KR100980809B1 - Flanking sequences and sets of primer for determining PERV - Google Patents

Abstract

The present invention relates to a concatenation sequence of PERV inserted into a pig gene and a primer pair for PERV detection using the same, a base sequence including any one of SEQ ID NOs: 1 to 14, which is a concatenation sequence, and ① containing the concatenation sequence. Oligonucleotide having a sequence complementary to the nucleotide sequence, and (2) relates to a primer pair for detecting PERV fused in the swine genome consisting of oligonucleotide having a sequence complementary to the PERV gene base sequence.

According to the present invention, the presence of problematic PERV in xenotransplantation from pig tissues or organs can be detected in advance, and further, it can be used to knock out the gene.

Porcine endogenous retrovirus (PERV), organ transplant, detection, primer, locus, knock-out

Description

Flanking sequences and sets of primers for determining PERV

The present invention relates to a flanking sequence of a pig endogenous retrovirus (PERV) inserted into a Korean native pig ( Sus scrofa ) gene and a primer pair for PERV detection using the same.

Organ transplant refers to a surgical procedure for transplanting a tissue or organ extracted from a living body or a corpse of a human or animal into a patient's body to substitute for its function to treat a patient. Organ transplantation is based on the use of a transplanted tissue from a non-human animal, including an autograft that takes the organ for transplantation from another part of the patient's own body, an allograft that is extracted from another person, and an artificial organ. Obtaining can be divided into xenografts.

Among these, autologous transplantation is limited to the types of organs to be acquired, and therefore, allograft is mainly performed. However, due to severe imbalance in supply and demand, the realization of xenotransplantation still in the experimental stage is urgently required.

The most suitable animal for Xenotransplantation is pig. This is because the size of organs is similar to humans and is not ethically problematic unlike primates such as monkeys (Chari et al., 1994; Groth et al., 1994; Deacon et al., 1997; Lee and Moran, 2001). . In addition, the genetic consistency with humans is relatively high, and the average number of litters is about 10, and the growth period is short.

However, xenografts have a problem to be solved, one of which is the problem of immunological inconsistency. There is a species-specific glycoprotein on the cell surface that acts as an antigen, allowing you to tell whether a particular cell is a heterologous cell. Alpha-1,3-galactose, a component of pig's native glycoprotein, acts as an antigen for the immune system in the human body. Reaction 'will occur. Recently, cloned pigs are removed from the nucleus of porcine somatic cells to remove the genes that produce the enzymes that make alpha-1,3-galactose, thus opening the way to avoid acute immune rejection. However, pigs do not completely solve the problem of immune rejection because there are several more human and other types of sugar.

Another problem with xenotransplantation is due to porcine endogenous retroviruses (PERVs). All animals in the natural world have viruses adapted to them in their genes, which are harmless to the host but do not know how they will affect the transplanted organ. The PERV, which was analyzed millions of years ago in the genome of a host pig, is not clear in its function, but is passed down to the next generation by Mendel's genetic modality.

Recently, a variety of studies have been conducted since the results of research showing that PERVs infect human cells when pig organs are transplanted into humans. Safety testing is also ongoing, as long-term transplantation with pigs, such as the AIDS virus and the Ebola virus, can cause PERV infections in humans, resulting in new types of viruses that can cause fatal diseases. Although there are no studies showing that PERV is directly or indirectly fatal to humans in xenotransplantation, it is advisable to remove the PERV gene from pig organs or tissues before transplantation as there is considerable risk.

PERV (Fig. 1) can be divided into three types (PERV-A, PERV-B, PERV-C) based on the genotype of the env (envelop gene), it is known that there are 30-50 in the genome of pigs (Le Tissier et al. 1997, Rogel-Gaillard et al. 1999, 2001). The knock-out of the PERV gene in the pig genome requires knowing the exact locus and flanking sequence of PERV. However, it is not easy to find the exact locus and concatenation sequence of PERV because the swine genome sequence project is still in progress. Furthermore, since the genetic locus of PERV varies from species to species and varies widely, there are many problems in applying it to Korean native pigs. Therefore, in order to knock out PERV for use in xenotransplantation as well as genetic resources, research on PERV loci and concatenation sequences derived from Korean native pigs is required. There is also a need for primer pairs that can effectively detect PERV in Korean native pigs.

The present invention is to solve the problems of the prior art as described above, it is an object of the present invention to identify the locus of PERV in Korean pigs and to provide a concatenated sequence of PERV in the locus.

Another object of the present invention is to provide primer pairs that can effectively detect PERV in organs or tissues of pigs from the concatenation sequence of PERV and sequence information of PERV.

The present invention for achieving the above object, as a 3'- or 5'- concatenated sequence for the pig endogenous retrovirus (PERV) fused to the porcine genome, the base sequence comprising any one of SEQ ID NOS: 1-14 It is about.

In addition, the present invention, ① primer for detecting PERV fused in the porcine genome consisting of oligonucleotide having a sequence complementary to the base sequence including the concatenation sequence, and ② oligonucleotide having a sequence complementary to the PERV gene sequence It's about pairs. The primer pair may be any one or two or more of SEQ ID NO: 15-16, 17-18, 19-20, 21-22, 23-24, 25-26, 27-28 or 29-30.

The present invention also relates to a method for detecting PERV by PCR from a pig tissue or organ specimen using a primer pair.

The present invention also relates to a method of knocking out PERV from porcine genomic DNA using the primer pair.

Experimental process for completing the present invention was as follows.

Genetic information and locus of the PERV fused in the Korean native pig genome was determined according to the method shown in FIG. FIG. 2A shows the process of constructing the BAC library (I, II), FIG. 2B shows the process of selecting a PERV-inserted clone from the BAC library, and FIG. 2C shows the PERV-A or PERV-B among the clones. 2d shows the terminal sequence analysis using T7 and SP6 primer pairs, FIG. 2e shows the locus positioning process of PERV, and FIG. 2f shows the full length and concatenation sequence analysis of PERV.

First, a total of seven clones were selected, one PERV-A type and six PERV-B types, to which the PERV gene was inserted, from the BAC library of Korean native pigs. BAC terminal sequences were analyzed for each of the seven clones selected and the locus of PERV was determined by mapping using the terminal sequences. The full-length and contiguous sequences of PERV were analyzed by primer walking and contig operations using the known base sequences of PERV. In particular, the full length sequence of PERV and the concatenation sequence of 5'- and 3'- were analyzed and sequence numbers 1-14 were assigned to the concatenation sequence.

From the full length and contiguous sequences of PERV obtained by the above method, a primer pair was designed to detect PERV at a specific locus in DNA in pig tissues or organs. That is, a primer pair consisting of an oligonucleotide having a sequence complementary to some nucleotide sequences of the contiguous sequence and an oligonucleotide having a sequence complementary to some nucleotide sequences of the full-length sequence of PERV was prepared and used for detection of PERV. In the embodiment of the present invention using the primer pair of SEQ ID NO: 15-16, 17-18, 19-20, 21-22, 23-24, 25-26, 27-28 and 29-30 as an example of the primer pair By detecting PERV from pig tissues or organs, but not limited thereto, it is possible to effectively detect the PERV fused in the Korean native pig genome from the information on the locus found by the present invention.

It is possible to detect PERV by PCR of a sample of a pig tissue or organ using the primer pair.

It is also possible to knock out PERV by various methods known in the art by utilizing the information on the primer pair.

As described above, the present invention provides a PERV sequence, a locus, and a sequence found in Korean native pigs. Therefore, according to the present invention, since it is possible to know the native PERV sequence and its concatenated sequence of Korean native pigs, it is possible to detect PERV from pig tissues or organs by using specific primers.

Thus, according to the present invention, it is possible to determine whether the tissue or organ is suitable for transplantation by detecting the presence of problematic PERV at the time of xenotransplantation from the tissue or organ of the pig, and further knocking out the gene. can be used to

The present invention will be described in detail through the following examples. However, these examples are for illustrative purposes only and the present invention is not limited thereto.

<Examples>

Example 1 BAC library construction of Korean native pigs

BAC libraries of Korean native pigs are Jeon et al. (Jeon, JT, Park, EW, Jeon, HJ, Kim, TH, Lee, KT and Cheong, IC 2003. A large-insert porcine library with sevenfold genome coverage: a tool for positional Cloning of candidate genes for major quantitative traits.Mol. Cells 16: 113-116.) was distributed by the Rural Development Institute of Animal Science, and the 4D pooled BAC library was constructed for 2 step PCR. .

Example 2 Selection of PERV Clone in BAC Library

In order to select clones with PERV inserted from 19 master pool sets, PCR was performed using the pol primer pairs shown in Table 1 below, followed by PR (Plate Row), PC (Plate Column), and WR corresponding to the detected band. (Well Row) and WC (Well Column) pool sets were again subjected to PCR using pol primer pairs to select PERV clones. PCR reaction solution composition was prepared by PCR reaction buffer solution (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl ₂ ), 0.25 mM each of dNTPs, 10 pmol primer, 10 ng template DNA, 0.5 U Taq DNA polymerase. (TaKaRa Shuzo co., Shiga, Japan) and 1/5 volume of Cresol red (60% Sucrose, 4 mM Cresol red), ddH ₂ O to the total reaction solution was 20 μl (Fig. 2). After 10 minutes of pre-denaturation at 94 ° C, 30 cycles of denaturation at 94 ° C for 30 seconds, annealing for 45 seconds at the proper temperature of each primer at 65 ° C, and primer extension for 40 seconds at 72 ° C Finally, the final extension process was performed at 72 ° C. for 10 minutes.

Example 3 Extraction of BAC DNA Containing PERV

Monoclonals were incubated at 37 ° C. and 250 rpm in 50 ml of LB medium containing chloramphenicol (20 μg / ml). The fully grown cells were transferred to a centrifuge tube and centrifuged at 5000 rpm and 4 ° C for 10 minutes to remove the supernatant. After dispensing 2 ml of Solution I (25 mM Tris-Cl, 50 mM Glucose, 10 mM EDTA) and vortexing, the cell pellets were sufficiently released. After dispensing Solution II (1% SDS, 0.2 N NaOH) in 4 ml, 4 Shake it up and down ~ 6 times. Dispense 3 ml of solution III (5M potassium acetate, glacial acetic acid) and shake it up and down lightly for 4 ~ 6 times and put it on ice for about 30 minutes to mix the samples well. Samples mixed well with each other were centrifuged at 4 ° C. for 30 minutes at a speed of 6000 to 7000 rpm. In the centrifuged sample, the supernatant was transferred to a new tube using a filter, and 0.7 times of the isopropanol at room temperature was aliquoted and gently shaken. Thereafter, the pellets were recovered by centrifugation at 4 ° C. for 30 minutes at 1200 rpm. The recovered pellets were washed with 70% ethanol, and then the DNA pellets were air-dried to completely dissolve DNA pellets in 20 µl of TE (pH 8.0) at room temperature. Spectrophotometer (Pharamacia Biotec, England) was used to determine whether the ratio of OD260: OD280 was 1.5-1.8 at 260-280 nm absorbance, and the concentration was 300 ng / μl or more suitable for BAC-end sequencing.

Example 4 Classification of PERV-A and PERV-B Types

PCR was performed using the primer pairs shown in Table 2 to distinguish the PERV-A type and the PERV-B type using the BAC DNA extracted in Example 3.

In order to select PERV-A type, PCR was selected under the following conditions using primers SEQ ID Nos. 33 and 34 that recognize the nucleotide sequence of a specific site in PERV-A. After 10 minutes pre-denaturation at 94 ° C, denaturation at 94 ° C for 30 seconds, annealing for 45 seconds at the appropriate temperature of each primer in 69 ° C, primer extension 28 cycles at 72 ° C for 40 seconds, and finally at 72 ° C. The final extension process was performed for 10 minutes.

In order to select PERV-B type, only PCR clones having a band of 263 bp were selected by PCR under the following conditions using primers SEQ ID Nos. 35 and 36 that recognize the nucleotide sequence of a specific site in PERV-B. After 10 minutes of pre-denaturation at 94 ° C, denaturation at 94 ° C for 30 seconds, annealing for 45 seconds at the appropriate temperature of each primer at 69 ° C, primer extension 27 cycles at 72 ° C for 40 seconds, and finally at 72 ° C The final extension process was performed for 10 minutes.

PCR reaction solution composition was 10X gold buffer (Applied Biosystems, USA), 2 mM MgCl ₂ (Applied Biosystems, USA), 10 mM of dNTP (Toyobo, Japan), 10 pmol primer, 0.5 units Amplitaq Gold (Applied Biosystems, USA) ), BAC DNA and ddH ₂ O were used to make the total reaction solution 20 µl.

Example 5 Terminal Sequence Analysis in Selected BAC Clones

For efficient BAC terminal sequencing (terminal sequencing), the extracted BAC DNA was treated with restriction enzymes. After treatment with RNase (10 mg / ml treatment, Promega USA) and Eco RV restriction enzyme (Promega, USA), bases were removed using a QiaexII kit (Qiagen, USA). For the sequencing reaction, 5 μl of BAC DNA extracted from the above was used as a DNA template, Big Dye terminator v3.1 (Applied Biosystems, USA), T7 primer (TAATACGACTCACTATAGGG), SP6 primer (ATTTAGGTGACACTATAG) The total reaction solution containing 5X Buffer (400 mM Tris 10 mM MgCl ₂ ) was 20 μl. PCR was performed using GeneAmp PCR system 9600 (Perkin-Elmer Co., USA), and PCR conditions were denatured at 95 ° C. for 5 minutes, 30 seconds at 95 ° C., 10 seconds at 50 ° C., and 50 minutes at 60 ° C. for 50 times. Was performed. The PCR product was purified with isopropanol and ethanol. After dispensing 10 μl of formamide in dried pellets at room temperature, DNA was dissolved for 40 minutes, followed by sequencing with ABI3730 (Applied Biosystems, USA).

Since the BAC library used in this study has 5X genome coverage, the PERV clone with the same insert should be removed. For this, contig was prepared based on the terminal sequence analysis of BAC clones containing PERV. Because the repeat base sequence exists in the terminal base sequence of the BAC clone, all sequences derived through the terminal base sequence analysis were not immediately available. Therefore, based on the results obtained through the RepeatMasker program (http://www.repeatmasker.org/), primers were prepared for contig preparation after removing repetitive elements.

Trimming was performed to remove the vector and E coli sequences from the BAC terminal sequences of the clones. The sequences were removed, and the sorted sequences had a phred score of 20 to remove inaccurate bases. Bases not exceeding were removed (Genome Res. 8: 186-194). The repeat base sequence spread over the entire genome was removed using the repeat masker (http://www.repeatmasker.org/) for the second ordered nucleotide sequence. 45 pairs of primers were prepared from the final sequence obtained through this procedure.

The primer was prepared using the PRIMER3 (http://frodo.wi.mit.edu/cgi-bin/primer3) program. The prepared primers were used to prepare a contig map as a sequence-tagged site marker. However, primer design was not possible in all BAC-ends because of the presence of repetitive elements in the BAC-end sequences.

These primers are not intended for the scope of the present invention desired, and the presentation of sequences is omitted since the same methods and information enable the production of the same or different primers.

Contig was prepared using the 45 pairs of primers obtained from the BAC end sequence (FIGS. 3A and 3B), and nine contigs were identified. Finally, seven (532G9, 465D1, 742H1, 1155D9, 102H6, 491C7, 907F8) non-redundant PERV clones were selected.

Example  6: Korean native pig  In the genome PERV Genetic locus  decision

(1) Locus determination using somatic cell hybrid panel

Chromosome loci were identified for each of the seven non-redundant PERV clones identified in Example 5.

PCR using 27 primers (INRA, France) hybridized with pigs and hamsters and primer pairs shown in Table 3 for mapping (SCH mapping) using the somatic hybrid panel (Cytogenet. Cell Genet. 73 : 194-202) The analysis was performed. PCR reaction was 25 μl total, 10 × reaction buffer consisting of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 15 mM MgCl ₂ , 0.001% gelatin, 0.2 mM dNTP, 10 pmol primer, 25 ng Distilled water was added to radiation hybrid DNA and 1.5 unit Taq DNA polymerase (TaKaRa, Japan). For DNA amplification, 35 cycles were performed with DNA denaturation at 94 ° C for 30 seconds, primer binding at 57 ° C, and DNA strand extension at 72 ° C for 45 seconds. Analysis of the PCR product was confirmed by agarose electrophoresis (not shown) and given a + or-depending on the presence of a positive band (http://www2.toulouse.inra.fr/lgc/pig/hybrid.htm). . In this process, positive control containing only pig DNA, background DNA control containing only hamster DNA, and negative control (3 Distilled water) were included in the analysis.

The experimental results are shown in Table 4, and the locus of PERV determined using the somatic hybrid panel is shown in Table 5.

"Chromosome number (position)" in Table 5 means a chromosome number and a position on a chromosome in which the corresponding PERV exists. For example, in 742H1 T7, "2 (1/2 q21)-(1/2 q22)" is located at pig chromosome 2 q-arm 1/2 q21 to 1/2 q22.

As a result of the test, the error risk is low and the correlation is close to 1, indicating that the locus determined by the test has high reliability.

(2) Radiation hybrid Reconfirmation of Locus Using Panel

PCR analysis was performed using a radiation hybrid panel (Yerle et al., 1998) to reconfirm the locus of the PERV clones determined in (1) above.

We used INRA (France) consisting of 118 hybrid clones and 5000-rad porcine radiation hybrid (IMpRH) panel from Minnesota University for the mapping of the RH (radiation hybrid). Primer pairs used in 25 ng radiation hybrid clones ( INRA, France) (Cytogenet. Cell Genet. 82: 182-188), 1.5 unit Taq DNA polymerase (TaKaRa, Japan), SCH (Somatic cell hybrid panel) (Table 3) It was carried out in a reaction solution consisting of. PCR reaction was 25 μl total, 10 × reaction buffer consisting of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 15 mM MgCl ₂ , 0.001% gelatin, 0.2 mM dNTP, 10 pmol primer, 25 ng Distilled water was added to radiation hybrid DNA and 1.5 unit Taq DNA polymerase (TaKaRa, Japan). For DNA amplification, 35 cycles were performed with DNA denaturation at 94 ° C for 30 seconds, primer binding at 65 ° C, and DNA strand extension at 72 ° C for 45 seconds. PCR reactions were repeated twice under the same conditions.

PCR products were identified by electrophoresis using 2% agarose gel (not shown), and were assigned 1 or 0 depending on the presence of a positive band (not shown). The results of the RH panel were analyzed using an analysis program provided by INRA (http://imprh.toulouse.inra.fr/) in France.

The method identified the positions on the chromosomes of the seven PERV clones (Table 6).

The location of the marker can be determined from the database. If the LOD value is 3 or more, it is considered to be associated with the linked marker. Therefore, it can be seen that the test result has a very high reliability.

The clones located on the same contig showed the same SCH and RH mapping results, indicating that the locus determined above is correct.

As described above, based on the BAC contig, SCH and RH mapping results, seven non-redundant PERV clones in the Korean native pig genome were selected, and the locus was double confirmed.

Example 7: Full length sequence and concatenation analysis of PERV

(1) Long-Range PERV PCR Using Selected BAC DNA

Long PCR was performed to confirm that all seven non-redundant PERV clones selected by PERV mapping and BAC contig had 8 Kb sequences including LTR, gag, pol, and env.

Primer pairs in Table 7 (J. Virol. 74 (9): 4028 ?? 4038) 10 pmol, 17.5 mM MgCl ₂ , 0.5 units of Taq polymerase (Expand long template PCR system, Roche, Germany), 10 × buffer ( Cat. No. 1 681 834), and the total amount was 25 μl with BAC DNA. For DNA amplification, 35 cycles were performed with DNA denaturation at 94 ° C for 5 minutes, primer binding at 68 ° C for 30 seconds, and DNA strand extension at 72 ° C for 7 minutes.

As a result of PCR (FIG. 4), the size of the long-range PCR products of six of the seven selected PERV clones was about 8 kb, which turned out to be PERV clones with complete inserts. However, one PERV clone (102H6) has a PCR product of about 6 kb in size and has an insert that is different in size from other clones, and the sequencing results indicate that there is a deletion of about 2 kb between 5'-LTR and 3'-LTR. Confirmed. In electrophoresis, M is a 1kb ladder size marker and lanes 1-11 are clones with identified genetic loci. Clones associated with the present invention are marked with boxes.

(2) Shotgun library production

In order to know the PERV full length sequence, a shotgun library was prepared using a long-range PCR product (macrogen commissioned). The shotgun library was prepared using a primer pair of T7 and T3 and using the long-range PCR product obtained in (1) above as a template.

Random clones (not shown) obtained from the shotgun library were inserted into the template for sequencing and sequencing was performed using T3 and T7 primers (FIG. 5). The base sequences from the sequencing results were subjected to base-calling to determine whether the peaks were A, T, G, or C sequences using Chromas software (Technelysium, Australia) . The base sequence was removed by trimming to improve the assembly accuracy by removing the coli sequence, and the summarized sequence had a Phred (University of Washington Genome Center) score of 20 to remove bases of low quality. No more than this base was removed leaving only high quality bases of an average of 107 bp. The base sequences sequencing by shotgun sequencing from each PERV clone were aligned with the base sequence through pairwise sequence alignment to form a consensus sequence for each PERV clone to complete full-sequencing. The sequencing analysis of the full-sequencing results was carried out by NCBI's BLAST search (http://www.ncbi.nlm.nih.gov). The structure of retroviruses (5'-Franking region, 5'LTR, Gag , Pol , Env) , 3'LTR, 3'-Franking region) could be identified by region.

As a result of full-sequencing, the length of contig by each clone was 7.5 kb on average, almost identical to that of the full-length PCR, and 18G5 clone was also deleted about 2kb compared to other clones.

(3) Concatenation sequence analysis of PERV

In order to analyze the 5 'and 3' contiguous sequences of each PERV clone, DNA walking (macrogen-based analysis and PCR ) was performed using primer pairs (not shown) complementary to the 5 'and 3' LTR sequences. Methods Appl . 1, 39-42) was performed. 6 shows the DNA walking concept, and as a result, the PERV 5'- and 3'-concatenated sequences of each clone are shown in Tables 8A to 8G.

Example  8: in tissues or organs of pigs PERV Screening

From the full length and contiguous sequences of PERV obtained in Example 7, a primer capable of screening PERV in pig tissue or organ was devised and its effectiveness was confirmed.

(1) design of primer

Primers for the presence or absence of PERV insertion on the genome of pigs were determined by 5 'concatenation or 3' concatenation [Table 8a to Table 8g] and 5'LTR and env sequences of PERV. Primer3 (http://frodo.wi.mit.edu/) was used to design primer pairs that span both contiguous and full-length sequences (see FIG. 7). The primer pairs thus selected and their corresponding chromosome positions are shown in Table 9.

(2) screening of PERV

PERV was screened using genomic DNA of pigs from the Nanji Agricultural Research and Rural Development Administration, Gyeongsang National University. Among them, 63 pigs (numbers 1 to 63 ) were used.

100 ng / μl of each sample genomic DNA was added to 10 × PCR buffer (Tris-HCl (pH 9.0), (NH ₄ ) ₂ SO ₄ , 20 mM MgCl ₂ , PCR enhancers), primer pair 10pmol in Table 9 above, 10 mM dNTP PCR amplification was carried out in a total of 10 μl of the reaction solution consisting of 5 units / μl of taq polymerase and distilled water. PCR was denatured at 94 ° C. for 5 minutes, and then 40 cycles were performed at 94 ° C. for 30 seconds, 65 ° C. for 40 seconds, 72 ° C. for 1 minute, and 72 ° C. for 10 minutes.

Electrophoresis pictures of PCR products using each primer pair are shown in FIGS. 8A-8H. In the figure, M represents a size marker of 100bp. The experimental results are summarized in Table 10 below.

As shown in Table 10, it was confirmed that the insertion of PERV per locus in the pig using the primer pairs above, it can be useful to select a pig without the insertion of PERV.

Possible Example 9: PERV Knock-out in Porcine Tissues or Organs

Using the locus and concatenation sequence information of PERV inherent in the pig genome revealed by the present invention, it is possible to economically knock out PERV present in native pigs. The method of knocking out the gene by using the sequence of a specific gene and its concatenated sequence information (Gene Targeting Protocols, Eric B. Kmiec, 2000, Humana Press) is widely known in the art to which the present invention pertains. Explain.

Gene targeting vectors for PERV knockout are pBS226 (Genomic targeting with a positive-selection lox integration vector allows highly reproducible gene expression in mammalian Cells. 1992. Fukushige S and Sauer B. PNAS 89 (17): 7905-7909) and PERV battlefield The vector is constructed using the sequence and the newly identified 5'-conjugated and 3'-concatenated sequences. The constructed vector enables knock-out of PERV genes located at specific loci by homologous recombination.

Knock-out must be done individually by one PERV at a specific location. This requires knowing the locus (ie, the contiguous sequence). Therefore, using the primer pair according to the present invention can easily and economically knock-out PERV inherent in native pigs, it is also possible to easily determine whether the knock-out is well.

1 is a schematic diagram showing the structure of PERV.

2A to 2F are schematic views of an experimental method for determining PERV genetic information and genetic locus according to the present invention.

3A and 3B are conceptual diagrams of Contig mapping for PERV analysis.

4 is a long-range PCR result electrophoresis picture of seven clones selected.

5 shows an example showing sequencing using T3 and T7 primers.

6 is a conceptual diagram of DNA walking for concatenation sequence analysis.

7 illustrates the location of primer pairs for PERV screening.

8a to 8h are electrophoresis pictures of PERV detected from a pig specimen by a primer pair according to one embodiment of the present invention.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Flanking sequences and sets of primer for determining PERV <160> 60 <170> KopatentIn 1.71 <210> 1 <211> 125 <212> DNA <213> Sus scrofa <400> 1 caaaaaaaaa tcaaaaaaca gacaaaaaaa acaacccaat gttccttcaa tttctgctgt 60 tcagcaaagt gacccagtca cacatatatg cacattcttt ttttatacta tcttccatca 120 tgttc 125 <210> 2 <211> 270 <212> DNA <213> Sus scrofa <400> 2 gttcaaaccc gagaaattag acagagttcc tgtgctgtgc agtagaaccc cattgcttat 60 ccatttcaaa tcttattttt taaatataaa catttaacac tatttgcttc agatctcaca 120 ttttatacag atttgaaata ttactgatat aatttgcctt ttatggcacc tcatgctcca 180 tcccacttct gaaatccagg aggagcctat ggtaccctcc caaggacaaa agcctttctg 240 tgtcctccat ttcctgtatg aagggaaaat 270 <210> 3 <211> 17 <212> DNA <213> Sus scrofa <400> 3 taggatttta gcagttc 17 <210> 4 <211> 48 <212> DNA <213> Sus scrofa <400> 4 cttcactgct taaactgaaa tgtctatgtc taaaagcttt tcacactc 48 <210> 5 <211> 542 <212> DNA <213> Sus scrofa <400> 5 gtcaagttaa ttcaggagtt ttaataacca gacttttgtg ataaagaagt acaaagtctg 60 acagtaggag ttatttgtcc aagagtacag atttaatatt tataaataat cattgcagtt 120 tcatacccat tatttttcct actactccat ggatattttg aaagaaaaaa gaaaggctaa 180 tacaatggag ttactggata aaaccatgtt gaattttttt aaagttttta ttaaagtata 240 gttgatttac aatgttcctt caatttctgc tgtactgcca agtgaaaaac atgttgaatt 300 ttaatgttga catccaaatg gggtgagtct ggattagtaa tgctcaataa cttggagcga 360 gaaaagccag atcaaatttg gaagtgctgc tttttttgtt tgtttttgtc tttgttttct 420 tatagctgca cctacagcat atggaagttc ctaggccagg gatcaaatcc aaggcacagc 480 tgtgacctac tccatagctg tagcaacact ggatccttaa cccaccattc cacagcagga 540 ac 542 <210> 6 <211> 137 <212> DNA <213> Sus scrofa <400> 6 gaactcctgg aagcattggt tttcttccta gtgcacctgg ctataatctt ggacaagtta 60 gttgattttt ctaagtttta gaattgttgt taggtaaata tgaattatta aaatgtattc 120 ccctaattta tatagtg 137 <210> 7 <211> 189 <212> DNA <213> Sus scrofa <400> 7 tcacagactg cacatggaaa ttgaaatcaa gccaggaaaa ccccaatttt tcacctgcct 60 gtcacttcgc agacattcca agcgcggggt ctgtcttccg gggcctgggc cctctgcctt 120 ccttccatca tcttagagca ggtgctctca gactgccctt ggcttgcata gctcgtgtcg 180 tacttccag 189 <210> 8 <211> 126 <212> DNA <213> Sus scrofa <400> 8 ccagtccttt cttttctttt ctgcctcagc atgtcatcca ccggcggacc ggatactttg 60 tttatcttga aactgtgtgt taacatttag cacaacattt aaaggacagt tggaatctaa 120 aacaaa 126 <210> 9 <211> 127 <212> DNA <213> Sus scrofa <400> 9 cataataaca tcaaattatt ttctaaactg attataccaa tttatatttt aagcagcaat 60 gtataagcat cccctccata tacattttct ctaacatatg ctattttgaa gcactttaat 120 ttttgac 127 <210> 10 <211> 30 <212> DNA <213> Sus scrofa <400> 10 tgacaatcca tagtaaaagt aaaataatcc 30 <210> 11 <211> 380 <212> DNA <213> Sus scrofa <400> 11 tgtttacatt attatttttg tggtgaagag aaggaatatt cagtgctttg gatcagtgca 60 ttaaacaaag agaaaggggt cttttcctct ttgtttagaa cttggatgtt ttgagcatgt 120 gtcgtacacc tggcagaagt ctaagcaacc cttctccatc ctggcaggtg tgtgataccc 180 agtggatgga gctaaggaat tttataaaac tttttaccca gagagagcca tgtattgcat 240 gaagcagcag ggtgccctca agaatcacgt gacctggcag aggcagcagt gtccatggca 300 gtggccagta tccattggat gaggggcagg tcctgttgga gcctcaaggt acttggtggt 360 gaatgagtcc acagtaggct 380 <210> 12 <211> 71 <212> DNA <213> Sus scrofa <400> 12 ggctgaggta ctaaacctgg aaaatggcag ccaaacataa cttgttccat tcaatgttag 60 ttcattctag t 71 <210> 13 <211> 547 <212> DNA <213> Sus scrofa <400> 13 gctggtggtg gagctaccct ggggcccatt gcctcctagg acttccttcc tggacccttg 60 ctctgccttc tcctcactca gtccttccca catcctcagc cctgcttcgg cactaatccc 120 tcctggacag tgtggacttg ttgggtgtac cccccccatg ctgtaatctt gagggcagtg 180 cctctgtcgt gttttgcgtt gtgtgtgttg cctgatatat ggcacctgga caaaaataac 240 aactgaagag ctggtggtga cacggttggt acagggtgct ggggcccagg gcttctccta 300 ttgcagggtc agggagccat gccctccagc aggccagcct gtgggggttg agcctgtctc 360 ttctcactgg aagtgttgag tttgtaatga aaggtagact tgttatcatc tacctttgat 420 cctggccacg agcagggcct gtggcccttt gggggtggtt tcctaataac tgacctgcac 480 gaagcacaga atagtcaagg ctgtgtatgt ccatggccct tatactagat ggtagacagg 540 gccccac 547 <210> 14 <211> 390 <212> DNA <213> Sus scrofa <400> 14 caccacctgc tacctttccc catccatgct agttgctgcc agtcagccct ggtatgttcc 60 cccaaacctg gtcttttggt tggcaacaaa ttaatcacag ttggcacatc agatagcatg 120 ggtgttactc ctgtcatagg tgatctgcgg accccttcct agaattaagt tgtcttgttc 180 tgagacagta ggtgtggcca ttcaggtact acagtaacag cccaggtttg tgggtgccag 240 gacctgccag ctcccgtgcc aagtgttatc tatccgtcag ggcctgctgt gagtgcctgt 300 tcacgacgtt gctctttcag gtggatctgt gtacacaggc tccgtggagg ttcctcttca 360 tgtcagccag gcgctagacc ctggggcctc 390 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 angagtgagt gcagtccaga 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 accataggct cctcctggat 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ayragtgagt gcagtycrga 20 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gacatagaca tttcagttta agcagt 26 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 agcgagaaaa gccagatcaa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 ttgatgcaaa cagcaagagg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ayragtgagt gcagtycrga 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 agccaggtgc actaggaaga 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 ayragtgagt gcagtycrga 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gatgacatgc tgaggcagaa 20 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 caatgtataa gcatcccctc ca 22 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 ttgatgcaaa cagcaagagg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ccagtggatg gagctaagga 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 ttgatgcaaa cagcaagagg 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 ayragtgagt gcagtycrga 20 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 ttatgtttgg ctgccatttt c 21 <210> 31 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 gctacaacca ttaggaaaac taaaag 26 <210> 32 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 aaccaggact gtatatcttg atcag 25 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 gagatggaaa gattggcaac agcg 24 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 agtgatgtta ggctcagtgg ggac 24 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 aattctcctt tgtcaattcc ggccc 25 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 ccagtacttt atcgggtccc actg 24 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 cctggatgcc tgacattact 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 cacatggatt gaacacgagg 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 tgacctatgc tacctgatcc 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 ggatctgatg ttgtcactgc 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 ggcgattacg tggtataagc 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 gtgaatatct gtgtgcgcct 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 agtaagcctc actcaactcc 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 cctaagcatc tggttgtcct 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 ggtcagatga ggtgaacttg 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 tgttctagtc ttgctcctgc 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 cagtcctatg gtcgttgtca 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 atccttagta cctgccttgc 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 gaacacacgc acatcatcag 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 agccacctca cagtcattct 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 ctcgaatgac cttgactcct 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 ctatacctac gcagtgctct 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 catggtccaa tgatctcagc 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 cacatcagcc atgcagagta 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 ctgcttcctt ctccttggct 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 tccgaggatg actccaggac 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 cacagcactc caactcagtc 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 gctcaacctg ctgcttcctt 20 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 atcagcagac gtgctaggag gatc 24 <210> 60 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 ccacgcaggg gtagaggact gcgg 24  

Claims (5)

A nucleotide sequence comprising SEQ ID NO: 5, which is a 3'-consensus sequence, or SEQ ID NO: 6, which is a consensus sequence for a pig endogenous retrovirus (PERV) fused to a porcine genome. A primer pair for detecting PERV fused in a swine genome, comprising an oligonucleotide having a sequence complementary to the base sequence of claim 1 and an oligonucleotide having a sequence complementary to the PERV gene sequence. The method of claim 2, The primer pair is SEQ ID NO: 19-20 or 21-22 primer pairs for the detection of PERV fused in the pig genome. A method of detecting PERV by PCR from a pig tissue or organ specimen using the primer pair of claim 2. A method of knocking out PERV from porcine genomic DNA using the primer pair of claim 2.

Images