KR100997129B1 - Gateway RFP-Fusion Vectors for High Throughput Functional Analysis of Genes - Google Patents

Abstract

In the present invention, a multicloning site is located in the 3 'direction of the CMV promoter, an attR1 site and an attR2 site are located in the 3' direction of the multicloning site, and a chloramphenicol resistance gene (CM) is located between the attR1 site and the attR2 site. ^R ) and a suicide ccdB box are located, and the destination vector is characterized in that a red fluorescent protein is located in the 3 'direction of the multicloning site or the attR2 site.

According to the present invention, in a cDNA, a specific gene or a specific domain is selectively inserted into a destination vector to produce an expression clone, and the produced expression clone can be used to easily observe the function of a specific gene in a cell. Therefore, it is possible to rapidly detect the role in the cells of genes that perform homologous functions conserved in the genome in high throughputly (HTP).

Description

Gateway RFP-Fusion Vectors for High Throughput Functional Analysis of Genes

The present invention relates to a red fluorescence protein fusion protein production vector and a composition for differentiation of neurons containing the same for high-speed functional analysis of genes. More specifically, the multi-cloning site is located in the 3 'direction of the CMV promoter, and the multi-cloning The attR1 site and the attR2 site are located in the 3 'direction of the site, and the chloramphenicol resistance gene (CM ^R ) and the suicide ccdB box are located between the attR1 site and the attR2 site, and the 3' of the multicloning site or attR2 site is located. It relates to a destination vector (Destination Vector) characterized in that the red fluorescent protein is located in the direction.

In analyzing the function of genes after the genome project, the method of performing the analysis by the high throughput (HTP) method on the scale of the genome range is important. However, current techniques for holistic analytical methods allow only a limited range of phenotypic analyzes for the cells to be analyzed. In other words, rapid advances in genome sequencing over the last decade have enabled the identification of enormous numbers of genes and the creation and application of lists of functionally defined elements to perform holistic analysis in the genome range. Although possible (Gibbs et al., 2004; Waterston et al., 2002), still most of the genes expected from recently available genomic sequences remain functionally unspecified. One essential step in the analysis of the genome range is the systematic mapping of polymer binding and biochemical reactions using reverse proteomics approaches (Walhout and Vidal, 2001).

Reverse proteomics projects, however, require a large number of manipulations and cloning for open reading frames (ORFs), or protein coding sequences. Recently, cloning systems have been developed that perform genetic recombination in vitro, and the systems can also be used to perform high throughput (HTP) cloning of the human genome (Hartley et al., 2000; Siegel et al. , 2004). Gateway cloning technology (GCT) is a system that uses site-specific genetic recombination in vitro for replication and sequentially delivers DNA fragments between vector backbones (Hartley et al., 2000). This system is prepared by performing a PCR reaction on fragments having attB1 and attB2 genetic recombination sites at both ends, and performing the in vitro genetic recombination reaction of BP clonase on the prepared PCR result. It consists of introducing into a donor vector having a genetic recombination site of attP2. In turn, master vectors, called so-called entry clones, are produced, which contain important fragments having the site of genetic recombination of attL1 and attL2. The system includes several human, mouse, and rat genes (http://mgc.nci.nih.gov) as well as frogs (Xenopus, http://xgc.nci.hih.gov) and zebrafish (http: //xgc.nci.nih.gov) to produce mass clones of organisms. We also generated entry vectors using gateway cloning techniques for some full-length clones. Moreover, the first version of the human ORFeome containing 8,076 human ORFs was recently generated using gateway cloning technology (Rual et al., 2004).

The C2 domain, a conserved protein module of more than 120 amino acids, was initially defined as being the same as the C2 regulatory site of PKC (protein kinase C) (Newton and Johnson, 1998). The domain is currently known to be present in numerous signaling proteins, phosphorylases, GTPase-activating proteins, ubiquitination enzymes, and proteins involved in vesicle migration in eukaryotic cells. Furthermore, Benz et al. 2005 recently suggested that the C2 domain of PKCδ can directly bind to phosphotyrosine. Coffin 9 (Copine 9, CPNE9) belongs to a new family of Coffin family of ubiquitous calcium-dependent phospholipid-binding protein (Ca ^{2 +} -dependent phospholipidbinding proteins) have been cloned recently (Xie et al., 2004) . The role of coffin 9 in neuronal differentiation is not yet described.

Currently, there have been few reports of functional cloning in the genome range of specific genes using gateway cloning techniques, and HTP gateway cloning techniques for C2 domains have been shown to promote differentiation of neurons in C2 domains. none. In addition, although gateway cloning technology is an effective means for multi-gene cloning, substantial expression vectors labeled with fluorescent proteins have not been commercially available, and expression vectors for gateways labeled with red fluorescent proteins are currently available. None reported. In addition, the process of constructing an entry clone for a gene of interest by performing the gateway cloning technique includes producing a PCR product having a specific nucleotide sequence by producing sequence specific primers. Whether the desired gene of interest has been introduced into the expression vector can be said to be determined in the design of the PCR primer. In particular, if the PCR primers are strictly designed, genes of interest may be hardly introduced into the expression vector. On the contrary, when the PCR primers are flexibly designed, unwanted genes may be introduced into the expression vector.

Accordingly, the present inventors have made diligent research efforts to overcome the problems of the prior art, and in the present invention, a new sequence-specific primer for human C2 domain was newly designed to perform a gateway cloning technique, and a red fluorescent protein containing C2 domain was used. Expression clones expressing labeled proteins were newly produced and then introduced into hippocampal progenitor cells to analyze the role of the C2 domain as a whole. In the present invention, expression clones labeled with red fluorescent protein containing 60 representative human C2 domains were collectively introduced into hippocampal progenitor cells, and two C2 domains selected from 60 representative human C2 domains (PKCδ-C2 and CPNE9-C239). It was confirmed that the) promotes the differentiation of neurons, and completed the present invention.

Therefore, the main object of the present invention is to provide a vector for producing a red fluorescent protein fusion protein that can be transduced at high speed using a gateway cloning technique, and can easily perform a comprehensive analysis of the genome.

Another object of the present invention is to provide a composition for differentiating nerve cells containing a C2 domain gene or an expression peptide thereof labeled with a red fluorescent protein.

According to an aspect of the present invention, the present invention is a multi-cloning site is located in the 3 'direction of the CMV promoter, attR1 site and attR2 site is located in the 3' direction of the multi-cloning site, between the attR1 site and attR2 site Destination vector having a cleavage map of FIG. 1, wherein the chloramphenicol resistance gene (CM ^R ) and the suicide ccdB box are located, and the red fluorescent protein (RFP) gene is located in the 3 'direction of the attR2 site. Destination vector). The destination vector of the present invention is a vector containing all of the promoter, antibiotic resistance gene (for example, CM ^R gene) sequence, attR1 and attR2 sequences, and ccdB sequence information, which are sequences required for expression, and attR1 and attR2 sequence specific gene recombination. The vector can be easily transduced by carrying out the reaction. Protein expressed by the characteristics of the destination vector is labeled with a red fluorescent protein in the C 'direction. In addition, the antibiotic resistance gene of the present invention may be any antibiotic resistance gene that is resistant to a specific antibiotic that can screen the introduction of the destination vector into the cell.

According to another aspect of the invention, the present invention is a multi-cloning site is located in the 3 'direction of the CMV promoter, a red fluorescent protein (RFP) gene is located in the 3' direction of the multi-cloning site, 3 of the red fluorescent protein gene Destination having a cleavage map of FIG. 3, wherein attR1 and attR2 sites are located in the 'direction, and chloramphenicol resistance gene (CM ^R ) and suicide ccdB box are located between the attR1 and attR2 sites Provide a Vector (Destination Vector). The protein expressed by the characteristics of the destination vector is labeled with a red fluorescent protein in the N 'direction. In addition, the antibiotic resistance gene of the present invention may be any antibiotic resistance gene that is resistant to a specific antibiotic that can screen the intracellular introduction of the destination vector.

According to an aspect of the present invention, the present invention is a multi-cloning site is located in the 3 'direction of the CMV promoter, attR1 site and attR2 site is located in the 3' direction of the multi-cloning site, between the attR1 site and attR2 site Chloramphenicol resistance gene (CM ^R , CAT gene, chloramphenicol acetyl transferase) and suicide ccdB box is located, the red fluorescent protein gene having a cleavage map of Figure 1 characterized in that the 3 'direction of the attR2 site is located An expression clone is provided wherein a region between an attR1 site and an attR2 site of a Destination Vector is replaced by an attL1 site, a C2 domain, and an attL2 site by an LR recombination reaction. The LR recombination reaction of the present invention is a cross-linking between the attR site and the attL site by treating the enzyme mixture including the protein of the bacteriophage λ Xis protein and Integrase (Integrase) and E. coli protein IHF (Integration Host Factor), respectively. Cross-over occurs and transduces the gene of interest with the destination vector.

According to one aspect of the invention, the present invention is a multi-cloning site is located in the 3 'direction of the CMV promoter, a red fluorescent protein gene is located in the 3' direction of the multi-cloning site, the 3 'direction of the red fluorescent protein gene Destination vector having a cleavage map of FIG. 3 characterized in that the attR1 site and the attR2 site are located, and the chloramphenicol resistance gene (CM ^R ) and the suicide ccdB box are located between the attR1 site and the attR2 site. Vector) provides an expression clone characterized in that the site between the attR1 site and the attR2 site is replaced by attL1 site, C2 domain, and attL2 site by LR recombination reaction.

According to one aspect of the invention, the present invention is a donor vector binding of the protein kinase δ (PKCδ) -C2 domain gene comprising primers having the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 Provide primer sets for making PCR products for The primer set of the present invention is a 5 'primer consisting of an attB1 sequence, a Kozak sequence and a start codon sequence (dark indication), and a site encoding a protein kinase δ (PKCδ) -C2 domain gene specific sequence. And a 3 'primer consisting of a site encoding attB2, a stop codon and a protein kinase δ (PKCδ) -C2 domain gene specific sequence.

According to an aspect of the present invention, the present invention is for donor vector binding of coffin 9 protein (CPNE9) -C2 domain gene comprising primers having the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 Provide primer sets for making PCR products. The primer set of the present invention comprises a 5 'primer consisting of an attB1 sequence, a Kozak sequence and a start codon sequence (dark designations), and a site encoding a coffin 9 protein (CPNE9) -C2 domain gene specific sequence, and It is a set of 3 'primers consisting of sites encoding the attB2, stop codon and coffin 9 protein (CPNE9) -C2 domain gene specific sequences.

According to an aspect of the present invention, the present invention provides a composition for differentiating neurons containing a C2 domain gene or an expression peptide thereof encoding the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In Example 4 of the present invention, it was demonstrated that the expression clone into which the C2 domain was introduced was transduced into neural progenitor cells (ex. HiB5) to differentiate neurites into elongated neurons. The amino acid of SEQ ID NO: 5 of the present invention is derived from the Ca ⁺⁺ binding domain of PKCδ protein as PKCδ-C2 (C2 domain of protein kinase Cδ), the amino acid of SEQ ID NO: 6 is calcium-dependent phospholipid binding protein (Ca ^{2 It} is derived from the Ca ⁺⁺ binding domain of the Copine 9 (CPNE9) protein, which belongs to the Coffin family, a new family of ⁺ -dependent phospholipidbinding proteins. The expression vector of the present invention may be any expression vector having a promoter capable of expressing the C2 domain and a multicloning site for cloning, but is preferably inserted into an expression vector for animal cell transformation. More preferably, it is characterized in that it is inserted between the attR1 site and the attR2 site of the destination vector (Destination Vector) having a cleavage map of FIG.

Hereinafter, gateway cloning technology, which is a method of producing the destination vector and an expression clone, of the present invention will be described in more detail step by step.

The gateway cloning technique originates in a site-specific genetic recombination system of bacteriophage λ that can be introduced into the DNA of an E. coli chromosome. E. coli has attP and bacteriophage λ has a genetic recombination site of attB. Lysogeny is carried out by two enzymes: Integrase is encoded in bacteriophage λ, and E. coli protein IHF (Integration Host Factor) is encoded in the E. coli chromosome. Genetic recombination between attB and attP upon integration produces attL (100nt) and attR (168nt) on both sides of the bacteriophage λ DNA. The process is reversible and excitation is also caused by intergrase and IHF together with the Xis protein, a protein of bacteriophage λ.

The ultimate goal of Gateway Reaction is to create expression clones. This is divided into two stages. The first step is to introduce the gene of interest into the entry vector by performing the BP reaction, and the second step is to subcloning the gene of interest into the destination vector by performing the LR reaction with the entry clone and the destination vector. ) To produce expression clones. Since the entry clone is not capable of transcription, in order for the gene of interest introduced into the entry clone to be expressed, all of the sequences necessary for expression, antibiotic resistance genes (for example, CM ^R ), attR1 and attR2 sequences, and ccdB sequence information are included. It must be subcloned into the destination vector. The entry clone and the destination vector undergo a reaction by processing the LR clonase enzyme mix, which is a specific and one-way reaction. AttL1 reacts with attR1 and attL2 with attR2, respectively. The LR response of genetic recombination produces a donor vector that is the intended expression clone and byproduct. The resulting expression clones can be selected by antibiotic resistance (Kan ^r , positive selection) and toxic ccdB protein (negative selection). Gateway cloning results in high levels of positive clones of at least 99%. One of the main advantages of the gateway cloning technique is that once an entry clone is produced, it is possible to perform an LR reaction to easily subclone the gene of interest to one of a wide variety of destination vectors, enabling a comprehensive analysis of the function of the gene. Is the point.

In the present invention, two totally optimized expression vectors (HTP-optimized expression vectors) were labeled with a red fluorescent reporter protein (RFP) gene. These vectors produce target proteins labeled with red fluorescent proteins in multiple expression systems using gateway cloning technology (GCT). Red fluorescent protein labels are fused with the cloned gene and allow for intensive analysis of the protein expressed in mammalian cells. The usefulness of the vector was assessed using a red fluorescent protein-screening system. Sixty representative human C2 domains were labeled with red fluorescent protein, and HiB5 neuronal progenitor cells; Ronald DG McKay et al., Region-specific differentiation of the hippocampal stem cell line HiB5 upon implantation into the developing mammalian brain, Cell Two C2 domains overexpressed in 1991 Aug 23; 66 (4): 713-29. And promoting neuronal differentiation of HiB5 cells were analyzed in detail. The expression vector obtained by using the red fluorescent protein-screening system of the genome range scale developed in the present invention has been shown to be useful in the functional analysis of genes.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

Example  1. Gateway Destination  vector( gateway destination vectors ) Production

The pDsRed-Monomer-N1 vector (Clontech) was used as the base vector for the destination vector (pDEST-N-RFP vector) of FIG. 1. The destination vector (pDEST-N-RFP vector) is a vector of the gene of interest in the 5 'direction of the RFP protein gene is a vector characterized in that the protein of interest is linked to the N' direction of the RFP protein is expressed. . Amplification of the pDEST 15 vector (Invitrogen), which provides a suicide ccdB box (Bernard and Couturier 1992) containing the ccdB gene, the chloramphenicol (CM) acetyl transferase (CAT) gene, and the attR site as a template, by PCR reaction I ordered, the PCR primers used are 5 has a BglII site (each 5'-GGG GGATCC CCACAAGTTTGTACAAAAAAGC-3 'and 5'-GGG TGATCA ACCACTTTGTACAAGAAAGC-3) as primers' BamHI and 3 as primers, respectively. PCR products were digested with BamHI and BglII restriction enzymes, and after treatment of BamHI restriction enzymes with the pDsRed-Monomer N1 vector, each fragment was conjugated with a lyase. As a result, a suicide ccdB box was introduced at the BamHI site of the pDsRed-Monomer-N1 vector to produce a destination vector (pDEST-N-RFP vector). Here, the BamHI restriction enzyme recognizes the G gatcc sequence and the BglII restriction enzyme recognizes the A gatct sequence. Therefore, when the BamHI restriction enzyme is recombined after the enzyme treatment, the G gatct sequence is generated and changed into a nucleotide sequence that cannot be cut by the BamHI and BglII restriction enzyme. Therefore, the produced destination vector has the advantage of using the BamHI and BglII restriction enzyme sites of the parent vector as it is. The above process is shown in the schematic diagram of FIG.

The pDEST-RFP-C vector (FIG. 3) used pEGFP-C1 (Clontech) vector as a base vector. Use pDsRed-Monomer-N1 vector and a 5 as the template having a BamHI site (5'-GGG ACCGGT CGCCACCATGGACAACACCGAGG-3 ' and 5'-GGG GGATCC GGACTGGGAGCCGGAGTGGCG-3' ) in the primer, the primer AgeI and 3 'primers, respectively PCR reactions were performed and PCR products containing the DsRed-Monomer gene were produced. Also it used a BglII site (each 5'-GGG AGATCT AACAAGTTTGTACAAAAAAGC-3 'and 5'-GGG GGATCC TCA AACCACTTTGTACAAGAAAGC-3 ) in the primer' BamHI and 3 as primers, 5 were amplifying the ccdB suicide box in the pDEST15 vector, respectively. Bold underlined stop codons were added to the 3 'primer to prevent labeling of unnecessary amino acids. PCR products containing the DsRed-Monomer gene were digested with restriction enzymes of AgeI and BamHI, and PCR products containing suicide ccdB box genes were digested with restriction enzymes of BamHI and BglII. A fragment of the PCR product produced by treating the restriction enzyme was introduced into the BamHI site located in AgeI and the multicloning site of the pEGFP-C1 vector as a base vector to produce a destination vector (pDEST-RFP-C, FIG. 3). The destination vector (pDEST-RFP-C) is a vector of the gene of interest in the 3 'direction of the RFP protein gene is a vector characterized in that the gene of interest is linked to the C' direction of the RFP protein is expressed. At this time, the BamHI restriction enzyme recognizes G gatcc sequence and the BglII restriction enzyme recognizes A gatct sequence. Therefore, when the enzyme is recombined after each enzyme treatment, the G gatct sequence is generated and changed into a nucleotide sequence that cannot be cut by BamHI and BglII restriction enzyme. . Eventually, the AgeI site of the base vector and the AgeI site of the PCR product containing the DsRed-Monomer gene are conjugated, and the BamHI site of the base vector and the restriction enzyme site of BamHI or BglII of the PCR product containing the suicide ccdB box gene are conjugated. The BamHI site of the PCR product containing the DsRed-Monomer gene and the restriction enzyme site of BamHI or BglII of the PCR product containing the suicide ccdB box gene are conjugated. The process is illustrated in FIG.

Example  2. Fused Red Fluorescent Protein C2  Construction of Expression Vectors Incorporating Domains

The new red fluorescent protein labeled expression vector of the invention was determined to be based on cloning based on genetic recombination using the GCT plasmid series (Invitrogen). Gateway cloning technology (GCT) uses site-specific gene recombination reactions on so-called entry vectors (pENTRs) to produce the desired expression vectors, which are then used to clone the desired genes. pDEST). Using the cloning system, it is possible to easily produce each expression vector containing several genes of interest in one process. In the present invention, a destination vector comprising a red fluorescent protein coupled with a suicide ccdB box was designed. The gene encoding the red fluorescent protein (DsRed-Monomer protein) used in the destination vector we developed is the pDsRed-Monomer gene (Figs. 1 and 3), and this reporter protein is Discosoma sp . sp . ) Is a monomeric mutant protein derived from the tetrameric red fluorescent protein DsRed (Matz et al., 1999). Gateway recombination reactions were performed with the entry vector containing the desired gene to produce a new destination vector expressing the red fluorescent protein under the immediate-early promoter of cytomegalovirus.

Entry clones of the human C2 domain were constructed as follows. Initially, 175 published C2 domains with conserved sites in the 250 proteins listed in the database of Pfam (www.sanger.ac.uk/Software/Pfam) and NCBI (www.ncbi.nlm.nih.gov) I identified it. Reverse transcription PCR (PCR) reactions were performed to obtain human C2 domain genes. Total RNA isolated from human brain tissue, placental tissue, and HeLa cells were isolated using TRIZOL (Invitrogen, CA) kit according to the protocol, and 1 μg of the isolated mixed RNA was superscript II RT (Invitrogen). Reverse transcription was performed for 1 hour at random hexamer (50 pmol), dNTPs (1 mM) and 42 ° C. The cDNA generated in the reverse transcription reaction was amplified in a PCR instrument (GeneAmp 2400, Perkin Elmer, MA) using a high PCR premix (HiPi PCR premix, Elpis-Biotech, Korea). When performing the PCR reaction, human C2 domains were PCR amplified from complementary DNA (cDNA) using target sequence specific attB1 / attB2 primers. The 5 'primer consisted of a Kozak sequence, a start codon sequence (dark) and an attB1 sequence (underlined) (5'-GGGG ACAAGTTTGTACAAAAAAGCAGGCT CCACCATG- [gene specific 20-25 sequence] -3'). Further 3 were composed of 'primer 5'-GGGG ACCACTTTGTACAAGAAAGCTGGGTT TTA [gene-specific sequence 20 to 25] -3'. The underlined attB2 sequence was introduced immediately after the last stop codon of the dark marker, so that the C2 gene introduced between attB1 and attB2 forms an ORF. The primers are shown in Table 1 below, in which the lowercased portions are complementary sequences for the target genes.

TABLE 1

  PCR reaction was performed with the primers to produce a PCR product containing a human C2 domain gene. At this time, the PCR reaction conditions were (deaturation): 94 ° C, 30 seconds; Annealing: 57 ° C., 30 seconds; Extension: repeated 25 cycles at 72 ° C, 45 seconds, after amplification was observed by electrophoresis on 2% agarose gel and stained with EtBr. The recombinant DNA generated as a result of PCR was introduced into the pDONR207 donor vector (Invitrogen), and as a result, the base sequence of the C2 domain inserted into the generated entry vector was confirmed to confirm that it matches the base sequence of the target C2 domain (Macrogen Inc.). ). Entry vectors into which 150 human C2 domains were introduced were generated by performing the BP reaction of gateway cloning technology (GCT). From these, 60 entry clones were randomly selected and introduced into the destination vector (pDEST-RFP-C) via the LR response of the gateway cloning technique.

Example  3. cell culture, holistic transduction, and Adenovirus  infection

HiB5 cell lines with infinite proliferation contain 0.11 mg / ml sodium pyruvate, 7 mg / ml NaHCO3, 50 U / ml penicillin, 50 μg / ml streptomycin, and 10% fetal bovine serum (FBS) One Dulbecco's modified Eagle's medium (DMEM) was incubated at 33 ° C. and 5% CO ₂ . As is known in the art (Kwon, 1997; Sung et al., 2001), cells are differentiated for differentiation at 39 ° C 5 μg / ml insulin, 100 μg / ml transferrin, 20 nM progesterone, 30 nM selenium, 60 μM fu Incubation was for 2 days in chemically purified N2 medium containing trecine, 0.1 mg / ml sodium pyruvate, and 2 mM glutamine. Expression clones incorporating human C2 domains were introduced into 33 ° C HiB5 cells prepared in 96-hole plates. Under semi-automatic manipulation conditions, each expression vector (200 ng) was introduced using liposome transfection reagent (lipomal transfection reagent, lipofectamin 2000, Invitrogen) and contained more than 10,000 HiB5 hippocampal progenitor cells. introduced into the well. After further incubation for 48 hours, cell images were analyzed using an In Cell Analyzer 1000 automated high-content imaging system (Amersham Biosciences). This was followed by screening for human C2 domains that induce neurite outgrowth of HiB5 cells. In addition, two replication-defective adenoviruses (rAd5) were prepared, including green fluorescent protein-labeled CPNE9-C2 and PKCδ-C2 (Neurogenex Co., Korea), respectively. HiB5 cells were infected at 90% level at 50 multiplicity of infection (MOI).

Example  4. Image analysis and immunocytochemistry

Cells expressing the screened C2 domain were reanalyzed by red fluorescent protein fluorescence detection using a 60-fold fixed confocal microscope (Olympus Fluoview FV 1000) equipped with an inverted microscope (Olympus BX81). It was. The excitation light source is a 543-nm ray of green HeNe laser. Before reaching the photo multiplier tube, the emission fluorescence was passed through a 580-nm (40-nm wide) primary barrier filter. Laser intensity was minimized to prevent dye bleaching. The digital image output was 512 x 512 pixels with 32 bit resolution. Cells were covered with glass coverslips at 4 × 10 ⁴ cells / ml level for image analysis. After two days the cells were washed twice in Dulbecco's solution and monitored under the same focus microscope. By modifying the immunocytochemical protocol (Choi et al. 2005), HiB5 cells grown on coverslips (4 × 10 ⁴ cells) were fixed in 4% formaldehyde and permeabilized in cold methanol for 5 minutes. And 4 ° using the primary pan-neuronal neurofilament marker monoclonal antibody (SMI 311; Covance Research Products) to neurofilamment (NF; 1: 500). Incubated overnight at C. The next day the cells were washed and treated with fluorescein isothiocyanate (FITC) binding secondary antibody (HTP transfection) or Cy3-conjugated secondary antibody (rAd infection) for 1 hour at room temperature. All images were taken under the same co-focus microscope.

Example  4. HiB5  In neuronal differentiation of cells C2  Overall Screening of Presumptive Roles of Domains

To screen the C2 domains involved in the differentiation of neurons, we randomly selected 60 entry clones containing human C2 domains, which were then transformed into pDEST-RFP-C expression vector by LC reaction of the gateway cloning technique. Introduced (FIG. 5 and Table 2).

TABLE 2

Red fluorescent protein labeled expression vectors were transiently transfected with HiB5 hippocampal progenitor cells in 96 pore plates. Images of cells were captured after 48 hours of culture and the effect of the C2 domain on neurite proliferation was assessed (FIG. 6). HiB5 cells refer to pluripotent hippocampal stem cell lines isolated from the hippocampus of 16-day-old mouse embryos, where progenitor cells of pyramidal cells begin to proliferate (Renfranz et al., 1991). HiB5 expresses the stem cell marker nestin, grows at a permissive temperature of 33 ° C., and proliferates indefinitely by the temperature-sensitive SV40 large T antigen. When incubated in N2 medium at a non-permissive temperature of 39 ° C, these cells stop growing and many die. However, 30-40% of the cells survive and less than 30% of the surviving cells differentiate into neurite-like structures. In the present invention, the effect of the C2 domain on the formation of these neuron-like structures at 33 ° C. was measured. As a result, we screened six C2 domains, which appear to promote the formation of neurite-like structures, and selected the C2 domains of PKCδ-C2 and coffin 9 (CPNE9-C2) from among the six C2 domains to analyze the function of these genes. It was. To confirm that the selected PKCδ-C2 and CPNE9-C2 are involved in the induction of neurite outgrowths, each red fluorescent protein labeled C2 domain was introduced into HiB5 cells and their ability to induce morphological changes in the cells was identical. Observation was made with a focus microscope. Since PKCδ-C2 and CPNE9-C2 were fused to red fluorescent proteins, they were transformed into expression clones into which PKCδ-C2 and CPNE9-C2 were introduced by observing the presence of neurites, defined as elongations longer than the length of both cell bodies. Detecting the cells was very easy. In FIG. 7, the cells expressing the genes of PKCδ-C2 and CPNE9-C2 have delineated neurites-like structures. In addition, neuronal differentiation was checked by immunocytochemistry of neuronal differentiation marker, neurofilament, and overexpression of PKCδ-C2 or CPNE9-C2 was transformed cells with neurites at the permissible temperature. This led to an increase in numbers (FIG. 8).

Because only 30-40% of HiP5 survived in N2 medium at 39 ° C. unacceptable temperature, the effect of transduction was very low under these conditions, making it difficult to assess the activity of the transduced genes. Therefore, we constructed a recombinant adenovirus (www.newgex.com), which was commissioned by Nux Co., Ltd., containing green fluorescent protein labeled CPNE9-C2 and PKCδ-C2 to overcome the low efficiency of transduction. The effect of selected C2 domains on neuronal differentiation at 39 ° C. was measured. As shown in FIG. 9, PKCδ-C2 and CPNE9-C239 clearly increased the number of cells with neurites at 39 ° C.

In conclusion, the new destination vector of the present invention can be successfully applied to the overall screening of cell image data. In addition, since the fluorescence of red fluorescent protein can be easily distinguished from the fluorescence of EGFP, the two vectors combine red fluorescent protein with a green fluorescent protein labeled system to allow simultaneous irradiation of two or more important proteins (Fig. 7).

[references]

As described above, according to the present invention, in a cDNA, a specific gene or a specific domain is selectively inserted into a destination vector to produce an expression clone, and the produced expression clone is used to express the function of a specific gene in a cell. As can be easily observed in, high-throughput (HTP) can quickly detect the role in cells of genes that perform homologous functions conserved in the genome. In addition, a composition for inducing differentiation of neurons may be produced using an expression vector comprising CPNE9-C2 and PKCδ-C2 obtained in the functional analysis of the C2 domain through the destination vector produced in the present invention.

1 is a cleavage map of a red fluorescent protein labeled destination vector. The vector has a multicloning site in the 3 'direction of the CMV promoter, an attR1 site and an attR2 site in the 3' direction of the multicloning site, and a chloramphenicol resistance gene (CM) between the attR1 site and the attR2 site. ^R ) and the suicide ccdB box are located, and the destination vector is a red fluorescent protein located in the 3 'direction of the attR2 site.

FIG. 2 is a manufacturing schematic diagram of the destination vector of FIG. 1.

3 is a cleavage map of a red fluorescent protein labeled destination vector. The vector has a multi-cloning site in the 3 'direction of the CMV promoter, a red fluorescent protein in the 3' direction of the multi-cloning site, an attR1 site and an attR2 site in the 3 'direction of the red fluorescent protein, the attR1 It is a destination vector having a cleavage map of FIG. 3 characterized by the location of the chloramphenicol resistance gene (CM ^R ) and the suicide ccdB box between the site and the attR2 site.

FIG. 4 is a manufacturing schematic diagram of the destination vector of FIG. 2.

FIG. 5 is a schematic diagram illustrating a step of cloning into a donor vector (pDONR207 vector) by a C2 domain and BP reaction in which reverse-transcription polymerization chain reaction is carried out with a primer including attB1 / attB2.

Figure 6 shows the phenotype of hippocampal progenitor cells (HiB5) transformed with a destination vector (pDEST-RFP-C2 expression vector) in a 96-hole plate. The image was taken by an HTP imaging system.

FIG. 7 is a diagram illustrating C2 domains selected for screening in hippocampal progenitor cells (HiB5) under the same focal microscope. The ability of these C2 domains to induce neurite outgrowths was confirmed by the immune response to neurofibrils.

Figure 8 is a quantitative number of hippocampal progenitor cells with red fluorescent protein positive and neurites at 33 ° C.

9 is a diagram quantifying the number of hippocampal progenitor cells with green fluorescent protein positive and neurites at 39 ° C.

<110> Gyeongsang National University industry and academy cooperation foundation <120> Gateway RFP-Fusion Vectors for High Throughput Functional          Analysis of Genes <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> 5 'PCR primer for PKC delta-C2 domaim <400> 1 ggggacaagt ttgtacaaaa aagcaggctc caccatggcg ccgttcctgc gcatcgc 57 <210> 2 <211> 56 <212> DNA <213> Artificial Sequence <220> 3 'PCR primer for PKC delta-C2 domain <400> 2 ggggaccact ttgtacaaga aagctgggtt ttactccagg aaatactgaa cagaca 56 <210> 3 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> 5'PCR primer for CPNE9-C2 domain <400> 3 ggggacaagt ttgtacaaaa aagcaggctc caccatggcc atgtctctcg gcgga 55 <210> 4 <211> 54 <212> DNA <213> Artificial Sequence <220> 3223 PCR primer for CPNE9-C2 domain <400> 4 ggggaccact ttgtacaaga aagctgggtt ttaacccgtg agggttcgct ctac 54 <210> 5 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> PKC delta-C2 domain <400> 5 Ala Pro Phe Leu Arg Ile Ala Phe Asn Ser Tyr Glu Leu Gly Ser Leu   1 5 10 15 Gln Ala Glu Asp Glu Ala Asn Gln Pro Phe Cys Ala Val Lys Met Lys              20 25 30 Glu Ala Leu Ser Thr Glu Arg Gly Lys Thr Leu Val Gln Lys Lys Pro          35 40 45 Thr Met Tyr Pro Glu Trp Lys Ser Thr Phe Asp Ala His Ile Tyr Glu      50 55 60 Gly Arg Val Ile Gln Ile Val Leu Met Arg Ala Ala Glu Glu Pro Val  65 70 75 80 Ser Glu Val Thr Val Gly Val Ser Val Leu Ala Glu Arg Cys Lys Lys                  85 90 95 Asn Asn Gly Lys Ala Glu Phe Trp Leu Asp Leu Gln Pro Gln Ala Lys             100 105 110 Val Leu Met Ser Val Gln Tyr Phe Leu Glu         115 120 <210> 6 <211> 129 <212> PRT <213> Artificial Sequence <220> <223> CPNE9-C2 domain <400> 6 Ala Met Ser Leu Gly Gly Ala Ser Glu Arg Ser Val Pro Ala Thr Lys   1 5 10 15 Ile Glu Ile Thr Val Ser Cys Arg Asn Leu Leu Asp Leu Asp Thr Phe              20 25 30 Ser Lys Ser Asp Pro Met Val Val Leu Tyr Thr Gln Ser Arg Ala Ser          35 40 45 Gln Glu Trp Arg Glu Phe Gly Arg Thr Glu Val Ile Asp Asn Thr Leu      50 55 60 Asn Pro Asp Phe Val Arg Lys Phe Val Leu Asp Tyr Phe Phe Glu Glu  65 70 75 80 Lys Gln Asn Leu Arg Phe Asp Val Tyr Asn Val Asp Ser Lys Thr Asn                  85 90 95 Ile Ser Lys Pro Lys Asp Phe Leu Gly Gln Ala Phe Leu Ala Leu Gly             100 105 110 Glu Val Ile Gly Gly Gln Gly Ser Arg Val Glu Arg Thr Leu Thr Gly         115 120 125 Leu      

Claims (11)

delete A red fluorescent protein (RFP) gene is located in the 3 'direction of the CMV promoter, an attR1 site and an attR2 site are located in the 3' direction of the red fluorescent protein gene, and a chloramphenicol resistance gene is located between the attR1 site and the attR2 site. A destination vector with a cleavage map of FIG. 3, characterized in that (CM ^R ) and a suicide ccdB box are located and manufactured by the manufacturing process of FIG. delete C2 encoding the amino acid sequence of the attL1 site, SEQ ID NO: 5 or SEQ ID NO: 6 of the entry clone in which the human C2 domain has been introduced in the LR recombination reaction between the attR1 site and the attR2 site of the destination vector of claim 2 An expression clone characterized by being substituted with a domain and an attL2 site. delete delete delete delete delete A composition for differentiating neurons containing an expression clone according to claim 4. Preparing a plurality of human C2 domain genes; Preparing an entry clone generated by introducing a PCR product including the C2 domain gene into a donor vector and performing an BP reaction of a gateway cloning technique with the entry vector into which the human C2 domain is introduced; Preparing an expression clone by performing LR recombination reaction between the entry clone and the destination vector of claim 2; Transfecting said expression clone into neural stem cells; Using a confocal microscope to observe whether the neural stem cells are differentiated into neurite-like cells.

Images