KR100994632B1 - Screening method of controlling agent for expression of CPT-1 gene, and CPT-1 expression enhancer comprising genistein which is screened by the method - Google Patents

Abstract

The present invention provides a recombinant plasmid comprising a CPT-1 promoter and luciferase; Huh7 cell line transformed with the plasmid (Accession No .: KCLRF-BP-00090); It relates to a screening method of a chemical substance that specifically regulates the expression of the CPT-1 gene in the transcriptional step, characterized by using the cells,

In addition, the present invention, CPT-1 expression promoter comprising the genistein detected by the screening method as an active ingredient; And it relates to a beta oxidation promoter of a fatty acid containing the genistein found by the screening method as an active ingredient.

Genistein, CPT-1 gene, beta oxidation promoter of fatty acids.

Description

Screening method of chemical substance that specifically regulates expression of CT-1 gene in transcription step and CPT-1 expression promoter comprising genistein detected by the method as an active ingredient {Screening method of controlling agent for expression of CPT-1 gene , and CPT-1 expression enhancer comprising genistein which is screened by the method}

Figure 1 shows a plasmid comprising firefly luciferase coding sequence linked to the CPT-1 promoter.

2 shows increased luciferase activity by genistein in single cells containing the CPT-1 promoter-luciferase fusion construct.

3 is a graph showing the increase in CPT-1 expression in the HepG2 cell line by genistein at the mRNA level.

Figure 4 is a graph showing the increase in CPT-1 expression in HepG2 cell line by Genistein, Figure 4a is a result of Western blotting using an antibody specific for CPT-1 of the cell, Figure 4b is Figure 4a Is a graph quantified using an image analysis program.

CPT-1 is a group of proteins expressed in hepatocytes, cardiomyocytes, and skeletal muscle cells, including at least two or more 82-88 kilodalton (kd) proteins known as CPT-1L and CPT-1M. Genome 9, 608-610; J Biochem 119,533; PNAS 92, 1984; Genomics 40, 209-211) This protein is located in the mitochondria in the cell and functions to move fatty acids in the cytoplasm into the mitochondria, a site of beta oxidation. Reported. (Mamm. Genome 9, 608-610; J Biochem 119,533; PNAS 92, 1984; Genomics 40, 209-211). CPT-1, which is located at the contact sites of the mitochondrial outer membrane and whose activity is regulated by acetyl Co-A carboxylase 2, is an enzyme that determines the rate of beta oxidation of fatty acids, and the expression of different isotypes in cells and tissues is different. Reported (Mamm. Genome 9, 608-610; J Biochem 119,533; PNAS 92, 1984; Genomics 40, 209-211).

Beta oxidation and ketone formation, which are caused by long-term fasting, are an important part of fatty acid metabolism in the liver, a process that changes the free energy accumulated in adipocytes into ketone bodies that can be used by the central nerve, along with the depletion of stored glucogen. During fasting, beta oxidation of fatty acids by the hepatocytes reaches a maximum, and the amount of oxaloacetate in mitochondria is reduced, thereby limiting Krebs cycle activity, and as a result, acetylcoa produced by beta oxidation is introduced into ketone bodies. (Biochem Biophys Acta 1092: 277-283).

The activity of beta oxidation of fatty acids during fasting is primarily caused by increased activity of carnitine palmitoyl transferase-1 (CPT-1), and fatty acid migration into the mitochondria mediated by this enzyme has been reported to determine the rate of fatty acid beta oxidation. (Proc Natl Acad Sci USA 72: 4385-4388; J Bio Chem 259: 12030-12-33).

Enzyme activity of CPT-1 has been reported to be regulated by the concentration in the cytoplasm of the allosteric inhibitor maloniccoei and the cytoplasmic concentration of L-carnitine (Proc Natl Acad Sci USA 72: 4385-4388; J Bio Chem 254 : 8163-8168). Malonic coa is produced by acetyl CoA carboxylase, and acetylcoa produced from citric acid, a product of the Krebs cycle, acts as a substrate, through which the mechanism of beta oxidation of fatty acids by CPT-1 activity is regulated. Progression is regulated by the requirement of the synthesis of ATP in the cell. Since L-carnitine in hepatocytes is very low during normal diet, it does not induce CPT-1 activity, but during long-term fasting, l-carnitine in skeletal muscle migrates into hepatocytes, causing a rapid increase in intracellular concentrations, inducing CPT-1 activity. This results in increased beta oxidation of fatty acids (Biochem J 310: 853-858).

In addition to increased enzyme activity, quantitative increase in CPT-1 following induction of CPT-1 gene expression may induce beta oxidation of fatty acids. CPT-1 gene expression is primarily regulated by hormones in vivo, such as insulin and glucagon.Increasing glucagon and decreasing insulin during fasting lead to increased CPT-1 gene expression (Biochem J 310: 853-858). ). Eicopentaenoic acid (EPA), a major omega-3 component of fish oil, has been reported to increase the expression of CPT-1 by unknown mechanisms, thereby increasing the beta oxidation of fatty acids (Metabolism 48: 1303-1313). Fibrate drugs that activate PPAR-alpha have also been reported to increase gene expression of CPT-1 (J Lipid Res 38: 1851-1858).

As such, basic research at the cellular level of CPT-1 activity and expression regulation has been reported, but for the development of high-speed, high-throughput screening systems for the screening of compounds that promote CPT-1 expression. Attempts and attempts to search for expression control compounds of naturally occurring CPT-1 have not been made.

Accordingly, the present inventors have devised a search system to find a naturally-derived substance that increases the decrease of fat in the human body by increasing the expression of CPT-1 and thereby increasing the beta oxidation of fatty acids, and search for thousands of natural products using the same. Was intended.

Accordingly, it is an object of the present invention to provide a method for screening compounds that specifically induce CPT-1 gene expression in the transcriptional step.

It is another object of the present invention to provide a CPT-1 expression promoter and a beta oxidation promoter of a fatty acid comprising the substance found by the above method as an active ingredient.

The inventors have devised a search system to find a substance of natural origin that increases the reduction of fat in the human body through increased expression of CPT-1 and thus increased beta oxidation of fatty acids. In addition, Genistein, a type of soy isoflavone known to have osteoporosis prevention effect, menopausal syndrome reduction effect, anticancer effect and cancer prevention effect, as a result of searching thousands of natural products using this, Increasing the expression of the gene encoding CPT-1 has been found to have the effect of promoting beta oxidation of fatty acids in vivo. That is, when injecting genistein into human cells, it was found that there is an effect of increasing the expression of the gene encoding CPT-1, thereby promoting the beta oxidation of fatty acids in vivo, and completed the present invention.

The present invention provides a recombinant plasmid comprising a CPT-1 promoter and luciferase; Huh7 cell line transformed with the plasmid (Accession No .: KCLRF-BP-00090); It relates to a screening method of a chemical substance that specifically regulates the expression of the CPT-1 gene in the transcriptional step, characterized by using the cells,

In addition, the present invention, CPT-1 expression promoter comprising the genistein detected by the screening method as an active ingredient; And it relates to a beta oxidation promoter of a fatty acid containing the genistein found by the screening method as an active ingredient.

The present invention produced a CPT-1 promoter-luciferase fusion plasmid and a cell line in which the plasmid was permanently transfected. Screening methods for identifying chemicals that specifically regulate the expression of the CPT-1 gene at the transcriptional stage are included. More specifically, genomic DNA was isolated from human blood cells, and the -29 kb region promoter region was amplified by a polymerase reaction and cloned into pGL3 luciferase basic vector (Promega Corporation). With this plasmid, pcDNA 3.1 vector (invitrogen) was transfected into Huh7 cell line for selection using neomycin (G418). A screening method is used to identify chemicals that specifically regulate the expression of the CPT-1 gene at the transcriptional stage using cell lines transfected with a CPT-1 promoter-luciferase fusion plasmid.

The present invention relates to a method for determining a compound that can act as a factor that specifically increases the expression of the CPT-1 gene. That is, the present invention includes a screening method for identifying chemicals that specifically regulate the expression of the CPT-1 gene at the transcriptional stage by using a reporter gene fused with the CPT-1 promoter region and a permanent cell line including the same. Specifically,

a) contacting said cell with a compound of interest to be tested;

b) quantitatively measuring the amount of signal generated in step a); And

C) determining whether the test chemical specifically regulates the expression of the gene in the transcription step by comparing the signal amount measured in step b) with that of the control group.

It relates to a screening method of chemicals that specifically control the expression of the CPT-1 gene at the transcriptional stage.

More specifically,

a) The regulatory transcriptional regulatory sequences, promoters of the CPT-1 gene, and chemicals previously unknown as regulators of protein biosynthesis can act as transcriptional regulators of sugar genes, which chemicals are caused by the reporter gene Under a condition that causes a detectable signal to be generated, a predetermined number of eukaryotic cells, each consisting of a DNA structure essentially comprising the reporter gene, which is detectable and connected to the promoter and under the control of the promoter, are contained. Contacting the sample with a predetermined concentration of the compound to be tested;

b) quantitatively measuring the amount of signal generated in step a); And

C) The amount of the signal detected in step b) is generated in the absence of any chemicals to be tested, or the signal detected when the sample in step a) is contacted with another compound. By comparing with the amount of, the test chemical is identified as a chemical that causes a change in the amount of detectable signal generated by the reporter gene, and whether the test chemical specifically regulates the expression of the gene at the transcriptional stage. Steps to determine whether

It relates to a method for screening a chemical that specifically regulates the expression of the CPT-1 gene at the transcriptional stage.

According to the screening method of the present invention, when genistein is contacted with cells as an effective concentration, it was confirmed that the effect on the concentration of transcriptional RNA of the CPT-1 gene and the protein encoded by the gene was determined. It includes information on the use of genistein as a compound that can specifically regulate the expression of in the transcription step.

The present invention confirmed that when Genistein was contacted with a human liver cancer cell line HepG2 (ATCC Number HB-8065) at an effective concentration, the concentrations of transcriptional RNA of the CPT-1 gene and the protein encoded by the gene were increased. More precisely, 3 hours after genistein treatment, CPT-1 gene expression increased more than 2 times from mRNA level, 3.5 times after 24 hours and 4.4 times after 48 hours. It was confirmed. In addition, it was confirmed by Western blotting method that the amount of CPT-1 protein increased depending on the concentration of genistein when treated with 2.5, 5, 10 μM (micromolar) in the same cell line. By increasing the gene expression of CPT-1 at the mRNA level and the protein level, the genistein of the present invention can pursue the physiological benefits of increased CPT-1 activity, promote fatty acid beta oxidation of hepatocytes, and thereby reduce body fat. .

Accordingly, another aspect of the present invention provides a CPT-1 expression promoter comprising genistein detected by the screening method of the present invention as an active ingredient; And it provides a beta oxidation promoter of a fatty acid containing the genistein detected by the screening method as an active ingredient.

Genistein is a natural substance contained in soybeans. It has been known to prevent osteoporosis, reduce menopause syndrome, anticancer effect and cancer prevention effect, and especially the anticancer effect of colorectal cancer and prostate cancer.

Acute toxicity (LD ₅₀ ) of mice by oral administration of genistein was relatively safe at 100-250 mg / kg.

The dosage of genistein is 1-50 mg per adult, and the dosage may be varied depending on the age and weight of the patient as well as the severity of symptoms.

CPT-1 expression promoters and beta oxidation promoters of fatty acids according to the present invention may be prepared in a form suitable for oral or parenteral administration according to conventional preparation methods. That is, in the case of oral administration, it may be prepared in the form of tablets, capsules, solutions, syrups, suspensions, etc., and in the case of parenteral administration, it may be prepared in the form of injections for intraperitoneal, subcutaneous, muscle, and transdermal. .

Hereinafter, the present invention will be described in more detail with reference to the following examples, which are not intended to limit the scope of the present invention.

Example 1 Molecular Cloning of CPT-1 Promoter-Luciferase Fusion Constructs

[Step 1] Cell Line and Cell Culture

Human hepatoma cell line Huh7 was incubated in DMEM medium (Dulbecco's modified Eagle's Medium, Gibco 1210-0038) containing 10% fetal calf serum. ₂ incubators.

[Step 2] Molecular Cloning

This column describes the molecular cloning of the CPT-1 promoter and adjacent transcriptionally controllable 5 'regulatory sequences and the construction of structures in which these regulatory sequences are intended to regulate the expression of the firefly luciferase gene. Unless otherwise stated, the cloning procedure was essentially performed according to Maniatis et al., 1982.

After genomic DNA is isolated from human blood, the primer region of Table 1 and Pfu polymerase (Strategene) are used to amplify the promoter region of CPT-1 and digest with Kpn I and BamHI. The two primers correspond to the -29126 to -29106 and -26690 to -26674 portions of the CPT-1 gene, with the forward primers having the KpnI restriction site and the reverse primer having the Bgl II restriction site ( http). http://www.ncbi.nlm.nih.gov/entrez/ Genbank AJ420748). PCR amplification conditions were carried out 20 cycles of 1 minute at 95 ° C, 1 minute at 52 ° C, and 2 minutes at 72 ° C. The base sequence of this fragment was confirmed by DNA sequencing. The pGL3 luciferase basic vector, purchased from Promega Corporation, was linearized by KpnI and BglII digestion and then ligated into the promoter fragment of amplified CPT-1 above to generate vector pCPT-1P (FIG. 1). This construct was used to transfect Huh7 cell lines as described below.

Primer sequences used to amplify the CPT-1 promoter region Primer Type
Sequence number Restriction enzyme Sequence (underline is restriction enzyme recognition site) P1
(-29 kb) Forward primer One Kpn I 5 ' GGGGTACCCC GAATGAATGAATGAACGAATG 3'
Reverse primer 2 BamHI 5 ' CGGGATCCCG CGTGCGCATAAAATCGC 3'

Example 2 Construction and Screening of Single Cell Clones Containing CPT-1 Promoter-Luciferase Fusion Constructs

Huh7 by calcium phosphate precipitation (Biochem. J. 309,913-919) using pCPT-1P of FIG. 1 (Fig. 1) and the antibiotic resistant plasmid pcDNA 3.1 vector (Pharmacia), commercially available from kit (Pharmacia). The cells were cotransfected. After two days the cells were transferred to DMEM medium containing 0.4 mg / ml G418 and grown for another 10-14 hours. Once a sufficient number of cells are obtained, reporter Lysis buffer (Promega) is added to confirm production of constituent luciferase and the cells are destroyed by one freeze-thaw method. 100 μl (microliter) of Luciferase Assay Reagent (Promega) was added to 10 μl (microliter) of the supernatant obtained by centrifugation, and the activity was measured using a TD 20/20 luminometer (Turner Designs). Total protein was measured using BioRad's Protein assay dye and then luciferase activity was corrected. The clones were then analyzed on the basis of several criteria, such as sufficient adherence to the microtiter plate used for high throughput screening and acceptable standard deviations in several luciferase expression assays. Transfected promoter-luciferase fusion plasmids have been demonstrated to react with transcriptional step inducers in the same way as predicted based on published literature. It was confirmed that luciferase activity was increased by EPA and fibrate drugs, which were reported to increase the expression of conventional CPT-1, and genistein was found to be effective when various natural products were searched. The results are shown in FIG.

Example 3 Increase of CPT-1 mRNA Synthesis in HepG2 by Genistein

[Step 1] Cell Line and Cell Culture

HepG2, a human hepatoma cell line, was incubated in DMEM medium (Dulbecco's modified Eagle's Medium, Gibco 1210-0038) containing 10% fetal calf serum. ₂ incubators.

[Step 2] Increased CPT-1 mRNA Synthesis by Genistein

Each cell line incubated in step 1 was trypsinized to form a single cell suspension, and 1 x 10 ⁶ aliquots were dispensed into T75 flasks and incubated for 24 hours. Thereafter, DMEM medium without bovine serum is treated and incubated for 24 hours, followed by dissolving Genistein at a concentration of 10 μM (micromolar) in medium without bovine serum. Cells were harvested at the specified 3, 6, 24, 48 hours after Zenistein treatment, washed with cooled phosphate buffer (PBS) and 1 ml of TRIzol ^TM reagent (Life Technologies, Inc.) was added to total RNA. Extraction was performed for quantitative real-time PCR. Two primers and internal probes of CPT1 for real-time PCR were designed using Primer Express software (PE Biosystems) .The sequence was forward primer, SEQ ID NO: 3, and reverse primer was sequence. No. 4, and the internal probe is shown in SEQ ID NO: 5.

The internal probe is labeled with FAM dye (6-carboxyfluorescein), a reporter at the 5 prime end, and TAMRA (6-carboxytetramethyl-rhododamine, a quencher) at the 3 prime end, and the 3 prime end is designed to block extension The amount of CPT-1 mRNA in total RNA was proportional to the intensity of fluorescence measured in ABI prism 7700 sequence detection system (PE Biosystems): 50 mM KCl, 10 mM tris-HCl (pH 8.3), 5 mM MgCl ₂ , To 50 μl (microliter) of PCR reaction buffer of 100 μM (micromolar) dNTP were added two primers of 600 nM, 1 μM (micromolar) of probe, and reacted by adding 0.5 U Taq DNA polymerase. Reverse transcription was carried out at 48 ° C for 30 minutes using the prism 7700 sequence detection system, and after activating Taq DNA polymerase at 95 ° C for 10 minutes, PCR reaction proceeded through 40 cycles of 15 seconds at 95 ° C and 1 minute at 64 ° C. The intensity of fluorescence was also ABI pr It was measured using the ism 7700 sequence detection system (PE Biosystems), and its quantitative results were calculated as cycle threshold (Ct) values, the cycles at which the fluorescence intensity of the sample was significantly different from the initial value. From this, the relative amount of CPT-1 normalized using GAPDH values can be obtained, and the result is shown in Fig. 3. The gene expression of CPT-1 is expressed from mRNA level at 3 hours after genistein treatment. It increased more than 2 times, 3.5 times after 24 hours, and 4. 4 times after 48 hours.

Example 4 Increase of CPT-1 Protein Synthesis in HepG2 by Genistein

[Step 1] Cell Line and Cell Culture

HepG2, a human hepatoma cell line, was incubated in DMEM medium (Dulbecco's modified Eagle's Medium, Gibco 1210-0038) containing 10% fetal calf serum. ₂ incubators.

[Step 2] Increased CPT-1 Protein Synthesis by Genistein

Each cell line incubated in step 1 was trypsinized to form a single cell suspension, and 1 x 10 ⁶ aliquots were dispensed into T75 flasks and incubated for 24 hours. Subsequently, treated with DMEM medium that does not contain bovine serum and incubated for 24 hours, and then dissolves 2.5, 5, and 10 μM (micromolar) concentration of genistein in medium without bovine serum. Cells were harvested and washed with chilled phosphate buffer (PBS) at 24 hours after genistein treatment and washed with 8 M urea, 2% CHAPS, 50 mm DTT, 2 M thiourea, 2 mM PMSF, 100 μg / μl leupeptine After treatment with 500 μl of protein extraction buffer, it is left at room temperature for 10 minutes. After centrifugation at 15,000 g of gravity acceleration for 10 minutes at 4 ℃, the supernatant is collected and the protein is quantified using BIO-Rad Protein Dye Reagent ^™ . 20 μg (micrograms) of protein are separated by size using 8% SDS-PAGE and blotting onto PDF (BioRad) membrane at 50 V for 12 hours. After blocking this blot with a 5% nonfat milk solution for 1 hour, use polyclonal anti-CPT1 (Alpha Diagnostic International) as the primary antibody and anti-rabbit IgG (amersham) combined with horse radish peroxidase as the secondary antibody. Amersha enhanced chemiluminescence (ECL) kit was used. The reacted blot was developed after photosensing on an X-ray Fuji film to confirm the degree of protein expression. Bands on the film were scanned using PowerLook 2100 XL (Umax) and analyzed using ImageMaster 2D Elite (Amersham Bioscience) image analysis program. When Genistein was treated with 2.5, 5, and 10 μM (micromolar), it was confirmed that the amount of CPT-1 protein increased by 3 times, 3.2 times, and 5.6 times, respectively, compared with the untreated. (Figure 4)

Formulation Preparation Example 1 Tablet

Genistein 1.0 mg

Lactose BP 150.0 mg

Starch BP 30.0 mg

Pregelatinized Corn Starch BP 15.0 mg

1.0 mg magnesium stearate

Genistein is sieved and mixed with lactose, starch and pregelatinized corn starch, then a suitable volume of purified water is added and granulated into a powder. The granules were dried and then mixed with magnesium stearate and compressed to obtain tablets.

Formulation Preparation Example 2 Capsule

Genistein 1.0 mg

Starch 1500 100.0 mg

1.0 mg magnesium stearate

Genistein was sieved and mixed with excipients and filled into gelatin capsules to obtain capsules.

Formulation Preparation Example 3 Injection

Genistein 1000 ㎍ / ml

Dilute hydrochloric acid BP up to pH 3.5

Injectable sodium chloride BP up to 1 ml                     

Genistein was dissolved in an appropriate volume of sodium chloride BP for injection, and the pH of the resulting solution was adjusted to pH 3.5 with diluted hydrochloric acid BP, then the volume was adjusted with injection of sodium chloride BP and thoroughly mixed. The solution was filled into a 5 ml Type 1 ampoule of clear glass, dissolved in glass and enclosed under an upper grid of air, then sterilized by autoclaving at 120 ° C. for at least 15 minutes to obtain an injection.

As described above, the present invention provides a reporter gene fused with a CPT-1 promoter region that can be used as a screening method for identifying chemicals that specifically regulate the expression of the CPT-1 gene at the transcriptional stage, and a permanent cell line comprising the same. do. In addition, genistein, which has been reported to be effective in preventing osteoporosis, reducing menopausal syndrome, anticancer effect, and cancer prevention, specifically increases the expression of CPT-1 gene at the mRNA and protein levels and promotes beta oxidation of fatty acids in cells. It provides the fact that it has new efficacy as a substance. This provides a new high-dose, high-speed retrieval method for the search for new natural-derived compounds that can be used as safety additives for natural obesity inhibitors and dietary foods.

<110> Amorepacific Corporation <120> Screening method of controlling agent for expression of CPT-1          gene, and CPT-1 expression enhancer comprising genistein which is          screened by the method <130> 2003dp147 <150> KR10-2002-0085064 <151> 2002-12-27 <160> 5 <170> KopatentIn 1.71 <210> 1 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for P1 (-29 kb) using for amplification of CPT-1          promoter region <400> 1 ggggtacccc gaatgaatga atgaacgaat g 31 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for P1 (-29 kb) using for amplification of CPT-1          promoter region <400> 2 cgggatcccg cgtgcgcata aaatcgc 27 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CPT-1 using for real-time PCR <400> 3 catcatcact ggcgtgtacc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> Reverse primer for CPT-1 using for real-time PCR <400> 4 ttgagcaagt gctgtcatcc 20 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Internal probe for CPT-1 using for real-time PCR <400> 5 aaacggccaa ctgcatgtcc agcca 25

Claims (7)

A recombinant plasmid in which a promoter region consisting of -29126 to -26674 sites of a carnitine palmitoyl transferase 1 (CPT-1) gene known as GenBank AJ420748 is fused to luciferase. The recombinant plasmid pCPT-1P-luc according to claim 1, which has the following genetic map.

Huh7 cell line transformed with the plasmid of claim 1 and deposited with accession number: KCLRF-BP-00090. A method for screening chemicals that specifically regulates the expression of the CPT-1 gene at the transcriptional stage, using the cell of claim 3. The method of claim 4, wherein a) contacting the cell of claim 3 with a compound of interest; b) quantitatively measuring the amount of signal generated in step a); And C) determining whether the test chemical specifically regulates the expression of the gene in the transcription step by comparing the signal amount measured in step b) with that of the control group. A method for screening a chemical that specifically regulates the expression of the CPT-1 gene at the transcriptional stage. delete delete

Images