Leu Lys Arg Asn Ala Val Ile Gly Leu Asn Leu Tyr Cys   1 5 10 15 ggg ggg gcc ggc ttg ggg gcc ggc agc ggc ggc gcc acc cgc ccg gga 96 Gly Gly Ala Gly Leu Gly Ala Gly Ser Gly Gly Ala Thr Arg Pro Gly              20 25 30 ggg cga ctt ttg gcc acc ggc gcc aag gac aca aag cca atg ggc agg 144 Gly Arg Leu Leu Ala Thr Gly Ala Lys Asp Thr Lys Pro Met Gly Arg          35 40 45 tct ggg gcc acc agc agg aag gcg ctg gag acc gca gca gca gca gca 192 Ser Gly Ala Thr Ser Arg Lys Ala Leu Glu Thr Ala Ala Ala Ala Ala      50 55 60 gca gca gtg cag cgc aac cac gag acg gcc ttc caa ggc atg ctt cgg 240 Ala Ala Val Gln Arg Asn His Glu Thr Ala Phe Gln Gly Met Leu Arg  65 70 75 80 aga ctg gac atc aaa aac gaa gac gat gtg aaa tcg ttg tct cga gtg 288 Arg Leu Asp Ile Lys Asn Glu Asp Asp Val Lys Ser Leu Ser Arg Val                  85 90 95 atg atc cat gtt ttc agc gac ggc gta aca aac tgg ggc agg att gtg 336 Met Ile His Val Phe Ser Asp Gly Val Thr Asn Trp Gly Arg Ile Val             100 105 110 act ctc att tct ttt ggt gcc ttt gtg gct aaa cac ttg aag acc ata 384 Thr Leu Ile Ser Phe Gly Ala Phe Val Ala Lys His Leu Lys Thr Ile         115 120 125 aac caa gaa agc tgc atc gaa cca tta gca gaa agt atc aca gac gtt 432 Asn Gln Glu Ser Cys Ile Glu Pro Leu Ala Glu Ser Ile Thr Asp Val     130 135 140 ctc gta agg aca aaa cgg gac tgg cta gtt aaa caa aga ggc tgg gat 480 Leu Val Arg Thr Lys Arg Asp Trp Leu Val Lys Gln Arg Gly Trp Asp 145 150 155 160 ggg ttt gtg gag ttc ttc caa gta gag gac cta gaa ggt ggc atc agg 528 Gly Phe Val Glu Phe Phe Gln Val Glu Asp Leu Glu Gly Gly Ile Arg                 165 170 175 aat gtg ctg ctg gct ttt gca ggt gtt gct gga gta gga gct ggt ttg 576 Asn Val Leu Leu Ala Phe Ala Gly Val Ala Gly Val Gly Ala Gly Leu             180 185 190 gca tat cta aaa aga tag 594 Ala Tyr Leu Lys Arg         195 <210> 2 <211> 197 <212> PRT <213> Artificial Sequence <400> 2 Met Phe Gly Leu Lys Arg Asn Ala Val Ile Gly Leu Asn Leu Tyr Cys   1 5 10 15 Gly Gly Ala Gly Leu Gly Ala Gly Ser Gly Gly Ala Thr Arg Pro Gly              20 25 30 Gly Arg Leu Leu Ala Thr Gly Ala Lys Asp Thr Lys Pro Met Gly Arg          35 40 45 Ser Gly Ala Thr Ser Arg Lys Ala Leu Glu Thr Ala Ala Ala Ala Ala      50 55 60 Ala Ala Val Gln Arg Asn His Glu Thr Ala Phe Gln Gly Met Leu Arg  65 70 75 80 Arg Leu Asp Ile Lys Asn Glu Asp Asp Val Lys Ser Leu Ser Arg Val                  85 90 95 Met Ile His Val Phe Ser Asp Gly Val Thr Asn Trp Gly Arg Ile Val             100 105 110 Thr Leu Ile Ser Phe Gly Ala Phe Val Ala Lys His Leu Lys Thr Ile         115 120 125 Asn Gln Glu Ser Cys Ile Glu Pro Leu Ala Glu Ser Ile Thr Asp Val     130 135 140 Leu Val Arg Thr Lys Arg Asp Trp Leu Val Lys Gln Arg Gly Trp Asp 145 150 155 160 Gly Phe Val Glu Phe Phe Gln Val Glu Asp Leu Glu Gly Gly Ile Arg                 165 170 175 Asn Val Leu Leu Ala Phe Ala Gly Val Ala Gly Val Gly Ala Gly Leu             180 185 190 Ala Tyr Leu Lys Arg         195 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pcMcl-1L forward primer <400> 3 agtggatcca tgtttggcct caaaagaaac 30 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> pcMcl-1L reverse primer <400> 4 ttctatcgga atgacattct taagatc 27 <210> 5 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> pcFlag Mcl-1L forward primer <400> 5 agtggatcca tggactacaa agacgacgac gacaaatttg gcctcaaaag aaac 54 <210> 6 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Mcl-1 BH3 7AA Mutant reverse primer <400> 6 gagcaccaac gcgacgtgac gacgacgacg acgacgacgc cagaggtcgc ggaaggacga 60                                                                           60 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Mcl-1 BH3 7AA Mutant forward primer <400> 7 ggtctccagc gccttcctgc t 21  

Claims (8)

A polypeptide represented by the amino acid sequence of SEQ ID NO: 2. DNA encoding the polypeptide of claim 1. The method of claim 2, DNA is characterized in that the DNA is represented by the nucleotide sequence of SEQ ID NO: 1. A recombinant vector comprising the DNA of claim 2 or 3. Microorganism transformed with the recombinant vector of claim 4. A pharmaceutical composition for inducing apoptosis comprising a polypeptide represented by SEQ ID NO: 2 or a DNA encoding the same as an active ingredient. The method of claim 6, Pharmaceutical composition, characterized in that the DNA is represented by the nucleotide sequence of SEQ ID NO: 1. delete

Images