KR100986960B1 - Method for Analysis of Gene Methylation and Ratio Thereof - Google Patents

Abstract

In the present invention, when a gene is treated with sodium bisulfite in order to confirm methylation of a gene and then PCR is performed as a template, a primer (methylated specific primer) that enables amplification when the gene is methylated, A primer (non-methylated specific primer) that binds to a portion spaced from a portion of a gene to which the primer binds, and which is amplified when the gene is unmethylated, and a primer that is not affected by methylation (common primer) Simultaneously perform PCR using all of the genes so that the PCR product (methylated amplification product) when the gene is methylated according to the degree of methylation of the gene and the PCR product (nonmethylated amplification product) when the gene is unmethylated are different sizes. By amplifying to a method for analyzing the methylation and ratio of the gene.

Methylation, CpG sequence

Description

Method for Analysis of Gene Methylation and Ratio Thereof}

The present invention relates to a method for analyzing whether or not a gene is methylated, and more particularly, a primer that enables amplification when the gene is methylated, and a portion which is spaced apart from a portion spaced apart from a portion of the gene to which the primer binds. When the gene is unmethylated, PCR is performed simultaneously with both a primer capable of amplification and a primer unaffected by methylation, so that the PCR product and the gene when the gene is methylated according to the degree of methylation of the gene The present invention relates to a method for analyzing whether or not a gene is methylated by amplifying PCR products having different sizes when unmethylated.

Methylation on human DNA is limited in C of the CpG sequence, which is an evolutionary phenomenon. Generally, in vivo, cytosine in the CpG sequence is relatively easily converted to uracil by deamination, which in turn is converted to thymine by DNA repair, so that CG, which was the original sequence, cannot be maintained and is often converted to TG. It has evolved because it is not able to transmit information. For this reason, the frequency of CG sequences actually present among about 3 * 10 ⁹ human sequences is reported to be about 15% of the arithmetic expectation. In addition, the cytosine of CG thus preserved is methylated to prevent deamination and maintain the CG sequence.

However, unlike this general state, there is a nucleotide sequence region where CG appears repeatedly with a high frequency of about 40-50%, and this region is called CpG island. This CpG island is mainly present in the 5 'promoter region of the gene and is about 500-2000 bp in length. In particular, the cytosine of CpG at this site remains unmethylated, which is closely associated with the binding of transcription-induced proteins responsible for gene expression. Cancer suppressor genes such as RASSF1A and p16INK4A also contain CpG islands at the 5 'promoter site. In normal cases, they are unmethylated and transcription is easily maintained, and expression is well maintained, but cancer patients have high methylation frequency. It can also be seen that the amount of expression is also significantly reduced. These facts also suggest that cancer suppression genes cause cytosine methylation on the CpG island to interfere with access to the DNA of transcription-induced proteins, resulting in decreased expression, leading to cancer. Conversely, proto-oncozin, such as k-ras, has a CpG island at the 5 'promoter region, which is methylated and suppressed its expression in normal subjects, but is highly unmethylated and increased in protein expression in cancer patients. Able to know. As such, cytosine methylation of CpG islands is closely related to cancer development and is known to occur early in cancer development. Therefore, there are many attempts to develop specific genes that can be used as early diagnosis biomarkers for cancer. Many papers are published in leading magazines abroad.

The most common method that researchers now use to identify DNA methylation is to perform a chemical called bisulfite and then perform MSP (methylation specific PCR). When the genomic DNA is purely separated from the sample sample to be identified for methylation, and a chemical reaction using bisulfite is carried out, methylated cytosine is maintained but all other non-methylated cytosines are converted to uracil. PCR was performed using the converted DNA as a template, and two sets of non-methylated primers and methylated primers were independently prepared at positions including 3 to 4 CpG sequences among the nucleotide sequences of a specific gene to be identified. PCR. Each independently reacted product is analyzed to determine which amplification product is obtained by using which primer set. Each sample sample is identified for methylation. However, in this method, amplification using non-methylated specific primers and amplification using methylated specific primers are performed in different test tubes to confirm methylation in one sample. have.

First, it is impossible to determine the proportion of methylated DNA in the sample sample. In MSP, the methylated primer and the non-methylated primer are selected and produced at the site containing 3 to 4 CpG sequences, so that the Tm values of each of them are about 6 to 10 degrees. In order to compensate for the difference in amplification rate to the difference in Tm value, non-methylated primers are usually composed of oligonucleotides that are about 4 to 6 times longer than methylated primers, or when using non-methylated primers, the annealing temperature is lowered. PCR conditions will be different. As a result, even if the correction is to some extent, the amount of amplification products is inevitably different. In addition, due to the characteristic of PCR that the amount of amplified product is exponentially amplified as the cycle progresses, and the conventional limit is reached, the ratio of the methylated DNA in the sample before the amplification is analyzed for the non-methylated product and the methylated product after the amplification reaction. It is not maintained in poetry. Therefore, the general MS method can only confirm whether methylation is present in the DNA of the sample sample, and the ratio thereof becomes virtually difficult.

Second, it is a matter of overuse of sample samples. In general, the amount of converted DNA that can be obtained after bisulfite chemical reaction using 1 microgram of DNA is about 200 to 300 nanograms, which can be performed about 5 to 6 times of PCR. That's the amount. Therefore, when the amplification reaction using an unmethylated primer and a methylated primer independently, the number of genes that can confirm methylation is only about 3-4. If there are a large number of genes to be identified for methylation, such a general MS method may be limited.

Third, there is a difficulty in confirming the success of PCR due to the absence of the intrinsic control gene. If the result of the amplification reaction using a non-methylated primer and a methylated primer is negative, there is a critical problem that can not be confirmed whether or not due to a simple PCR error.

To solve these problems, various solutions such as bisulfite sequencing, combination of bisulfite and restriction enzyme assay (COBRA), pyrosequencing, methyl light, and golden gate The measures were studied. However, these methods also have many additional difficulties that many researchers in the general laboratory can easily use, which limits their use. In the case of bisulfite sequencing, the amplification product can be obtained by PCR using only one primer set common after the conversion of DNA through bisulfite treatment, but the site where the methylation is desired is high in the CpG sequence Since it exists as a primer, there is a restriction on sequencing in designing a site capable of simultaneously amplifying an unmethylated methylated amplification product as a primer, and additionally, sequencing through cloning after the amplification reaction has to be performed for several clones. There are disadvantages. In the case of pyro sequencing, methyllite, and golden gate method, it is difficult to carry out experimental analysis only with expensive dedicated analytical instruments and reagents that can be used only for each method, and in the case of COBRA method, it is limited again after amplification reaction. After enzymatic cleavage of amplification products, there are complex problems such as further experiments in which the amplification products are identified by electrophoresis. Therefore, there is a growing demand and desire for a technology that can easily and accurately determine the methylation and ratio of a sample without expensive equipment or additional reagents.

In order to overcome the problems of the prior art described above, the inventors of the present invention have treated a gene to identify methylation with sodium bisulfite and then carried out PCR with the template, which can be amplified when the gene is methylated. Primers (methylated specific primers), primers (non-methylated specific primers) which allow amplification when the gene is unmethylated, which binds to a portion spaced apart from a portion of the gene to which the primer binds, and PCR was carried out simultaneously using all primers (common primers) not affected by methylation, so that the PCR product (methylated amplification product) when the gene was methylated according to the degree of methylation of the gene and the PCR when the gene was unmethylated Products (non-methylated amplification products) are amplified to different sizes The present invention was completed by confirming whether or not the rate and ratio can be analyzed.

Accordingly, the present invention provides, in one aspect, the method comprising the steps of: (1) treating the sample DNA with sodium bisulfite;

(2) Using the sample DNA treated with sodium bisulfite as a template, as a primer,

(a) a first oligonucleotide consisting of a nucleotide sequence complementary to a first region containing 3-4 CpG sequences on a nucleotide sequence of a specific gene,

(b) complementary to the second region including 3-4 CpG sequences, which are located spaced apart from the first region by a predetermined base sequence, wherein the CpG sequence is regarded as an UpG sequence and is complementary thereto. A second oligonucleotide consisting of a nucleotide sequence and having the same orientation as the first oligonucleotide,

(c) a base sequence complementary to the third region, which does not include the CpG sequence, located apart from the first region and the second region, and is opposite to the first and second oligonucleotides Performing PCR using an aromatic third oligonucleotide;

(3) it provides a method for analyzing the methylation and ratio of a specific gene comprising the step of detecting the amplification product according to the PCR reaction.

As another aspect, (1) sodium bisulfite;

(2) the following primers:

(a) a first oligonucleotide consisting of a nucleotide sequence complementary to a first region containing 3-4 CpG sequences on a nucleotide sequence of a specific gene,

(b) complementary to the second region including 3-4 CpG sequences, which are located spaced apart from the first region by a predetermined base sequence, wherein the CpG sequence is regarded as an UpG sequence and is complementary thereto. A second oligonucleotide consisting of a nucleotide sequence and having the same orientation as the first oligonucleotide,

(c) a base sequence complementary to the third region, which does not include the CpG sequence, located apart from the first region and the second region, and is opposite to the first and second oligonucleotides Tertiary oligonucleotides having aromaticity;

(3) Provides a kit for methylation and rate analysis of a specific gene, including dNTP and DNA polymerase capable of amplifying a specific gene.

One aspect of the present invention relates to a method for analyzing whether or not a specific gene is methylated. This analysis method includes the following steps.

First step : treating sample DNA containing the gene for which methylation is to be confirmed with sodium bisulfite

'Sample DNA' refers to DNA isolated from cancer cells of a subject for which methylation is to be confirmed, for example, a patient who is to diagnose cancer through methylation confirmation. The DNA may be genomic DNA or fragments thereof. The method of separating DNA from cells can be carried out according to conventional methods known in the art. For example, commercially available kits for DNA separation may be used.

The gene to be identified for methylation (also referred to as a 'specific gene') may be the entirety of the sample DNA, or preferably a fragment thereof. Certain genes in the present invention may be regulatory sequences, including not only coding sequences but also leader sequences, polyadenylation sequences, promoters, enhancers, upstream activation sequences, signal peptide sequences, and transcription terminators. In the present invention, the specific gene is preferably a promoter. The length of the promoter is generally about 500-2000 bP. In addition, two or more specific genes may be used in the present invention.

By treating the sample DNA with 'Sodium Bisulfate', methylated cytosine is maintained on the base sequence of the sample DNA, and unmethylated cytosine is converted to uracil.

Second step : PCR using the primer of the present invention using the sample DNA treated with sodium bisulfite as a template

(1) primer of the present invention

The assay method of the present invention is characterized by using the following three oligonucleotides as primers.

That is, a first oligonucleotide is used which consists of a nucleotide sequence complementary to a first region (base sequence) containing 3-4 CpG nucleotide sequences on a nucleotide sequence of a specific gene. Cytosine (C) in the first region to which the first oligonucleotide binds is considered to be methylated and not converted to uracil (U) by sodium bisulfite, so that the guanine (G) at the corresponding position of the first oligonucleotide ) Is designed to come. In the present invention, the first oligonucleotide is abbreviated as "methylated specific primer".

In addition, complementary to the second region (base sequence) containing 3-4 CpG sequences, which are spaced apart from the first region by a predetermined base sequence, the CpG sequence is regarded as an UpG sequence The second oligonucleotide is used to include the base sequence complementary thereto and has the same orientation as the first oligonucleotide. Cytosine in the CpG sequence within the second region to which the second oligonucleotide binds is unmethylated and is considered to be changed to uracil similar to thymine (T) by sodium bisulfite. Design the adenine (A) at the location. In the present invention, the second oligonucleotide is abbreviated as "non-methylated specific primer".

In addition, a base sequence complementary to the third region, which does not include the CpG base sequence, spaced apart from the first region and the second region, and has a direction opposite to the first and second oligonucleotides. A third oligonucleotide having Cytosine in the third region to which the third oligonucleotide binds is considered to be all converted to uracil, similar to thymine (T) by sodium bisulfite, so that adenine (A) is present at the corresponding position of the third oligonucleotide. Design to come. In the present invention, the oligonucleotide is named "common primer".

In the primer of the present invention, the predetermined interval between the first region and the second region may be any size, and is set in consideration of the following three points. First, the PCR products are electrophoresed and then set on the gel at intervals that can easily distinguish the size of the unmethylated and methylated products.

Second, if the size difference between the unmethylated product and the methylated product is too large, two problems may occur when checking the unmethylated and methylated ratio. In other words, since the non-methylated product and the methylated product are amplified at the same time, a competition reaction occurs. At this time, if there is a large difference in size between the two products, a large difference occurs in the amplification rate. Will be affected. In addition, although similar amounts of amplified products are amplified by PCR, the proportions of the products may be calculated differently by using a larger amount of dye (eg, EtBr). Third, CpG in the base sequence of the CpG island is mostly methylated or unmethylated in the same pattern, but in some genes, there may be a cluster (cluster) in which methylation is different inside the CpG island of one promoter. As a result, if the distance between the unmethylated and methylated specific primer becomes too wide, it may be located in another cluster. Therefore, in the present invention, the predetermined distance between the first region and the second region is not particularly limited, but 40 to 50 bp is preferable.

In addition, in the primer of the present invention, the first oligonucleotide and the second oligonucleotide are designed to have the same orientation, and the third oligonucleotide is designed to have the opposite orientation to the oligonucleotides. For example, if the first and second oligonucleotides have a 5 '→ 3' aromatic (or sense), the third oligonucleotide is designed to have a 3 '→ 5' aromatic (or antisense). In the present invention, it is preferable that the first and second oligonucleotides are designed to have antisense and the third oligonucleotide has sense orientation.

In addition, the primer of the present invention is 50 to 70 ℃, preferably 55 to 65 ℃, most preferably about 60 ℃ melting temperature (Tm); It is suitable to design an oligonucleotide of size 10 to 50 bp, preferably 20 to 25 bp, including a GC ratio of about 35-55%, preferably about 40-50%.

The type of primer used for synthesizing the primer of the present invention may include a polymer form of deoxynucleotides or a polymer form of Peptide Nucleic Acid (PNA), or both. Any polymer form that can be used as a primer in PCR can be used, such as a polymer with a miss match form in the middle.

Primers of the present invention uses (one that can be purchased for example, Bio-Search, Applied Biosystems ^TM, etc.) any method known to be capable of oligonucleotides synthesized nucleoside tie in the art, for example, automatic DNA synthesizer You can also synthesize.

(2) PCR of the present invention

In the analysis method of the present invention, all PCR (Polymerase Chain Reaction) methods known in the art may be used. PCR is described, for example, in US Pat. No. 4,683,195; US Patent No. 4,683,194; Saiki et al. Science, 1985, vol. 230, pp. 1350-1354; Scharf et al. Science, 1986, vol. 324, pp. 163-166; Kogan et al. New Engl. J. Med., Vol. 317, pp. 986-990 and the like.

PCR typically involves (1) denaturation of DNA; (2) annealing of primers; (3) DNA synthesis (polymerization or elongation) step. The denaturation of DAN in the present invention can be achieved by heating at about 80 to 96 ℃ as known in the art and the higher the temperature is easier to separate (denaturation) into single-stranded DNA, but if the temperature is too high activity of the DNA polymerase The proper temperature should be set. The binding of the primer to the isolated single-stranded DNA (ie, template) is typically performed at 37 to 65 ° C, but the temperature may vary depending on various factors such as the GC content and size of the primer. When the primer is bound to the template, nucleotides complementary to the template are sequentially bound from the ends of the primers, thereby causing DNA synthesis, which is typically performed at 60 to 75 ° C. In the present invention, it is suitable to perform denaturation, annealing, and synthesis of DNA 30 to 40 times, preferably 35 times.

In the present invention, it will be preferable to perform PCR under conditions suitable for the synthesis of DNA. In general, PCR is performed in a buffer solution of about pH 7 to 9, preferably about pH 8. In the present invention, a buffer solution containing HEPES or glycine-NaOH, a phosphate buffer solution, and the like may be used, and it is particularly preferable to use a buffer solution containing Tris-HCl at a concentration of 10 to 100 mM. In the present invention, the buffer solution may contain a monovalent salt at a concentration of about 10 mM to 60 mM. Commonly used monovalent salts include KCl. NaCl and (NH ₄ ) ₂ SO ₄ , and the like, but are not limited thereto.

Deoxynucleotide triphosphate dATP, dCTP, dGTP and dTTP as a component of the PCR reaction should be added to the PCR reaction in an amount sufficient to amplify the sequence of the specific gene of interest to the desired amount. dNTPs may be added to the PCR reaction preferably at a concentration of about 0.75 to 4.0 mM, more preferably at a concentration of about 2.0 to 3.0 mM.

The PCR reaction product should include a DNA polymerase that catalyzes the reaction of sequentially connecting nucleotides complementary to the nucleotide sequence of the template DNA from the end of the primer. In the present invention, all DNA polymerases known in the art may be used, and examples thereof include E. coli DNA polymerase, Klenow fragment of E. coli DNA polymerase, T4 DNA polymerase and the like. However, since PCR is usually performed at a high temperature, the DNA polymerase used in the present invention preferably has a stable property at a high temperature. In the PCR according to the present invention, all thermally stable DNA polymerases known in the art may be used, and it is particularly preferable to use Taq polymerase, for example, Amplitaq-gold enzyme.

As shown in FIG. 2, the PCR of the present invention may generate various amplification products depending on whether or not a specific gene is methylated. If a particular gene is fully demethylated, non-methylated specific primers will bind to that gene, resulting in a PCR product (also referred to as an 'unmethylated amplification product'). If a particular gene is fully methylated, the methylation specific primer will bind to that particular gene, resulting in a PCR product (also referred to as a 'methylated amplification product'). If methylation and demethylation are mixed in a particular gene, both unmethylated and methylated amplification products will be produced. Furthermore, when the specific gene is predominantly methylated, the methylation specific promoter will bind to the specific gene with a higher probability than the non-methylated specific promoter to produce predominantly methylated amplification products, whereas the specific gene is predominantly unmethylated. The non-methylated specific promoter will bind to this particular specific gene with a higher probability than the methylated specific promoter, resulting in a predominantly unmethylated amplification product.

In the present invention, as described above, since the first and second oligonucleotides are designed to be spaced apart at regular intervals, the unmethylated amplification products and the methylated amplification products have different sizes by the intervals. For example, if the interval is 40-50bp, the size of the non-methylated amplification product and the methylated amplification product is 40-50bp difference. Therefore, the unmethylated amplified product and the methylated amplified product can be easily identified by the detection of the amplified product described later.

Third Step : Detection of Amplified Products

In the present invention, the PCR product obtained through the PCR of the previous step is preferably detected by electrophoresis. 'Electrophoretic' refers to a method of separating a specific material in an electric field according to size and charge, and typically, a specific material is loaded on a cathode and an electric field is applied to induce the material to move while moving to the anode. Agarose, agarose-acrylamide or polyacrylamide gel and the like can be generally used for electrophoresis of a material consisting of nucleotides, but is not limited thereto.

Methods of preparing and staining gels used for the aforementioned electrophoresis are known in the art. For example, a method for staining agarose gel using ethidium bromide is described by Boerwinkle et al. PNAS, 1989, vol. 86, pp. 212-216. In addition, a method of dyeing a polyacrylamide gel using silver is (1) Goldman et al. Electrophoresis, 1982, vol. 3, pp. 24-26; (2) Marshall, Electrophoresis, 1983, vol. 4, pp. 269-272; (3) Tegelstrom, Electrophoresis, vol. 7, pp. 226-229 and (4) Allen et al. Bio Technique, 1989, vol. 7, pp. 736-744 and the like.

 In the present invention, by arithmetically calculating the condensation of a band appearing on the gel of electrophoresis by the amplification product, it is possible to confirm the presence and ratio of methylation of a specific gene.

The analytical method of the present invention described above is briefly abbreviated as "Dual Specific Bisulfite PCR (DSBP)".

Another aspect of the invention relates to a kit that can analyze the methylation and ratio of specific genes. The kit includes the following components:

That is, (1) sodium bisulfite; (2) the following primers:

(a) a first oligonucleotide consisting of a nucleotide sequence complementary to a first region containing 3-4 CpG sequences on a nucleotide sequence of a specific gene,

(b) complementary to the second region including 3-4 CpG sequences, which are located spaced apart from the first region by a predetermined base sequence, wherein the CpG sequence is regarded as an UpG sequence and is complementary thereto. A second oligonucleotide consisting of a nucleotide sequence and having the same orientation as the first oligonucleotide,

(c) a base sequence complementary to the third region, which does not include the CpG sequence, located apart from the first region and the second region, and is opposite to the first and second oligonucleotides Tertiary oligonucleotides having aromaticity; And

(3) dNTPs and DNA polymerases that can amplify specific genes.

The assays and kits of the present invention can be used to diagnose cancer in one aspect. In other words, cancer is diagnosed by comparing the methylation and the ratio of a specific gene in normal cells with the methylation and the ratio of the gene in cancer cells. It is generally known that promoters of cancer suppressor genes (e.g., RASSF1A, p161INK4A) are unmethylated in normal cells and methylated in cancer cells. Therefore, if a specific gene is a promoter of cancer suppressor genes, it is cancerous if the methylation rate is high. Diagnosis can be made. In addition, it is generally known that a promoter of a carcinogenic gene (e.g., k-ras) is methylated in normal cells and demethylated in normal cells, so that when a specific gene is a promoter of a carcinogenic gene, cancer is high when the demethylation rate is high. It can be diagnosed as Examples in this regard will be described in the detailed description for carrying out the invention.

Since the methylation specific antisense primer and methylation specific antisense primer are reacted with one common sense primer through a competition reaction in one in vitro to synthesize amplification products, the methylation ratio of a specific gene can be maintained after the amplification reaction. have.

In addition, since one or more amplification products are synthesized whether a non-methylated amplification product or a methylated amplification product for a specific gene, the problem of risk of false negative determination due to PCR error can be fundamentally solved.

In addition, since the non-methylated amplification product and the methylated amplification product can be simultaneously performed by only one PCR, the amount of DNA treated with sodium bisulfite is reduced, so that much more genes of interest can be identified.

In addition, the size of the product amplified by the common sense primer and the non-methylated specific antisense primer and the product amplified by the common sense primer and the methylated specific antisense primer can be arbitrarily controlled to further increase the price of methylation for multiple genes. This can be checked without purchasing equipment or reagents.

Hereinafter, specific examples of the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited to these Examples.

Example  One: Genomic DNA Separation and Bisulfite  process

Using the kit, genomic DNA was extracted from the lung cancer cell lines Calu6 and H358 and the patient's sputum, and the concentration was measured using Nano Drop. Thereafter, about 1-2 g of the extracted DNA was mixed with sodium hydroxide at 0.5 N concentration, and 16 μl of the extracted DNA was reacted for 15 minutes at 37 ° C. to transform the DNA into a single-stranded form. Then, sodium bisulfate at 3.5 M and hydroquinone reagent at 0.01 M were added and chemically reacted at 56 ° C. for 16 hours. After the precipitation reaction using ethanol to concentrate only the transformed DNA, purely separated and dissolved in 50 μl of 3 distilled water, add sodium hydroxide to 0.1 M concentration and react for 15 minutes at room temperature to desulfurization of cytosine Concentrated again by ethanol precipitation, and finally dissolved in 30 μl of tertiary distilled water and stored at -20 ℃.

Example  2: methylation standard positive sample DNA  Ready and Bisulfite  process

In order to prepare a standard positive control sample necessary for confirming the sensitivity and specificity of the DSBP method, an enzyme reaction using Sss1 methyllaser was performed on DNA isolated from Calu6, a lung cancer cell line. Sss1 enzyme was purchased from New England Biolabs, Inc., and the reaction conditions were as follows. 5 μg of DNA is mixed with 2 buffer solution provided with enzyme, SAM ( S- Adenosylmethionine) added to the final 0.16 M concentration, and 10 units of Sss1 enzyme. Finally, additional tertiary distilled water was added to make the total reaction solution 100 ㎕, mixed well, mixed, and reacted at 37 ° C for 1 hour to methylate cytosine of all CpG sequences to form a standard positive sample. gave. Thereafter, the reaction was completed by further incubation at 65 ° C. for 20 minutes to inactivate Sss1 enzyme by heat denaturation. Thus prepared standard positive DNA is subjected to bisulfite conversion by the method described in Example 1.

Example 3: Design and Synthesis of DSBP Primers for HOX D9, HOX D11, HOX D13 Genes

To design the DSBP primers, the standard sequences for the CpG islands of the HOX D9, HOX D11, and HOX D13 genes were identified, and the common sense primers, unmethylated specific antisense primers, and methylated specific antisense primers were prepared according to the conditions described above. Designed and synthesized. The unmethylated amplification products of HOX D9, HOX D11, and HOX D13 genes were 108bp, 183bp, and 117bp, respectively, and the methylated amplification products were 148bp, 232bp, and 162bp, respectively. The base sequence of each primer is as follows.

DSBP Common Sense Primer

HOX D9-Common: 5'-GTGTGAGTAGGGAGAGAGG-3 '(SEQ ID NO: 1)

HOX D11-Common: 5'-CTACCTTCTACTACCCCCTT-3 '(SEQ ID NO: 2)

HOX D13: 5'-GAGGTTTATAGAGGGAGAGAG-3 '(SEQ ID NO .: 3)

DSBP unmethylated specific antisense primer

HOX D9-unmethylated: 5'-CAACCACAAAAACACCAAACCA-3 '(SEQ ID NO: 4)

HOX D11-unmethylated: 5'-GTTTTATGAGGTAGTGTTTGGG-3 '(SEQ ID NO: 5)

HOX D13-unmethylated: 5'-CATCCCAACAAACACAAACACA-3 '(SEQ ID NO .: 6)

DSBP methylation specific antisense primer

HOX D9-Methylation: 5'- AACTTCCGAACCGCGAACG-3 '(SEQ ID NO: 7)

HOX D11-Methylation: 5'-TTTATAGCGCGGTGGGTCG-3 '(SEQ ID NO .: 8)

HOX D13-Methylation: 5'-CAAAACCGAAAACTACCGCCG-3 '(SEQ ID NO .: 9)

Table 1 shows some standard sequences for the CpG islands of the HOX D9, HOX D11, and HOX D13 genes for which methylation is to be confirmed, and the positions where the DSBP primers of each gene bind.

 HOX D9 Amplified Product Standard Sequence Methylation products GTGTGAGTAGGGAGAGAGG CGAGGGGAGAACAGCTCCCCTCGGGCGCTAGGGGCCGCCCCGAGGGCCCGCCTGCCTCGGGCGACACCGGCCTGGCGCCCCCGCGGCCGCTCCGTGTGCCCTGGACTCGC CGCCCG (SEQ ID NO: 10) Non-methylated products GTGTGAGTAGGGAGAGAGG CGAGGGGAGAACAGCTCCCCTCGGGCGCTAGGGGCCGCCCCGAGGGCCCGCCTGCCTCGGGCGACAC CGGCCTGGCGCCCCCGCGGCCG (SEQ ID NO: 11)  HOX D11 Amplified Product Standard Sequence Methylation products TCTACAGCGCGGTGGGCCG CAATGGCATCTTGCCACAGGGCTTCGACCAGTTCTACGAGGCAGCGCCCGGGCCCCCGTTCGCCGGGCCGCAGCCCCCGCCGCCACCCGCGCCGCCACAGCCCGAGGGCGCAGCCGACAAGGGCGACCCCAGGACCGGGGCTGGTGGCGGCGGGGGCAGTCCCTGCACCAAGGCGACCCCTGGCTCGGAGCCC AAGGGGGCAGCAGAAGGCAG (SEQ ID NO: 12) Non-methylated products GTTCTACGAGGCAGCGCCCGGG CCCCCGTTCGCCGGGCCGCAGCCCCCGCCGCCACCCGCGCCGCCACAGCCCGAGGGCGCAGCCGACAAGGGCGACCCCAGGACCGGGGCTGGTGGCGGCGGGGGCAGTCCCTGCACCAAGGCGACCCCTGGCTCGGAGCCC AAGGGGGCAGCAGAAGGCAG (SEQ ID NO: 13)
 HOX D13 Amplified Product Standard Sequence Methylation products AGAGAGAAAGGAGAGGAGGG AGGAGGCGCGCCGCGCCATGGTGTCCTGCGCGGGGCCAGGGCCAGGGCCGGGGCCGGGCCAGGCCGGGCCATGAGCCGCGCCGGGAGCTGGGACATGGACGGGCTGCGGGCAGACGGCGGGGG CGCCG Number column Non-methylated products AGAGAGAAAGGAGAGGAGGG AGGAGGCGCGCCGCGCCATGGTGTCCTGCGCGGGGCCAGGGCCAGGGCCGGGGCCGGGCCAGGCCGGGCCATGAGC CGCGCCGGGAGCTGGGACATG (SEQ ID NO .: 15)

Example 4: Amplification of the Converted DNA by DSBP

In order to perform PCR on the HOX D9, HOX D11, and HOX D13 genes, the DNA which was previously converted to bisulfite was mixed with each reagent under the following conditions.

First, the common sense primer, unmethylated specific antisense primer, and methylated specific antisense primer for each gene were mixed to 10 μΜ, respectively, to prepare HOX D9 DSBP primer mix, HOX D11 DSBP primer mix, and HOX D13 DSBP primer mix. Was prepared.

1 μl of DSBP primer mix of each gene was prepared, 2 μl of 10 × PCR buffer 2 (100 mM Tris HCl (pH 8.3), 15 mM MgCl ₂ , 500 mM KCl, 0.01% gelatin), 2.5 mM dNTP mixture (2.5 mM dATP, 2 μl of 2.5 mM dGTP, 2.5 mM dTTP, 2.5 mM dCTP), 1.0 unit of Amplitaq-Gold Polymerase (Applied Biosystem), and distilled water were adjusted to 18 μl in total, followed by 2 μl of modified DNA to confirm methylation. PCR was carried out under the following conditions by the addition of. After 5 minutes at 94 ° C, 15 seconds at 94 ° C, 30 seconds at 62 ° C (-0.5 ° C / cycle), and 20 cycles were performed under conditions of 50 seconds at 72 ° C. Further 20 cycles were carried out under the condition of reacting 30 seconds at 50 ° C. and 50 seconds at 72 ° C., and finally reacting at 72 ° C. for 7 minutes. When PCR was performed under these conditions, all of the HOX D9, HOX D11, and HOX D13 genes were able to perform amplification well without any special optimization.

Example 5: Confirmation of the result of DSBP amplification products by electrophoresis

5 μl of the amplification products of the HOX D9, HOX D11, and HOX D13 genes amplified by the DSBP reaction in Example 4 were prepared using 1 μl of 6 × DNA agarose gel loading buffer (0.25% bromophenol blue, 0,25% xylene cyanol, 30). % glycerol) was loaded on 2.5% agarose gel and electrophoresed at 150 V for 30 minutes. Thereafter, the agarose gel image recognition device including the Ultra-LUM device to determine the methylation by checking the band of the non-methyl, methyl amplification products amplified by each sample DNA. Thereafter, the amount of each amplified product was arithmetic using a program capable of arithmetic band band including the 1Dscan EX program, and the methylation ratio of each gene was measured.

Example 6: Results of confirming the sensitivity of DSBP to HOX D9, HOX D11, HOX D13

Example 6-1: Checking the sensitivity of DSBP to the HOX D9 gene

Sensitivity of DSBP to the HOX D9 gene was confirmed using the standard positive sample DNA methylated from the Calu6 cell line using the Sss1 methyllaser to methylate the cytosine of all CpG sequences. Indicated.

In FIG. 3, lane 1 is a negative control using tertiary distilled water instead of template DNA, and lane 2 is an amplification product obtained by performing DSBP on the HOX D9 gene using DNA obtained by bisulfite conversion of 100% Calu6 DNA, and lane 3 Is an amplification product obtained by reacting 99% Calu6 DNA with Sss1, mixing 1% of methylated Calu6 DNA, and then performing bisulfite-converted DNA as a template and performing DSBP on the HOX D9 gene, and lane 4 shows 95% Calu6 DNA and Sss1. After reacting 5% methylated Calu6 DNA, the bisulfite-converted DNA was amplified by performing DSBP on the HOX D9 gene as a template, and lane 5 was methylated Calu6 DNA 10 by reacting 90% Calu6 DNA with Sss1. After mixing%, the bisulfite-converted DNA was amplified by performing DSBP on the HOX D9 gene as a template. Lane 6 was mixed with 25% methylated Calu6 DNA by Sss1 reaction with 75% Calu6 DNA. Fight converted DNA into template HOX The amplification product was a DSBP for the D9 gene, lane 7 is 50% Calu6 DNA and Sss1 reacted to mix 50% methylated Calu6 DNA, and then the bisulfite-converted DNA as a template to perform the DSBP for the HOX D9 gene Lane 8 is an amplification product obtained by reacting 10% Calu6 DNA with Sss1, mixing 90% of methylated Calu6 DNA, and performing DSBP on the HOX D9 gene using bisulfite-converted DNA as a template. 5% Calu6 DNA was reacted with Sss1, and 95% methylated Calu6 DNA was mixed. Bisulfite-converted DNA was amplified by performing DSBP on the HOX D9 gene as a template, and lane 10 was 1% Calu6 DNA and Sss1. After reacting with 99% methylated Calu6 DNA, the bisulfite-converted DNA was amplified by performing DSBP on the HOX D9 gene as a template, and lane 11 was Sss1 and bisulfite methylated Calu6 DNA. Converted DNA to Template HO Amplification product that performed DSBP on X D9 gene.

As shown in FIG. 3, the proportion of methylated amplified products of HOX D9 gradually increases in proportion to the proportion of DNAs that were methylated by Sss1 conversion, and the concentration of non-methylated amplified products gradually decreased as expected. have.

Example 6-2 Sensitivity of DSBP to HOX D11 Gene

Sensitivity of DSBP to the HOX D11 gene was confirmed using the standard positive sample DNA methylated from the Calu6 cell line using the Sss1 methyllaser to methylate the cytosine of all CpG sequences. Indicated.

In FIG. 4, lane 1 is a negative control using tertiary distilled water instead of template DNA, and lane 2 is an amplification product obtained by performing DSBP on HOX D11 gene using DNA obtained by bisulfite conversion of 100% Calu6 DNA, and lane 3 Is an amplified product obtained by reacting 99% Calu6 DNA with Sss1, mixing 1% of methylated Calu6 DNA, and then performing bisulfite-converted DNA as a template and performing DSBP on the HOX D11 gene. Lane 4 shows 95% Calu6 DNA and Sss1. After reacting 5% methylated Calu6 DNA, the bisulfite-converted DNA was amplified by performing DSBP on the HOX D11 gene as a template, and lane 5 was 90% Calu6 DNA reacted with Sss1 to methylate Calu6 DNA 10 After mixing%, the bisulfite-converted DNA was amplified by performing DSBP on HOX D11 gene as a template. Lane 6 was mixed with 75% Calu6 DNA and Sss1 to mix 25% methylated Calu6 DNA. Fight transformed DNA into template The amplification product was subjected to DSBP for the HOX D11 gene, lane 7 is 50% Calu6 DNA and Sss1 reaction to mix 50% methylated Calu6 DNA, and then the bisulfite transformed DNA as a template for the DSBP for the HOX D11 gene Lane 8 is an amplification product obtained by reacting 10% Calu6 DNA with Sss1, mixing 90% methylated Calu6 DNA, and performing DSBP on HOX D11 gene using bisulfite-converted DNA as a template. 9 is an amplification product obtained by reacting 5% Calu6 DNA with Sss1 and mixing 95% methylated Calu6 DNA, and then performing bisulfite-converted DNA as a template and performing DSBP on the HOX D11 gene, and lane 10 with 1% Calu6 DNA. 99% of methylated Calu6 DNA was mixed by sss1 reaction, and then amplified product was subjected to DSBP to HOX D11 gene using bisulfite-converted DNA as a template, and lane 11 was bisulfated 100% of methylated Calu6 DNA by Sss1 reaction. Fight transformed DNA With the amplification products was performed on a DSBP D11 HOX gene.

As shown in FIG. 4, the proportion of methylated amplified products of HOX D11 is gradually increased in proportion to the proportion of the DNA methylated by Sss1 conversion, and the concentration of non-methylated amplified products is gradually decreased as expected. have.

Example 6-3: Results of confirming the sensitivity of DSBP to the HOX D13 gene

Sensitivity of DSBP to the HOX D13 gene was confirmed using the standard positive sample DNA methylated from the Calu6 cell line using the Sss1 methyllaser to methylate the cytosine of all CpG sequences.

In FIG. 5, lane 1 is a negative control using tertiary distilled water instead of template DNA, and lane 2 is an amplification product obtained by performing DSBP on HOX D13 gene using DNA obtained by bisulfite conversion of 100% Calu6 DNA. Is an amplification product of reacting 99% Calu6 DNA with Sss1, mixing 1% of methylated Calu6 DNA, and then performing bisulfite-converted DNA as a template and performing DSBP on the HOX D13 gene. Lane 4 shows 95% Calu6 DNA and Sss1. After reacting 5% methylated Calu6 DNA, the bisulfite-converted DNA was amplified by performing DSBP on the HOX D13 gene as a template, and lane 5 was methylated Calu6 DNA 10 by reacting 90% Calu6 DNA with Sss1. After mixing%, the bisulfite-converted DNA was amplified by performing DSBP on the HOX D13 gene as a template. Lane 6 was mixed with 75% Calu6 DNA and Sss1 to mix 25% methylated Calu6 DNA. Fight transformed DNA into template The amplification product was a DSBP for the HOX D13 gene, lane 7 is 50% Calu6 DNA and Sss1 reacted to mix 50% methylated Calu6 DNA, and the bisulfite transformed DNA as a template for the DSBP for the HOX D13 gene Lane 8 is an amplification product obtained by reacting 10% Calu6 DNA with Sss1, mixing 90% methylated Calu6 DNA, and performing DSBP on HOX D13 gene using bisulfite-converted DNA as a template. 9 is an amplification product obtained by reacting 5% Calu6 DNA with Sss1 and mixing 95% methylated Calu6 DNA, and then performing bisulfite-converted DNA as a template and performing DSBP on the HOX D13 gene. 99% of methylated Calu6 DNA was mixed by Sss1 reaction, and then amplified product was subjected to DSBP to HOX D13 gene using bisulfite-converted DNA as a template. Fight transformed DNA With the amplification products was performed on a DSBP D13 HOX gene.

As shown in FIG. 5, the proportion of methylated amplified products of HOX D13 gradually increases in proportion to the proportion of DNAs that were converted into methylated Sss1, and the concentration of unmethylated amplified products gradually decreased as expected. have.

Example  7: HOX D9 , HOX D11 , HOX D13  For genes DSBP Accuracy check result of

Among the DSBP primers for the HOX D9, HOX D11, and HOX D13 genes, the common sense primer and the unmethylated specific antisense primer set, and the common sense primer and the methylation specific antisense primer set were PCR respectively and electrophoresed on an agarose gel. Each amplification product was confirmed to have the correct size and amplified, and a gel photograph is shown in FIG. 6.

In FIG. 6, lane 1 shows 108 bp as a result of amplification using a common sense primer of the HOX D9 gene and a non-methylated specific antisense primer set using Calu6 DNA as a template, and lane 2 shows a methylated Calu6 DNA by Sss1 enzymatic reaction. As a template, the result of amplification reaction using the common sense primer of the HOX D9 gene and the methylation specific antisense primer set was 148 bp, and lane 3 shows the common sense primer and the unmethylated specific antisense of the HOX D11 gene using Calu6 DNA as a template. As a result of the amplification reaction using the primer set, it was 183bp, and lane 4 was the result of amplification reaction using the common sense primer of the HOX D11 gene and the methylation specific antisense primer set using methylated Calu6 DNA as a template by Sss1 enzyme reaction. 232 bp, lane 5 is a common sense of HOX D13 gene using Calu6 DNA as a template As a result of the amplification reaction using the reamer and the non-methylated specific antisense primer set, it was 117 bp, and lane 6 was subjected to Sss1 enzymatic reaction, and methylated Calu6 DNA was used as a template. As a result of amplification reaction using 162bp.

Example  8: HOX D9 , HOX D11 , HOX D13  Individual for genes DSBP  Amplification Result

Using genomic DNA as a template for Clau6 and H358 cell lines, DSBP amplification was performed individually against HOX D9, HOX D11, and HOX D13 genes, and a gel photograph is shown in FIG. 7.

In Figure 7, lanes 1 to 3 are Calu6 DNA, lanes 4 to 6 are methylated Calu6 DNA by Sss1 enzymatic reaction, lanes 7 to 9 are H358 DNA, lanes 10 to 12 are Sss1 enzymatic reaction, and methylated H358 DNA. As a template, it was the result of DSBP amplification reaction with respect to HOX D9, HOX D11, and HOX D13 gene, respectively.

Example 9: Multiple DSBP Amplification of HOX D9, HOX D11 Genes

After mixing all of the DSBP primers for HOX D9 and HOX D11, the result of amplification reaction using a transformed DNA obtained by bisulfite chemical reaction of genomic DNA of Clau6 and H358 cell lines was electrophoresed on agarose gel. Is shown in FIG. 8.

Indeed, Calu6 DNA is unmethylated in both HOX D9 and HOX D11 genes, while H358 DNA is unmethylated and methylated.

In FIG. 8, lane 1 shows amplification results of multiple DSBPs of two genes, HOX D9 and HOX D11, using the transformed DNA of Calu6 cells, and lane 2 shows the amplification of HOX D9 and HOX D11, using the transformed DNA of H358 cells. Results of amplification of multiple DSBP for two genes.

As expected, each amplification product was amplified only in non-methylated amplification products of HOX D9 and HOX D11 genes in lane 1 and simultaneously in non-methylated and methylated amplification products of HOX D9 and HOX D11 genes in lane 2.

Example 10: Accuracy Check Results of DSBP

To show that DSBP amplification for the HOX D9, HOX D11, and HOX D13 genes is amplified by specifically recognizing only bisulfite-converted DNA, non-sulphite-converted and bisulfite-converted Calu6 genomic DNA As a template, the results of performing DSBP amplification on the HOX D9, HOX D11, and HOX D13 genes were electrophoresed on an agarose gel, and the gel photograph is shown in FIG. 9.

In Figure 9 lanes 1 to 3 are the results of the DSBP amplification reaction for the HOX D9 gene as a template of the third distilled water, bisulfite-converted Calu6 DNA, bisulfite-converted Calu6 DNA as a template. Lanes 4 to 6 are the results of the DSBP amplification of HOX D11 gene using tertiary distilled water, bisulfite-converted Calu6 DNA and bisulfite-converted Calu6 DNA as templates. Lanes 7 to 9 are the results of DSBP amplification of HOX D13 gene with tertiary distilled water, bisulfite-converted Calu6 DNA and bisulfite-converted Calu6 DNA as templates.

Example 11: Relationship between methylation frequency of HOX D9, HOX D11, HOX D13 genes and lung cancer

The DNA of HOX D9, HOX D11, and HOX D13 genes was confirmed in association with lung cancer in DNA of lung cancer confirmed patients and 100 patients confirmed to be non-pulmonary cancer (Table 2).

Association between methylation frequency of HOX D9, HOX D11, HOX D13 gene and lung cancer Sputum test positive lung cancer group Sputum test negative lung cancer group Control HOX D9 66% 22% 2% HOX D11 34% 46% 8% HOX D13 59% 30% 7%

As shown in Table 2, the higher the methylation frequency of the HOX D9, HOX D11, and HOX D13 genes, the higher the risk of lung cancer.

Comparative Example 1: Design and Synthesis of Conventional MSP Primers for HOX D9, HOX D11, and HOX D13 Genes

To confirm the accuracy of the DSBP amplification reaction, non-methylated and methylated specific primer sets for HOX D9, HOX D11 and HOX D13 genes were designed and synthesized according to the conventional MSP method.

 The sizes of the unmethylated amplification products for the HOX D9, HOX D11, and HOX D13 genes were 151bp, 111bp, and 147bp, respectively, and the methylated amplification products were 151bp, 111bp, and 148bp, respectively. The base sequence of each primer is as follows.

Conventional MSP Nonmethylated Specific Sense Primer

HOX D9-Unmethylated Sense Primer:

5'- TTGGTGGTTTGGGTGTTGGT -3 '(SEQ ID NO .: 16)

HOX D11-Unmethylated Sense Primer:

5'- TGTATGTTTAGTTTGTGTGT -3 '(SEQ ID NO .: 17)

HOX D13-Unmethylated Sense Primer:

5'- GTATTGGTTAATGAGGTGTTAGT -3 '(SEQ ID NO .: 18)

Conventional MSP Unmethylated Specific Antisense Primer

HOX D9-Unmethylated Antisense Primer:

5'- CACACCACAAACACCTCATCA -3 '(SEQ ID NO .: 19)

HOX D11-Unmethylated Antisense Primer:

5'- CACTACTACCACCCCCCACA -3 '(SEQ ID NO .: 20)

HOX D13-Unmethylated Antisense Primer:

5'- CATAAAAATATAAACCTCATACCA -3 '(SEQ ID NO .: 21)

Conventional MSP Methylation Specific Sense Primer

HOX D9-methylated sense primers:

5'- TCGGTGGTTCGGGCGTCGGC -3 '(SEQ ID NO .: 22)

HOX D11-Methylated Sense Primer:

5'- TCGTACGTTTAGTTCGTGCGC -3 '(SEQ ID NO .: 23)

HOX D13-methylated sense primers:

5'- TATCGGTTAACGAGGTGTTAGC -3 '(SEQ ID NO .: 24)

Conventional MSP Methylation Specific Antisense Primer

HOX D9-methylated antisense primer:

5'- GCGCCGCGAACACCTCGTCG -3 '(SEQ ID NO .: 25)

HOX D11-Methylated Antisense Primer:

5'- GCTACTACCGCCCCCCGCG -3 '(SEQ ID NO .: 26)

HOX D13-methylated antisense primer:

5'- CATAAAAATATAAACCTCGTACCG -3 '(SEQ ID NO .: 27)

Comparative Example 2: Confirmation of the result of the conventional MSP amplification product by electrophoresis

The conventional MSP amplification reaction was performed in the same manner as the DSBP amplification reaction. However, for each of the HOX D9, HOX D11, and HOX D13 genes, PCR using a non-methylated specific primer set and a methylated specific primer set should be performed independently. PCR conditions and the composition ratio of each reagent were performed in the same manner as described above in Example 4, and then the amplification reaction was carried out. Then, 5 µl of the non-methylated amplification product and the methylated amplification product were mixed with 1 µl of 6X DNA agarose gel loading buffer. (0.25% bromophenol blue, 0,25% xylene cyanol, 30% glycerol) was mixed with 2.5% agarose gel and electrophoresed at 150 V for 30 minutes. Thereafter, by using the same instrument and program as in Example 5, whether amplification products are generated by PCR using a methylation-specific primer set is checked for methylation.

Comparative example  3: conventional MSP  Analysis

Comparative Example 3-1: Conventional MSP Assay for HOX D9, HOX D11, and HOX D13 Genes

Non-methylated amplification products and methylated amplification products of HOX D9, HOX D11, and HOX D13 genes were PCR separately performed using conventional MSP primers, and the results are shown in FIG. 10.

In Figure 10 lanes 1 to 6 as a template for the Calu6 DNA, non-methylated and methylated amplification products for HOX D9 gene, non-methylated and methylated amplification products for HOX D11, non-methylated amplification for HOX D13, respectively Show product and methylated amplification products. Lanes 7 to 12 were mixed with 10% of methylated Calu6 DNA and 90% of unmethylated Calu6 DNA by Sss1 enzymatic reaction, followed by bisulfite-converted DNA as a template, respectively. The product, unmethylated amplification product and methylated amplification product for HOX D11, unmethylated amplification product and methylation amplification product for HOX D13 are shown. Lanes 13 to 18 were mixed with 25% of methylated Calu6 DNA and 75% of unmethylated Calu6 DNA by Sss1 enzymatic reaction, followed by bisulfite-converted DNA as a template, respectively. The product, unmethylated amplification product and methylated amplification product for HOX D11, unmethylated amplification product and methylation amplification product for HOX D13 are shown. Lanes 19 to 24 were mixed with 90% of methylated Calu6 DNA and 10% unmethylated Calu6 DNA by Sss1 enzymatic reaction, followed by bisulfite-converted DNA as a template, respectively. The product, unmethylated amplification product and methylated amplification product for HOX D11, unmethylated amplification product and methylation amplification product for HOX D13 are shown.

In the case of Calu6 genomic DNA, the HOX D9, D11, and D13 genes are all unmethylated, which should be amplified only with the unmethylated products as shown in lanes 1, 2 and 3 of FIG. 7 using DSBP technology. However, as shown in lane 2 of FIG. 10, when amplifying the unmethylated and methylated products separately from the conventional MSP primers, the amplified products appear even when methylated specific primer sets are used. This is because, due to the original problem of the conventional MSP reaction to perform the amplification reaction independently using only the methylation primer, it is amplified exponentially by recognizing only a part of the remaining methylation (due to bisulfite unconverted, etc.).

In addition, as shown in lanes 8, 14, and 20, which are methylation specific amplification products for the HOX D9 gene, when the amplification reaction of the non-methylated product and the methylated product is independently performed by the conventional MSP method, the methylation ratio is increased. Despite the difference of 10%, 25%, and 90%, the amount of amplification products does not differ so much that the ratio cannot be distinguished. This phenomenon can be seen that the same in the HOX D13 gene, it can be seen that this problem is also a problem of the conventional MSP amplification reaction itself, not a specific sequence.

Comparative Example 3-1: Confirmation of Sensitivity of Conventional MSP to HOX D11 Gene

Calu6 DNA methylated by Calu6 DNA and Sss1 enzyme reaction: 100: 0, 99: 1, 95: 5, 90:10, 75:25, 50:50, 10:90, 5:95, 1:99, 100% After mixing at a ratio of bisulfite-converted DNA as a template, a conventional MSP reaction was performed on the HOX D11 gene, and the results are shown in FIG. 11.

That is, FIG. 11 shows the results of electrophoresis by PCR using a non-methylated specific primer set and a methylated specific primer set for the HOX D11 gene, respectively. Lane 1 is a tertiary distilled water, and lane 2 is a template of genomic DNA without bisulfite conversion, and lanes 3 to 12 have a ratio of methylated DNA of 0, 1, 5, 10, 25, 50, 90, This is the result of conventional MSP amplification using a non-methylated specific primer set for the HOX D9 gene using 95%, 99%, and 100% bisulfite-converted DNA as a template. Lane 13 is the tertiary distilled water, and lane 14 is a genomic DNA which is not bisulfite-converted as a template, and the ratio of methylated DNA is 15, 24, 0, 1, 5, 10, 25, 50, 90, 95 , 99, 100% of bisulfite-converted DNA as a template, and the result of conventional MSP reaction using a methylation specific primer set for the HOX D9 gene. Although it is possible to confirm the methylation, it can be seen that it is impossible to confirm the ratio of methylation, which is part of the problems of the conventional MSP described above in the present invention.

1 is a schematic diagram for the design of common sense primers, unmethylated specific antisense primers, methylated specific antisense primers in accordance with the present invention.

2 is a view briefly showing the results of electrophoresis of amplified products.

3 is a gel photograph confirming the sensitivity of DSBP to the HOX D9 gene using standard positive sample DNA methylated cytosine of all CpG sequences using Sss1 methyllaser in genomic DNA purely isolated from Calu6 cell line.

Figure 4 is a gel photograph showing the sensitivity of DSBP to the HOX D11 gene using genomic DNA purely isolated from Calu6 cell line using standard positive sample DNA methylated cytosine of all CpG sequences using Sss1 methyllaser.

5 is a gel photograph confirming the sensitivity of DSBP to the HOX D13 gene using the standard positive sample DNA methylated cytosine of all CpG sequences using the Sss1 methyllaser genomic DNA purely isolated from Calu6 cell line.

FIG. 6 shows PCR agarose using a common sense primer and an unmethylated specific antisense primer set, and a common sense primer and a methylated specific antisense primer set among DSBP primers for the HOX D9, HOX D11, and HOX D13 genes, respectively. The gel is electrophoresed on the gel to confirm that each amplification product is amplified to the correct size.

7 shows the results of DSBP amplification of HOX D9, HOX D11, and HOX D13 genes using genomic DNA as a template for Clau6 and H358 cell lines.

Figure 8 is a mixture of all the DSBP primers for HOX D9 and HOX D11, electrophoresis on agarose gel the result of amplification reaction using a transformed DNA obtained by bisulfite chemical reaction of genomic DNA of Clau6 and H358 cell line as a template The result is.

FIG. 9 shows that DSBP amplification for HOX D9, HOX D11, and HOX D13 genes was amplified by specifically recognizing and amplifying only bisulfite-converted DNA, without bisulfite conversion of Calu6 genomic DNA. Using the transformed template as a template, DSBP amplification of the HOX D9, HOX D11, and HOX D13 genes was carried out on an agarose gel.

FIG. 10 is a result of PCR separately performing non-methylated products and methylated products of HOX D9, HOX D11, and HOX D13 genes using conventional MSP primers.

FIG. 11 shows Calu6 DNA methylated by calcining Calu6 DNA with Sss1 100: 0, 99: 1, 95: 5, 90:10, 75:25, 50:50, 10:90, 5:95, 1:99 , And a result of performing a conventional MSP reaction on the HOX D11 gene by mixing the bisulfite-converted DNA as a template after mixing at a rate of 100%.

<110> THE ASAN FOUNDATION <120> Method for Analysis of Gene Methylation and Ratio Thereof <160> 27 <170> KopatentIn 1.71 <210> 1 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gtgtgagtag ggagagaggg tgtgagtagg gagagagg 38 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctaccttcta ctaccccctt 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gaggtttata gagggagaga g 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 caaccacaaa aacaccaaac ca 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gttttatgag gtagtgtttg gg 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 catcccaaca aacacaaaca ca 22 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 aacttccgaa ccgcgaacg 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tttatagcgc ggtgggtcg 19 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 caaaaccgaa aactaccgcc g 21 <210> 10 <211> 148 <212> DNA <213> Artificial Sequence <220> <223> methylation product <400> 10 gtgtgagtag ggagagaggc gaggggagaa cagctcccct cgggcgctag gggccgcccc 60 gagggcccgc ctgcctcggg cgacaccggc ctggcgcccc cgcggccgct ccgtgtgccc 120 tggactcgcc gcccgcggct cggaagct 148 <210> 11 <211> 108 <212> DNA <213> Artificial Sequence <220> <223> non-methylation product <400> 11 gtgtgagtag ggagagaggc gaggggagaa cagctcccct cgggcgctag gggccgcccc 60 gagggcccgc ctgcctcggg cgacaccggc ctggcgcccc cgcggccg 108 <210> 12 <211> 232 <212> DNA <213> Artificial Sequence <220> <223> methylation product <400> 12 tctacagcgc ggtgggccgc aatggcatct tgccacaggg cttcgaccag ttctacgagg 60 cagcgcccgg gcccccgttc gccgggccgc agcccccgcc gccacccgcg ccgccacagc 120 ccgagggcgc agccgacaag ggcgacccca ggaccggggc tggtggcggc gggggcagtc 180 cctgcaccaa ggcgacccct ggctcggagc ccaagggggc agcagaaggc ag 232 <210> 13 <211> 183 <212> DNA <213> Artificial Sequence <220> <223> non-methylation product <400> 13 gttctacgag gcagcgcccg ggcccccgtt cgccgggccg cagcccccgc cgccacccgc 60 gccgccacag cccgagggcg cagccgacaa gggcgacccc aggaccgggg ctggtggcgg 120 cgggggcagt ccctgcacca aggcgacccc tggctcggag cccaaggggg cagcagaagg 180 cag 183 <210> 14 <211> 162 <212> DNA <213> Artificial Sequence <220> <223> methylation product <400> 14 agagagaaag gagaggaggg aggaggcgcg ccgcgccatg gtgtcctgcg cggggccagg 60 gccagggccg gggccgggcc aggccgggcc atgagccgcg ccgggagctg ggacatggac 120 gggctgcggg cagacggcgg gggcgccggt ggcgccccgg cc 162 <210> 15 <211> 117 <212> DNA <213> Artificial Sequence <220> <223> non-methylation product <400> 15 agagagaaag gagaggaggg aggaggcgcg ccgcgccatg gtgtcctgcg cggggccagg 60 gccagggccg gggccgggcc aggccgggcc atgagccgcg ccgggagctg ggacatg 117 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ttggtggttt gggtgttggt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 tgtatgttta gtttgtgtgt 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gtattggtta atgaggtgtt ag 22 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cacaccacaa acacctcatc a 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 cactactacc accccccaca 20 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 cataaaaata taaacctcat acca 24 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tcggtggttc gggcgtcggc 20 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 tcgtacgttt agttcgtgcg c 21 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 tatcggttaa cgaggtgtta gc 22 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gcgccgcgaa cacctcgtcg 20 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gctactaccg ccccccgcg 19 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 cataaaaata taaacctcgt accg 24  

Claims (12)

(1) treating the sample DNA with sodium bisulfite; (2) A primer based on sample DNA treated with sodium bisulfite as a template, (a) a first oligonucleotide consisting of a nucleotide sequence complementary to a first region containing 3-4 CpG sequences on a nucleotide sequence of a specific gene, (b) complementary to the second region including 3-4 CpG sequences, which are located spaced apart from the first region by a predetermined base sequence, wherein the CpG sequence is regarded as an UpG sequence and is complementary thereto. A second oligonucleotide consisting of a nucleotide sequence and having the same orientation as the first oligonucleotide, and (c) a base sequence complementary to the third region, which does not include the CpG sequence, located apart from the first region and the second region, and is opposite to the first and second oligonucleotides Performing PCR using an aromatic third oligonucleotide; (3) detecting the amplification product according to the PCR reaction; methylation status and ratio analysis method of a specific gene comprising a. The method according to claim 1, wherein the predetermined nucleotide sequence is 40 to 50bp. The method according to claim 1, wherein the primer is a 55 to 65 ℃ melting temperature, 40 to 50% of the GC ratio, including the oligonucleotide of 20 to 25bp size, characterized in that the methylation of the specific gene method. The method according to claim 1, wherein the specific gene is a cancer-related gene. The method of claim 4, wherein the cancer-related genes are HOX D9, HOX D11, and HOX D13 genes. The method according to claim 5, wherein the primers consist of the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 9. (1) sodium bisulfite; (2) the following primers: (a) a first oligonucleotide consisting of a nucleotide sequence complementary to a first region containing 3-4 CpG sequences on a nucleotide sequence of a specific gene, (b) complementary to the second region including 3-4 CpG sequences, which are located spaced apart from the first region by a predetermined base sequence, wherein the CpG sequence is regarded as an UpG sequence and is complementary thereto. A second oligonucleotide consisting of a nucleotide sequence and having the same orientation as the first oligonucleotide, (c) a base sequence complementary to the third region, which does not include the CpG sequence, located apart from the first region and the second region, and is opposite to the first and second oligonucleotides Tertiary oligonucleotides having aromaticity; (3) dNTP and DNA polymerase capable of amplifying a specific gene; kit for analyzing the ratio and methylation of a specific gene, including. 8. The kit according to claim 7, wherein the predetermined nucleotide sequence is 40 to 50 bp. According to claim 7, Primer is 55 to 65 ℃ melting temperature, 40 to 50%, including a GC ratio of 20 to 25 bp oligonucleotide, characterized in that a specific gene methylation kit and rate analysis kit, characterized in that. The kit according to claim 7, wherein the specific gene is a cancer-related gene. The kit according to claim 10, wherein the gene is HOX D9, HOX D11, HOX D13 genes. 12. The kit according to claim 11, wherein the primer consists of the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 9.

Images