KR100973432B1 - Oligonucleotide probe set for dectecting Order Bacillales food-borne pathogens and microarray containing the probe set - Google Patents

Abstract

The invention bar silral less neck (Order Bacillales) sikjungdokgyun detection oligonucleotide for oligonucleotide probe set, the oligonucleotide microarray including the probe set, oligonucleotide above using the oligonucleotide probe set bar silral method of detecting less throat sikjungdokgyun, the oligonucleotide The present invention relates to a Bacillal wood poisoning detection kit comprising a set of nucleotide probes.

The probe of the present invention may be utilized for rapid detection and identification of food poisoning bacteria, which is a problem in the food industry.

Basilales Throat, Oligonucleotide, Microarray, Food Poisoning, Comparative Genomics, Probe

Description

Oligonucleotide probe set for dectecting Order Bacillales food-borne pathogens and microarray containing the probe set}

The present invention relates to a set of oligonucleotide probes for detecting Bacillus throat food poisoning bacteria, a microarray and a kit including the probe set.

Food poisoning bacteria are causing major problems in human health around the world, and there is a need for rapid detection of food poisoning bacteria in the fields of food industry, public health promotion and microbial terrorism. The major food poisoning bacteria that cause disease in humans are: Bacillus cereus ), Listeria monocytogenes , Staphylococcus aureus), Clostridium botulinum (Clostridium botulinum ), Clostridium perfringens , Campylobacter jejuni ), Vibrio parahaemoritis ( Vibrio) parahaemolyticus ), Yersinia enterocolitica , Escherichia coli ) O157: H7 and Salmonella enterica serova typhimurium enterica serovar Typhimurium). The detection of such food poisoning bacteria is very important in the human health and food industry, and sensitivity, detection time and specificity are the most important requirements in detecting food poisoning. Known biochemical methods of food poisoning bacteria generally require 2-3 days, and it is difficult to detect multiple pathogens in one experiment.

Although some methods of detecting food poisoning bacteria using DNA have been reported, PCR (polymerase chain reaction) is the most commonly used method. However, PCR has a problem in detecting multiple food poisoning bacteria because of the limited number of primers used. In addition, there is a possibility of showing false-positive or false-negative by similarity or diversity of DNA sequences among similar genus strains. Microarray experiments centered on DNA sequences have been used for experiments such as gene expression, genotyping and single-nucleotide polymorphism (Chizhikov et al. 2002. J. Clin. Microbiol. 40). : 2398-2407). In addition, the microarray test method has been proposed as a new method for detecting food poisoning bacteria because of the potential for detecting a plurality of food poisoning bacteria in one experiment (Al-khaldi et al. 2002. J. AOAC Int. 85: 906-910).

Recently, cDNA and oligonucleotide microarray techniques have been applied to the analysis of pathogenic microorganisms (Burton et al. 2005. Molecular and Cellular Probes. 19: 349-357), and one chip can detect four food poisoning bacteria. A study has been reported (Sergeev et al. 2004. Biosensors and Bioelectronics. 20: 684-698). Probes produced in these previous studies were constructed from microbial flagelline genes or virulence genes (including pathogenic genes), 16S rRNA or 23S rRNA sequences. However, these target genes share their sequence among microorganisms of the same genus, which is likely to result in cross-hybridization. In addition, in these studies PCR is performed prior to hybridization, which is limited to the number of available probes, which makes it difficult to detect a large number of pathogens (Chizhikov et al. 2001. Appl. Environ. Microbiol. 67: 3258). -3263).

As of January 2006, genomic sequences for more than 270 microorganisms have been published in the National Center for Biotechnology information (NCBI, http://www.ncbi.nih.gov/genomes/lproks.cgi ). Genomic sequencing work for food poisoning bacteria is finished or in progress.

Korean Patent Registration No. 10-611056 discloses an oligonucleotide microchip for detecting pathogenic microorganisms and a pathogenic microorganism detection method using the same. Korean Patent Registration No. 10-671501 discloses a food poisoning primer and a bacterial food poisoning detection method using the same. Is disclosed, but differs from the probe sequences of the present invention.

The present invention has been made in accordance with the above requirements, and in the present invention, 70-mer oligonucleotide probes specific for each food poisoning bacterium were selected from the genome sequence of each food poisoning bacterium, and the "FBP-1" was selected using the selected probes. A microarray chip for detecting food poisoning bacteria was named. The produced chip was used to react with genomic DNA of various food poisoning bacteria and non-pathogenic bacteria to prove its specificity, thereby completing the present invention.

In order to solve the above problems, the present invention provides rapid and accurate detection is possible bar silral less neck (Order Bacillales) sikjungdokgyun oligonucleotide for detection provides a nucleotide probe set.

The present invention also provides a microarray comprising the oligonucleotide probe set.

In addition, the present invention provides a method for detecting bacillal wood poisoning bacteria using the oligonucleotide probe set.

In addition, the present invention provides a Bacillal wood throat poisoning detection kit comprising the oligonucleotide probe set.

According to the present invention, the probe of the present invention is expected to be used for rapid detection and identification of food poisoning bacteria, which is a problem in the food industry. It has been shown to be applicable to safety studies on microbial pathogens. In addition, a new application method for microbial classification studies in comparative genomics is presented.

In order to achieve the object of the present invention, the present invention

An oligonucleotide probe for detecting Bacillus cereus , comprising one or more oligonucleotides selected from the group consisting of oligonucleotides of SEQ ID NOs: 1-10;

Listeria monocytogenes comprising one or more oligonucleotides selected from the group consisting of oligonucleotides of SEQ ID NOs: 11-20 monocytogenes ) oligonucleotide probes for detection; And

Oligonucleotide of SEQ ID NO: 21 to 30 one oligonucleotide selected from the group consisting of a nucleotide or more, including nucleotide, Staphylococcus mouse fluorescein (Staphylococcus aureus) detecting oligonucleotide for oligonucleotide for sikjungdokgyun bar silral less neck (Order Bacillales) comprising at least one probe selected from the group consisting of nucleotide detection probe provides a nucleotide probe set.

The bar silral less neck-nucleotide probe set up for sikjungdokgyun detection (Order Bacillales) according to one embodiment of the present invention, Bacillus cereus (Bacillus cereus) oligonucleotides for detecting a nucleotide probe from the group consisting of oligonucleotides of SEQ ID NOS: 1 to 10 It may include one or more oligonucleotides selected, and may preferably include all of the oligonucleotides of SEQ ID NOs: 1 to 10.

In the bar-less silral neck nucleotide oligonucleotide probe set for detecting sikjungdokgyun (Order Bacillales) in accordance with one embodiment of the invention, the L. monocytogenes cytokines to Ness (Listeria monocytogenes ) oligonucleotide probe for detection may include one or more oligonucleotides selected from the group consisting of oligonucleotides of SEQ ID NOs: 11 to 20, and preferably may include all of the oligonucleotides of SEQ ID NOs: 11 to 20.

In the bar-less silral neck nucleotide oligonucleotide probe set for detecting sikjungdokgyun (Order Bacillales) according to one embodiment of the present invention, Staphylococcus mouse fluorescein (Staphylococcus aureus ) Oligonucleotide probe for detection may include one or more oligonucleotides selected from the group consisting of oligonucleotides of SEQ ID NO: 21 to 30, preferably may include all of the oligonucleotides of SEQ ID NO: 21 to 30.

Bar silral less neck (Order Bacillales) Oligonucleotide probe set for detecting sikjungdokgyun in accordance with one embodiment of the present invention are oligonucleotides of SEQ ID NO: 1, and most preferably to 30 may include both nucleotides.

As used herein, "probe" refers to a single stranded nucleic acid sequence that hybridizes with a complementary single stranded target sequence to form a double stranded molecule (hybrid).

As used herein, oligonucleotides used as probes may also include nucleotide analogs, such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

The invention also provides a microarray having a substrate on which at least one oligonucleotide probe set is immobilized according to one embodiment of the invention.

In the microarray of the present invention, "microarray" refers to a microarray in which a group of oligonucleotides is immobilized at a high density on a substrate, and each of the oligonucleotide groups is immobilized in a predetermined region. Such microarrays are well known in the art. Microarrays are disclosed, for example, in US Pat. Nos. 5,445,934 and 5,744,305, the contents of which are incorporated herein by reference. The oligonucleotide probe set is as described above.

The term “substrate” refers to any substrate to which an oligonucleotide probe can be attached under conditions that retain hybridization properties and keep the background level of hybridization low. Typically, the substrate may be a microtiter plate, membrane (eg, nylon or nitrocellulose) or microspheres (beads) or chips. Prior to application or immobilization on the membrane, nucleic acid probes can be modified to promote immobilization or to improve hybridization efficiency. Such modifications may include homopolymer tailing, coupling with different reactive functional groups such as aliphatic groups, NH ₂ groups, SH groups and carboxyl groups, or coupling with biotin, hapten or protein.

The present invention also provides

Contacting genomic DNA of a sample with one or more oligonucleotide probe sets according to one embodiment of the present invention to hybridize a target sequence and a probe sequence in the sample; And

It provides a method for detecting the probe and the sample comprising the step of detecting the degree of hybridization between the target sequence in the bar-less silral neck (Order Bacillales) sikjungdokgyun.

The bar-less silral neck (Order Bacillales) sikjungdokgyun is bar-less silral neck uniform random number but belonging to, preferably Bacillus cereus (Bacillus cereus ), Listeria monocytogenes ( Listeria) monocytogenes ) and Staphylococcus aureus .

As used herein, "hybridization" refers to the process by which two complementary strands of nucleic acid combine to form a double stranded molecule (hybrid).

In one embodiment of the invention, the hybridization in the process of the invention can be carried out under high stringency hybridization conditions. In this embodiment, the high stringency hybridization conditions preferably comprise 0.12 M phosphate buffer comprising the same moles of Na ₂ HPO ₄ and NaH ₂ PO ₄ , 1 mM EDTA and 0.02% sodium dodecyl sulfate at 65 ° C. will be.

In addition, in this specification, "stringency" is a term used to describe the temperature and solvent composition present during hybridization and subsequent processing steps. Under high stringency conditions highly homologous nucleic acid hybrids will form. That is, hybrids without sufficient degree of complementarity will not be formed. The stringency of the assay conditions thus determines the amount of complementarity required between the two nucleic acid strands forming the hybrid. Stringency is chosen to maximize the difference in stability between the target and non-target nucleic acids and the hybrids formed.

The sample may be any sample including a microorganism suspected of food poisoning bacteria, and the method for separating genomic DNA from the sample may use a method commonly used in the art, for example, DNeasy Tissue Kit (QIAGEN , Hilden, Germany) can be used to extract genomic DNA.

In the method of the present invention, the target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, the 5'-terminus of the primer is labeled with Cy-5 or Cy-3 to synthesize a nucleic acid using a Klenow fragment or perform PCR to label the target sequence with a detectable fluorescent label. In addition, the label using the radioactive material is added to the nucleic acid synthesis or PCR reaction solution when radioisotopes such as ³² P or ³⁵ S are added to the nucleic acid synthesis or PCR reaction solution when the nucleic acid synthesis or PCR is performed, and the radioactivity is incorporated into the amplification product. It can be labeled radioactively.

In the method of the invention, the probe set can be immobilized on a substrate of a microarray. The oligonucleotide probe set immobilized on the microarray substrate is as described above.

In the method of the present invention, the bar silral less neck (Order Bacillales) detection of sikjungdokgyun is a material that generates a detectable signal and labeled genomic DNA of said sample, raised above them hybridized with a nucleotide probe and a signal arising therefrom This can be done by detecting. The detectable signal may be, for example, an optical signal or an electrical signal, but is not limited to these examples. The optically active material may be a material that generates fluorescence or phosphorescence. The fluorescent material may be, for example, fluorescein, Cy-5, and Cy-3. In addition, the genomic DNA may or may not be labeled with a substance that generates a detectable signal before or after hybridization. The hybridization result of the genomic DNA and the oligonucleotide probe when not labeled can be detected by, for example, an electrical signal, but is not limited to these examples.

The present invention also provides

It provides containing one or more oligonucleotide probe sets in accordance with an embodiment of the present invention, a bar-less silral neck (Order Bacillales) sikjungdokgyun detection kit. The oligonucleotide probe set is as described above. The kit also requires reagents for the hybridization reaction, which may be used conventionally in the art, and are not particularly limited. In addition, the kit of the present invention may further include a user manual describing the conditions for performing the optimal reaction.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example

Experiment method

Microbial Strains Used

The microorganism used in the present invention was used to collect the strains of the American Type Culture Collection (ATCC) as shown in Table 1.

Table 1. Strains used in the present invention.

Bell Strain Bell Strain Salmonella serovar Typhimurium ATCC 19585 Listeria monocytogenes ATCC 19118 Salmonella serovar Typhimurium ATCC 14028 Listeria monocytogenes ATCC 7644 Salmonella serovar Typhimurium ATCC 13311 Listeria monocytogenes ATCC 15313 Salmonella serovar Typhi ATCC 6539 Listeria ivanovii ATCC 19119 Salmonella serovar Typhi ATCC 33459 Listeria welshimeri ATCC 35897 Salmonella serovar Paratyphi B ATCC 13428 Listeria inocua ATCC 33090 Salmonella serovar Paratyphi C ATCC 10719 Listeria grayi ATCC 25401 Salmonella serovar Enteritidis ATCC 4931 Listeria seeligeri ATCC 35967 Salmonella bongori ATCC 43975 Staphylococcus aureus ATCC 25923 Salmonella enterica salamae ATCC 15793 Staphylococcus aureus ATCC 6538P Salmonella enterica arizonae ATCC 13314 Staphylococcus aureus ATCC 6538 Salmonella enterica diarizonae ATCC 43973 Staphylococcus aureus ATCC 29737 Salmonella enterica houtenae ATCC 43974 Stapylococcus haemolyticus ATCC 29970 Salmonella enterica indica ATCC 43976 Stapylococcus epidermidis ATCC 14990 Salmonella serovar Choleraesuis ATCC 13312 Vibrio parahaemolyticus ATCC 27969 Salmonella serovar Gallinarum ATCC 9184 Vibrio parahaemolyticus ATCC 33844 Salmonella serovar pullorum ATCC 9120 Vibrio parahaemolyticus ATCC 17802 Escherichia coli O157: H7 ATCC 43894 Vibrio cholerae ATCC 14547 Esherichia coli ATCC 27325 Vibrio vulnificus ATCC 33815 Esherichia coli ATCC 23736 Campylobacter jejuni ATCC 43429 Esherichia coli ATCC 25922 Campylobacter jejuni ATCC 33291 Esherichia coli ATCC 11775 Clostridium botulinum ATCC 3502 Yersinia enterocolitica ATCC 23715 Clostridium perfringens ATCC 3624 Bacillus cereus ATCC11778 Citrobacter frenudii ATCC 8090 Bacillus cereus ATCC14579 Enterobacter aerogenes ATCC 13048 Bacillus cereus ATCC10876 Enterobacter cloacae ATCC 13047 Bacillus subtilis ATCC 6633 Enterobacter sakazakii ATCC 29544 Bacillus subtilis ATCC 6051 Enterococcus faecalis ATCC 19433 Bacillus thuringiensis ATCC 35646 Kelbsiella pneumoniea subsp. pneumoniae ATCC 8724 Bacillus thuringiensis ATCC 10792 Proteus vulgaris ATCC 29905 Bacillus anthracis ATCC 14578 Rahnella aquatilis ATCC 15552 Listeria monocytogenes ATCC 19111 Shigella boydii ATCC 8700 Listeria monocytogenes ATCC 19113 Shigella flexneri ATCC 12022 Listeria monocytogenes ATCC 19114 Shigella sonnei ATCC 25931 Listeria monocytogenes ATCC 19115

A total of 69 strains were used and consisted of food poisoning bacteria and non-food poisoning bacteria. The food poisoning bacteria used were: Bacillus cereus ), Listeria monocytogenes ( Listeria) monocytogenes ), Staphylococcus aureus), Clostridium botulinum (Clostridium botulinum ), Clostridium perfringens ), Campylobacter jejuni ), Vibrio parahaemoritis ( Vibrio) parahaemolyticus ), Yersinia enterocolitica ), Escherichia coli ) O157: H7, Salmonella enterica serovatipi ( Salmonella) enterica serovar Typhi) and Salmonella typhimurium Entebbe Rica vertical bar (Salmonella enterica serovar Typhimurium). Each microorganism was incubated in each medium and condition, Bacillus anthracis ATCC 14578 and Clostridium In the case of botulinum ATCC 3502, genomic DNA was obtained from the Korea Center for Disease Control and Prevention (KCDC).

Genome DNA  extraction

Each grown microorganism was centrifuged to collect the cells and genomic DNA was extracted using DNeasy Tissue Kit (QIAGEN, Hilden, Germany). The concentration of extracted genomic DNA was measured using a UV-spectrophotometer (Model UV-1700, Shimadzu, Tokyo, Japan), and only the DNAs having an absorbance ratio (A ₂₆₀ / A ₂₈₀ ) of 1.8 to 2 were used in the present invention. .

Genome of food poisoning bacteria DNA  order

Genomic DNA sequences used in the present invention are shown in Table 2.

TABLE 2 Genome sequences used in the present invention.

Bacterial strains Ref. seq Genbank Total base (bp) Protein coding genes Pathogenic Bacillus cereus ATCC 14579 NC_004722 AE016877 5,411,809 5234 Pathogens Listeria monocytogenes strain EGD NC_003210 AL591824 2,944,528 2846 Pathogens Listeria inocua NC_003212 AL592022 3,011,208 2989 Non-pathogenic bacteria Stapylococcus aureus N315 NC_002745 BA000018 2,814,816 2594 Pathogens Stapylococcus aureus Mu50 NC_002758 BA000017 2,878,529 2714 Pathogens Stapylococcus aureus MW2 NC_003923 BA000033 2,820,462 2632 Pathogens Clostridium botulinum Hall strain A (ATCC 3502) CB.dbs 3,886,916 Pathogens Clostridium perfringens str. 13 NC_003366 BA000016 3,031,430 2660 Pathogens Campylobacter jejuni subsp. jejuni NCTC 11168 NC_002163 AL111168 1,641,481 1634 Pathogens Vibrio parahaemolyticcus RIMD 2210633 NC_004603 BA000031 3,288,558 3080 Pathogens NC_004605 BA000032 1,877,212 1752 Yersinia enterocolitica YE.dbs 4,615,899 Pathogens Escherichia coli O157: H7 EDL933 NC_002655 AE005174 5,528,445 5324 Pathogens Escherichia coli O157: H7 NC_002695 BA000007 5,498,450 5361 Pathogens Escherichia coli K12 NC_000913 U00096 4,639,221 4279 Non-pathogenic bacteria Salmonella enterica serovar Typhimurium LT2 NC_003197 AE006468 4,857,432 4451 Pathogens Salmonella enterica serovar Typhi CT18 NC_003198 AL513382 4,809,037 4395 Pathogens

Most of the food poisoning sequence files used in the present invention (ffn file (coding region sequence), fna file (whole genome sequence)) were obtained from NCBI, Yersinia enterocolitica and Clostridium Genomic DNA sequences of botulinum Hall strain A (ATCC 3502) are described in Sanger Institute ( http://www.sanger.ac.uk/Projects/Y_enterocolitica/ , http://www.sanger.ac.uk/Projects/C_botulinum/ ). Obtained from Genomic DNA sequences of non-pathogenic bacteria associated with food poisoning bacteria were also used, and a total of 16 genomic DNA sequences were used in the present invention.

Food Poisoning Bacteria Specific Using Comparative Genomics Probe  Screening

The schematic diagram of the screening operation of 70-mer oligonucleotides specific to each food poisoning bacterium is shown in FIG. 1. A database of 16 bacterial genomic DNA sequences was made, and the coding region sequences of each of the 11 food poisoning bacteria were compared to a database of genomic DNA sequences using the BLAST (Basic Local Alignment Search Tool) program. Clostridium In the genomic DNA of botulinum and Yersinia enterocolitica , since the gene sequence portion has not been analyzed yet, the entire genome sequences were cut into 400 bp by 800 bp, and then 800 bp DNA fragments were compared with a database of genomic DNA sequences.

Of the BLAST results, the products with the highest similarity were selected for each gene (or individual DNA fragments), and based on these results, genes (or DNA fragments) that were thought to be specific for each food poisoning bacterium were selected. Again, it was compared with NCBI's nr database using the BLAST program. Through this method, genes thought to be specific for each food poisoning bacterium were selected (Table 3), and the selected genes were divided into 70-mer size DNA fragments shifted by 1 base pair from the starting sequence. Of these 70-mer DNA fragments, the sequences with Tm (melting temperature) value of 78 ± 0.5 ° C were reselected and 70-mer DNA sequences specific for each food poisoning bacterium were finally selected by comparison with the databases.

Table 3. Number of 70-mer probes and constructed 70-mer oligonucleotides selected from genomic DNA sequences of 11 food poisoning bacteria.

Bacillus cereus ATCC 14579 Listeria monocytogenes EGD Stapylococcus aureus Mu50 Clostridium botulinum Hall strain A Clostridium perfringens str. 13 Campylobacter  jejuni NCTC 11168 Gene count
(snippet) 5,234 2,846 2,714 9758 ^a 2,660 1,634 Number of genes selected first 2,508 136 1,422 3402 ^a 1,414 935 Secondary Selected Gene Count 2,004 113 333 38 ^a 916 722 Number of 70mer DNA Fragments in Secondary Selected Genes 1,110,015 81,919 252,300 27,778 637,562 524,884 70mer DNA Fragment Number
Tm. = 78 ° C 10,873 805 1,988 251 1,201 2,410 Number of fragments selected using BLAST results 49 152 364 44 228 238 Number of pieces selected 36 106 126 17 103 122 Constructed 70-mer oligonucleotides 19 30 20 15 30 30 Number of 70mer Probes Used to Build FBP-1 10 10 10 10 10 10

(continue)

Vibrio parahaemolyt icus RIMD Yersinia enterocolitica Escherichia coli O157: H7 EDL933 Salmonella enterica serovar Typhimurium LT2 Salmonella enterica serovar Typhi CT18 Gene count
(snippet) 4,831 11539 ^a 5,323 4,451 4,395 Primary Selection
Electronic can 2,653 2948 ^a 848 196 290 Secondary Selection
Electronic can 1,669 87 ^a 336 138 210 Secondary Selection
70mer in e
DNA fragment number 1,069,484 63,771 166,599 97,850 97,875 70mer DNA Fragment
Number
Tm. = 78 ° C 8,864 332 1,114 518 598 BLAST results
Selection by using
Fragments counted 1,571 67 141 124 166 Finalized
Flight number 26 24 62 91 102 Built 70-mer
Oligonuclei
Ortides 20 20 15 41 35 In building FBP-1
Used 70mer
Probe Count 10 10 10 10 10

Construction of Positive Control and Negative Control

Arabidopsis A portion of the putative tubulin beta-4 chain (accession number AY059075) and actin 3 (accession number AY093784) genes of thaliana were amplified by PCR with the following primers: Actin3-f 5'-CTCTTGACTACGAGCAGGAA-3 '(SEQ ID NO: 113) ) And Actin3-r 5'-AGTCCTTCCTGATGTCGACA-3 '(SEQ ID NO: 114); Tb4-f 5'-AAGAGGTTGACGAGCAGATG-3 '(SEQ ID NO: 115) and Tb4-r 5'-GCCTTTCTCCTGAACATAGC-3' (SEQ ID NO: 116). The amplified DNA fragment was inserted into pMD18-T vector using Perfect-T cloning kit (TaKaRa, Shiga, Japan), and the produced plasmid DNA was stored at -20 ° C.

Sequences of the probes for use as positive and negative controls were selected from the putative tubulin beta-4 chain (accession number AY059075) and actin 3 gene (accession number AY093784) of A rabido psis thaliana , respectively: 5'- AAGTCCAGTGTCTGTGATATTGCACCAAAGGGTTTGAAAATGGCGTCTACTTTCATTGGTAACTCAACCT-3 '(SEQ ID NO: 111) and 5'-AGGTTCTTTACCAGCCATCTATGATTGGTATGGAGAATGCTGGTATCCATGAAACCACCTATAACTCCAT-3'.

Oligonucleotide Microarray  making

An oligonucleotide DNA chip consisting of 112 probes (224 oligonucleotide DNA spots) was constructed. The 70-mer oligonucleotides converting the 5 'end to an amine were prepared by Illumina (Illumina Inc., San Diego, Calif.), Dissolved in a hybridization solution at a concentration of 50 pmol, and then pixsys 5500 on CMT-GAPS II silane slide glass. DNA chips were prepared using an arrayer (Cartesian Technologies, USA). After fabrication, one chip was dyed with Syto61 and scanned with a GenePix 4100A scanner (Axon Instruments, Redwood City, Calif.) To confirm the fabrication of the chip. Each block on the chip was zoned by covering with a CoverWell perfusion chamber (PC8R-0.5, Grace-Bio Labs, Inc., Bend, OR) just before hybridization.

sample DNA of Cy3  Fluorescent material labeling and Hybridization

The microbial genomic DNAs were labeled with Cy3 fluorescent material using the BioPrime DNA labeling system (Invitrogen, Carlsbad, Calif.). 500 ng of genomic DNA and 1 ng of positive control were added to eppendorf tube and filled with 20 μl of tertiary distilled water. Then, 20 μl of 2.5X Random Primers Solution was added to boiling water for 5 minutes. It was. 6 μl of tertiary distilled water, 1 μl of dNTP solution (10 mM dATP, dGTP and dTTP; 3 mM dCTP), 2 μl of Cy3-dCTP (1 mM, GeneChem Inc., Daejeon, Korea), 40 units of Klenow fragment After the addition, the reaction was carried out for 2 hours at 37 ℃. After the reaction, DNA labeled with Cy3 fluorescent material was precipitated with sodium acetate (3M, pH 5.2) and 100% ethanol, and then dissolved in 45 μl hybridization solution. The solution was boiled in boiling water for 2 minutes, cooled at room temperature and placed in each chamber of the microarray chip and hybridized at 60 ° C. for 8 hours. After hybridization, the DNA chip was washed for 5 minutes at 60 ° C. with a primary cleaning solution (2X SSC, 0.1% SDS), and for 3 minutes at room temperature with a secondary cleaning solution (1X SSC), followed by a tertiary cleaning solution (0.2X SSC) at room temperature for 3 minutes and centrifuged to dryness.

Scan, image analysis and classification

The hybridized chip was scanned at a resolution of 5 μm using an Axon Instruments GenePix 4100A scanner (Axon Instruments, Redwood City, CA), and the scanned image was scanned using GenePix Pro 6.0 (Axon Instruments, Redwood City, CA) program. And analyzed. Image analyzed files were saved as MS Excel file. Analysis of each microorganism MS excel files were analyzed using GeneSpring 7.2 (Silicon Genetics, Palo Alto, CA) program. The algorithm used was analyzed based on Pearson correlation.

Example  1: Specific for 11 food poisoning bacteria through comparative genomics Probe  Screening and FBP -1 made

Comparative genetics was used to select 70-mer oligonucleotides specific for 11 food poisoning bacteria, and the process is shown in Table 3. A total of 275 70mer probes were prepared from 11 food poisoning bacteria. These probes were fixed on slide glass and reacted with samples prepared from genomic DNA of various microorganisms. Finally, 110 probes (10 probes for each food poisoning bacterium) of 275 probes were selected, and a microarray chip named FBP-1 was manufactured as shown in FIG. 2. The produced FBP-1 is divided into a total of eight blocks, each block is repeated twice with 110 phagocytic bacteria-specific probes, a positive control and a negative control. Therefore, the manufactured FBP-1 can react a total of eight samples in one experiment. Each block is composed of 12 rows and each row consists of 20 spots (10 probes).

Table 4. 70-mer oligonucleotide probe sequences for construction of FBP-1.

DNA chips were prepared as shown in FIG. 2 using the probes (70mer) obtained from food poisoning bacteria. Ten 70mer probes (5'-amine modifications) were prepared for each food poisoning bacterium, and DNA chips were prepared primarily by printing onto amine-silane coated slides at a concentration of 50 uM.

The fabricated DNA chip was printed with 10 specific probes for 10 kinds of food poisoning bacteria, and a total of 110 spots, 2 positive control spots, and 2 prints of 10 probes specific for S. typhi that specifically caused diseases in humans. Negative control spots.

Based on the probes specific to the selected food poisoning bacteria and the experimental results, a microarray chip as shown in FIG. 2 having 110 spots (selected 10 specific probes for each food poisoning bacteria) was finally manufactured. -1 (Food Borne Pathogen).

The final DNA chip consists of a total of eight blocks, each of which has 110 probes repeated twice, and the tubulin beta-4 chain and Actin 3 genes present in the plants for the positive control and the negative control, respectively. The sequence of was used.

Genomic DNA was used for Bioprime DNA labeling kit and labeled with Cy3. As a positive control DNA, the tubulin beta-4 chain gene of the plant was inserted into the plasmid DNA.

Example  2: Enterobacteriae  Of food poisoning bacteria Microarray  result

Salmonella, Escherichia coli O157: H7 and Yersinia enterocolitica is known as a food poisoning bacterium belonging to Enterobacteria. These food poisoning bacteria are known to be difficult to detect because they have high similarity in genomic DNA sequence with other microorganisms of Enterobacteria. Recently 10 probes constructed from the gyrB gene were evaluated to identify Escherichia coli , Shigella and Salmonella (Kakinuma et al. 2003. Biotechnology and Bioengineering. 83: 721-728). However, some probes showed reaction with other microorganisms, and thus did not show enough results to distinguish them from microorganisms within Enterobacteriae. Salmonella in the present invention enterica serovar Typhimurium, Salmonella enterica serovar Typhi, Escherichia coli O157: H7 with Yersinia Probes specific to enterocolitica were presented, and each of the ten probes was confirmed to be specific to each food poisoning bacterium as shown in FIG. 3. Salmonella enterica serovar Typhimurium was confirmed to specifically react to 10 selected probes as shown in Figure 3 (A, B, C).

Of the 10 Salmonella enterica serovar Typhimurium-specific probes, four probes were found to react specifically to serovars belonging to Salmonella subspecies I, which are known to cause disease in mammals or birds (Fig. 7, Salmonella). serovar Choleraesuis, Enteritidis, Pullorum, Gallinarum, Paratyphi C and Paratyphi B). If Salmonella in that belonging to Salmonella subspecies I has been confirmed that it does not react with any probe. In the case of Salmonella serovar Typhi specific probes, Salmonella serovar Typhi ATCC 33459 and ATCC 6539 reacted specifically as shown in FIGS. 3 and 7. Salmonella serovar Paratyphi A is a strain that is known to cause disease in humans, and it was confirmed that it reacts with three of serovar Typhi-specific probes, which has been reported as serovar Typhi and Paratyphi A. Genetic traits were confirmed to be close (data not shown). Yersinia enterocolitica ATCC 23715 and Escherichia In the case of coli O157: H7 ATCC 43894, as shown in FIG. 3 (G and E), it was confirmed that the reaction with each specific probe.

In particular, Escherichia, a non-pathogenic bacterium as shown in FIGS. 3F and 7 coli By confirming that they do not react, the probes selected in the present invention are pathogenic Escherichia coli O157: H7 strains and non-pathogenic Escherichia. Coli was selected to have the ability to screen. As a result of reacting with a number of non-pathogenic bacteria belonging to Enterobacteriae, it was confirmed that the specific to food poisoning bacteria as shown in FIG.

E. coli O157: H7: E. coli O157: were found to specifically react against the H7 ATCC 43894, was found to having no pathogenicity which do not react with respect to the E. coli strains.

Salmonella typhimurium , Salmonella typhi : Salmonella Typhimurium and Salmonella typhi specifically reacted with various Salmonella strains. As a result, various patterns of microarray experiments were observed according to Salmonella serovar .

Results of the experiment with respect to the corresponding to the intestinal microflora sikjungdokgyun, specific probes for Salmonella typhimurium have been able to check that the reaction in Salmonella spp., Salmonella Probes specific to typhi are Salmonella known to cause disease in humans Specific to typhi and paratyphi A were confirmed.

E. coli O157: H7 on the specific probe is also a sikjungdokgyun E. coli O157: H7 was found to only specific, ready-made Yersinia Probes of enterocolitica were also found to react specifically.

As a result of the reaction with various enteric microorganisms with the negative control sample DNA, the produced DNA chip did not react with the non-pathogenic enteric microorganisms (non-food poisoning bacteria).

Example  3: In the Bacillales  Belonging to food poisoning bacteria Microarray  result

Results for food poisoning bacteria belonging to Bacillales are shown in FIG. Staphylococcus aureus ATCC 25923 showed specific results as shown in A and 7 of FIG. Staphylococcus haemolyticus ATCC 29970 and Staphylococcus epidermis ATCC 14990 Fig-1 and FBP After a reaction, 4 denotes a reaction that does not result, as the (B, C) Staphylococcus The probes 10 are manufactured in aureus was found to react specifically with Staphylococcus aureus. For Listeria monocytogenes, Fig. 4 (DG) and also as seven there was a strain of seven Listeria monocytogenes found that the reaction specifically with the probe, the reaction patterns of the seven strains in accordance with the respective strain others I could confirm it. This result indicates that genetic traits are different among L. monocytogenes strains. Listeria , commonly known as pathogenic bacteria for animals, whose genomic DNA sequence is similar to L. monocytogenes It can be seen that ivanovii also reacts with 10 probes as shown in FIGS. 4 and 7. Bacillus Ten probes specifically designed for cereus are Bacillus as well as B. cereus ATCC 10778 and ATCC 14579 as shown in FIG. 4 (HK). It was confirmed that the reaction with anthracis ATCC 14578 and Bacillus thuringiensis ATCC 10792. These three strains are the bacterium Bacillus Bacillus, a non-pathogenic bacterium that is considered a cereus group and responded with a negative control strain It did not react with subtilis .

Bacillus cereus : 3 kinds of Bacillus It was confirmed that the specific development of the cereus strains, Bacillus subtilis , Bacillus Since the strains of thuringiensis did not develop, it was confirmed that the produced probes were specific.

Staphylococcus aureus : 5 species of Staphylococcus Reacted to aureus , Stapylococcus haemolyticus , Stapylococcus It was confirmed that it did not react with epidermidis .

Listeria monocytogenes : Total 7 Listeria monocytogenes strains and as a result of experiments with strains such as Listeria Listeria ivanovi The monocytogenes ATCC 7644 and ATCC 19113 developed color in all 10 spots, but the ATCC 19111 and ATCC 19114 developed different patterns. Listeria welshimeri, Listeria inocua , Listeria grayi , Listeria The control bacteria of seeligeri did not appear to develop.

Staphylococcus Probes specifically designed for aureus are Staphylococcus It was confirmed that the specific reaction only to aureus .

For Listeria is the difference between the result of the pattern for the production of the probe 10, but Listeria It was found to react in monocytogenes, a pathogenic bacterium known as Listeria It was confirmed that the response to ivanovi .

Bacillus In cereus , most of the probes are Bacillus cereus , Bacillus Only thuringiensis and Bacillus anthracis reacted specifically. These three microorganisms have recently been known as Bacillus It is considered to be a cereus group and it is known that the similarity of genomic DNA is very high as a pathogenic bacterium.

Example  4: In Vibrionaceae  For food poisoning bacteria belonging to Microarray  result

Vibrio As a result of reaction with FBP-1, parahaemolyticus ATCC 17802 and ATCC 33844 showed specific reaction with 10 selected probes as shown in FIGS. 5 and 7. Vibrio known as pathogenic bacteria cholerae ATCC 14547 and Vibrio The vulnificus ATCC 33815 did not react with the probes.

Vibrio parahemolyticus : 3 species of Vibrio specific for parahemolyticus and Vibrio cholerae And Vibrio It was confirmed that it did not respond to vulnificus .

Example  5: Clostridium perfringens , Clostridium botulinum  And Campylobacter jejuni of Microarray  result

Campylobacter spp. Is known as a pathogenic bacterium and reacted with C. jejuni ATCC 33291 and ATCC 43429, showing specific results as shown in FIG. Clostridium botulinum and Clostridium Each of the 10 probes specifically prepared in perfringens also reacted with C. botulinum ATCC 3502 and C. perfringens ATCC 3624.

* Clostridium botulinum , Clostridium perfringens , Yersinia enterocolitica : Clostridium of each botulinum ATCC 3502, Clostridium perfringens ATCC 3624, Yersinia enterocolitica It was confirmed that it was specific for ATCC 23715.

* Campylobacter jejuni : 2 types of Campylobacter jejuni ATCC 43429 developed 10 spots, but the control pattern showed different color development patterns, so experiments with additional probes and Campylobacter jejuni You should check the results with the various strains.

Clostridium perfringens , Clostridium botulinum , Camphylobacter Jejuni also showed a specific reaction result.

Example  6: genome of various microorganisms DNA  With the field Microarray  result

A total of 69 microorganisms, including food poisoning bacteria and non-pathogenic bacteria, were reacted with FBP-1 chips, and the results are shown in FIG. 7. The strains used in the present invention reacted with FBP-1 chips as positive and negative control strains for probes selected for each food poisoning bacterium. The overall results are shown in Figure 7 and confirmed that the probes specific for each food poisoning bacteria selected in the present invention and the produced FBP-1 chip has the ability to distinguish food poisoning bacteria.

Genomic DNA was extracted using 10 kinds of food poisoning microorganisms and control microorganisms that have been secured for the first-generation microarray chips. Confirmed.

It was confirmed that the food poisoning bacteria performed the experiment reacted with each specific probe, and the non-food poisoning bacteria showed a result of not reacting with the microarray chip (FBP-1) manufactured in the present invention. This dendrogram showed the specific response to the microarray chip food poisoning bacteria and pathogenic bacteria produced in the present invention.

1 shows a flow chart of the selection of 70-mer oligonucleotide probes from 11 food poisoning bacteria using genomic sequence and comparative genomics.

Figure 2 shows the layout of the FBP-1 microarray after Syto 61 test. Each slide consists of eight blocks, each block double spotted with 110 probes, a positive control and a negative control.

3 is a microarray result of Enterobacteriae food poisoning bacteria.

A, Salmonella enterica serovar Typhimurium ATCC 19585; B, serovar Typhimurium ATCC 13311; C, serovar Typhimurium ATCC 14028; D, Salmonella enterica serovar Typhi ATCC 33459; E, Escherichia coli 0157: H7 ATCC 43894; F, E. coli ATCC 11775; G, Yersinia enterocolitica ATCC 23715.

4 is a microarray result of Bacillales food poisoning bacteria.

A, Staphylococcus aureus ATCC 25923; B, S. haemolyticus ATCC 29970; C, S. epidermis ATCC 14990; D, Listeria monocytogenes ATCC 19115; E, L. monocytogenes ATCC 19118; F, L. ivanovii ATCC 19119; G, L. inoccua ATCC 33090; H, Bacillus cereus ATCC 10778; I, B. cereus ATCC 14579; J, B. thuringensis ATCC 10792; K, B. antharacis ATCC 14578 .

5 is a microarray result of Vibrionaceae food poisoning bacteria.

A, Vibrio parahaemolyticus ATCC 17802; B, V. parahaemolyticus ATCC 33844; C, V. cholerae ATCC 14547; D, V. vulnificus ATCC 33815.

6 is Clostridium perfringens , Clostridium Microarray results of botulinum and Campylobacter jejuni .

A, Clostridium perfringens ATCC 3624; B, Clostridium botulinum ATCC 3501; C, Camphylobacter jejuni ATCC 43429; D, C. jejuni ATCC 33291.

7 is a dendrogram analyzed using microarray data sets of various bacterial genomic DNAs using the Genespring program.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Oligonucleotide probe set for dectecting Order Bacillales          food-borne pathogens and microarray containing the probe set <130> PN08101 <160> 116 <170> KopatentIn 1.71 <210> 1 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC1312 probe <400> 1 tacacttcgc gttgtggcag aggttattaa gaagcgtgat gataaaaaaa tcattacgct 60 gcaaacaaac 70 <210> 2 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC1501 probe <400> 2 ttgcatgggg atcgcatatt acgattatgt tctctatatg tagggatgtt acaagcagag 60 ctgctagtca 70 <210> 3 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC1801 probe <400> 3 tttatcgtag tgaaaaatca cgtagttctc atactggtgg gaaaggaatg gggcttgcaa 60 tttcgaaaag 70 <210> 4 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC2098 probe <400> 4 tgaggagttt ttttcctcaa cgttatatgc acgtacgaaa caagattggg catatgcacc 60 aaacatgtat 70 <210> 5 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC2140 probe <400> 5 ctccctttac atccagtccc ttttaacgga gaagtcatct cctctcaaac aggagaatat 60 cgaattcgta 70 <210> 6 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC2393 probe <400> 6 aatggtggca cctcaaataa gacaccgatt tgactctgta aaaaaatttg cagaggagga 60 atctattccg 70 <210> 7 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC3742 probe <400> 7 ttgctgagaa acaattaact gctatccatg gtataggacc atggactgcc aactatgttt 60 taatgcgttg 70 <210> 8 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC4039 probe <400> 8 gatgtttcag cacgtcgagg ttataaagca catgatgtaa tctcactttc aagtagcaca 60 cctaaccttg 70 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC4292 probe <400> 9 aaaattgtgc aagttggagc ggaatttcat gtcggaattt tgtttgtcgc atcatatgct 60 catcctttaa 70 <210> 10 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> BC4598 probe <400> 10 tgtatttgta ggaggtattc tcttagtgct tcctgggtat gtgacagata tgctagggtt 60 tatctgcgtg 70 <210> 11 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo0754 probe <400> 11 ggaacttaat tctgacgcca aattagtgac acgagtagaa cgaatcgatg gcaaatggta 60 cattaatgca 70 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo2443 probe <400> 12 tgcatttttt ggaatagcag taatttgttt gttattccct tggatgtcta gcgggataga 60 tgcagcaaca 70 <210> 13 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo2732 probe <400> 13 attcgtttag gaattgagca acttccaaaa aaagaaattg agcaagttgc gacaagaatt 60 gcttatgcgc 70 <210> 14 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo1030 probe <400> 14 gcaaccaaca gcaggcctta ttttacttgg cactaattta aacgctgaag aaattaaccg 60 aatacagcaa 70 <210> 15 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo1033 probe <400> 15 gttagttatg gtgcacttgg tatgagccat cattcgcttc aagatattgc tgttactaga 60 gcgattccta 70 <210> 16 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo1036 probe <400> 16 gtcagttaga gccaatcaag ccagttatca attcagaacc gtgttacgaa ttgatgggat 60 atagtcgaca 70 <210> 17 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo2821 probe <400> 17 gacatatgtg tatactaaaa acatcgaagc agcagagccg ataacagtga attacgtgga 60 tgctaatggc 70 <210> 18 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo0017 probe <400> 18 ctaagccaaa aaagaaaacc gtcgctgctg ttaaaaagaa aaaagagaca cctccaaaac 60 caaaagaacc 70 <210> 19 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo0257 probe <400> 19 aagataaaat tgtaccgaat ttggttggag tggacatcgg ttgtgggttg tatgtagtga 60 agctaaaacc 70 <210> 20 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lmo0459 probe <400> 20 gcagtttaaa gtagccctat ataaggcttg caccgaggag tctaagaaat cagagagtgc 60 gttcattaaa 70 <210> 21 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0020 probe <400> 21 agaaggctct aatcaaattc aagtcacttg gggtgaaaaa ggcgtctttg attatcgtcg 60 ttcgttattg 70 <210> 22 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0021 probe <400> 22 agcccacaga tggtgcagat aagaagcatc aagttattgg agtgagaaaa gcaatcgagg 60 cattatatta 70 <210> 23 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0089 probe <400> 23 acaatcaatt gcagaagcac gagcacttct agatgaattt gaagcccaaa tggacgaaga 60 cgttaaaata 70 <210> 24 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0101 probe <400> 24 atccgtactt agcgttggac aatcaaatga atatgcgtgc aacggaaatg atccatttga 60 acattaatgc 70 <210> 25 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0110 probe <400> 25 ggtccagaac tagcagacat tattccatca ctagcaacaa tggtggtgtt agcatttgtt 60 tgtcgtaaat 70 <210> 26 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0149 probe <400> 26 tatctaaagc agacggtaca gcagttaaag tcgcaccaaa aactgtagtg aatctaatcg 60 gtgcattctt 70 <210> 27 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0155 probe <400> 27 ttccctggtg tccttattcg aacttccaca gaaagaccgg aagtactaga taaaggtacg 60 gttattgtag 70 <210> 28 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0178 probe <400> 28 tttggttacc tcaagaccga aatcaagtaa agcaaagtga tgacaagagg catgcaagtc 60 gttatcaaaa 70 <210> 29 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0182 probe <400> 29 atgattccca aagtgctaga tgccaaaaat gcgattgaaa atggctgtcc taaagttatc 60 attgcatcag 70 <210> 30 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> SAV0190 probe <400> 30 cgttgataat ttgaataacg gacgttatca aggcgaaatg caaattgtga gacaaacgct 60 tagtgcacat 70 <210> 31 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0001 probe <400> 31 ggcggtatac tttgtgggaa tctaaacaca ttctcagaat cgtatttgac cttaacttgg 60 gccagtagat 70 <210> 32 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0002 probe <400> 32 acgatgttat agatatcctc cggtactccg atatttttac aggctttcat attaacgggc 60 aaggtagcca 70 <210> 33 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0004 probe <400> 33 aattgaacgg cgagaatatg gagttgcaca caataaggca tccgcttttg gatatttaag 60 ttctgtcatt 70 <210> 34 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0007 probe <400> 34 tctgttatct tgaaaacctt accagataca ctgctatgaa ttctagcccc caatccatta 60 ggctctgcta 70 <210> 35 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0008 probe <400> 35 tggaagccct catctgtatc tttatccact atatctgcat caccatttgt gtttatgcga 60 gcttcttctc 70 <210> 36 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0009 probe <400> 36 cgcagctgtt tggataggta atgacaattc ttctacagtg gatggggtat atagtagtac 60 tgcagctaga 70 <210> 37 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0011 probe <400> 37 gaacagttag ctgtacctcc tctcatttct ggtccataag atggtaacca tgaaacttcc 60 atatttgcgt 70 <210> 38 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0012 probe <400> 38 ctcgtgatat atccttccaa tctaagttga tcataggcat tttctaccga gtttctgccg 60 acctgcaatt 70 <210> 39 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0013 probe <400> 39 acccgctgca aaacaattaa aggagcgatt tggaactcca tatttattgg ctagacccta 60 tggaattaag 70 <210> 40 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CB0017 probe <400> 40 aaagcctgct agtcccatta caacattaag tcgggttact cctaatgcat gatcatgata 60 ccacaaagtt 70 <210> 41 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE0192 probe <400> 41 ggtggtctta ctactcttgg agctaatact ttttcaatgg ctgtagttgg gcctttagta 60 tcatacggac 70 <210> 42 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE0590 probe <400> 42 cttagttttc tttggaacag ttgtaactca cttttttgga ggatcagcag gtagggaagg 60 aactggagta 70 <210> 43 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE0638 probe <400> 43 caactaatat agccttagaa atggggtatg catttggaac tcaccaagaa atgctatttg 60 caacaggggt 70 <210> 44 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE1030 probe <400> 44 agttgggctt acggaaactt atttgatact tacgttttag atagcgaccc agcagataaa 60 tgggatgctt 70 <210> 45 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE1094 probe <400> 45 catttactgg agctatgtac acattaggaa tgccacctga acttatggga atgggtagag 60 cattaaacga 70 <210> 46 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE2193 probe <400> 46 cttgcacctc ctactcaaga tttaagtgtt gcagtggcat tagcaattac ttcctttgtt 60 gttgttcatg 70 <210> 47 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE2318 probe <400> 47 atgggaaatc aagtatgtcc acttccaaca gcagtattgt caacacatac agatggattt 60 ggaaaaccag 70 <210> 48 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE2505 probe <400> 48 gtatgactgc atattcaata gcctatgcta gaataggaac aaacgctgtt gctagcatgc 60 agattgctac 70 <210> 49 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE2577 probe <400> 49 gaggtagacg gggctagaag cttaatagaa aaagcgtcaa tgcaattagg caaagctcat 60 aaatcacaaa 70 <210> 50 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> CPE2609 probe <400> 50 atctactagg aggagcaatt ggtgttgtta taacctatac tgttatggct gctgtaggaa 60 gcttaggacc 70 <210> 51 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj0150c probe <400> 51 ttccaaatta tgttttcgca gaagtaaatg cgataaaaat ggcagcaaga cgtgctggag 60 aggatatcat 70 <210> 52 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj0933c probe <400> 52 tccacttatt cctttttctc ctatgccagg aggagcttta acggcaaata cacaaatgat 60 gagggataat 70 <210> 53 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj1170c probe <400> 53 gtgggcctgt actttatgta gatagagctt atcttgacta ctatatcaca cctgagtgga 60 ttgcaaccgt 70 <210> 54 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj0921c probe <400> 54 ggagtggctc aagctgcaac tacaaaaaaa gctataggtg aagctgctaa aaaaattggc 60 attgatgtta 70 <210> 55 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj0998c probe <400> 55 taaaggattt ggcaagttat cttaaaggcg ctaaagctac cataaagcca agcaatgctt 60 ttatgggtga 70 <210> 56 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj1134 probe <400> 56 aaggcggcat aagacaaatg ctaagcgctc taaaaaaagg gagaactttg ggaattttaa 60 ctgatcaaga 70 <210> 57 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj1444c probe <400> 57 aaagagcttg aaactctagc tttaactagt ggttctgtta cagctcaagg tgcagctata 60 agagctcaac 70 <210> 58 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj0116 probe <400> 58 tttgctttag ggcattcttt gggagaattt tcagccttag ctgtcaatgg tgcttttgat 60 tttttagagg 70 <210> 59 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj0190c probe <400> 59 aaatcactat caatcttagt ccttcaggca tcccaaaaaa gggatcgcat tttgatttgg 60 ctatcgcttt 70 <210> 60 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Cj1347c probe <400> 60 atcagggtat gtttgcactt ttttggctta tcattatcgt tgcagcttgt gatagtgggg 60 cgtattttat 70 <210> 61 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP0434 probe <400> 61 gataccttgg gtaaggatta cactaaactc taccaacata tggcgaagac ctcttcagaa 60 cttctgccta 70 <210> 62 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP0626 probe <400> 62 agagaccgtc cattcgggat tccaaactac gttctattct atgagaaaag gtctaactcg 60 ttttcttcgt 70 <210> 63 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP0656 probe <400> 63 tagaacggtt gccttgagcg atcttagtcg aattcaactt gaactagaga catcttatga 60 tggtgggtat 70 <210> 64 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP0753 probe <400> 64 acatgattat cggctccgta catgtcggtg ataaaagcat gtatccactt ccgaaaaaca 60 tcactaagtt 70 <210> 65 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP0948 probe <400> 65 tactgatttc cgattcaggt aacgacttat atctacctaa gcaagttcgt gcaaccgtga 60 cattgtatgc 70 <210> 66 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP0953 probe <400> 66 ataacttaac tggattgagg aatcgtcgct ctttgcaagt taagtatcgc caaggggtga 60 ataaggattt 70 <210> 67 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP1284 probe <400> 67 ccgctgtact acagctacgc agaaaactcg aagttaaacg ataagtacac cgagataatc 60 aaagagcaaa 70 <210> 68 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP1365 probe <400> 68 cagatgttta cacgattacg gcaattcagt tggagaatac aacagagttt gaaggtttcc 60 atggtgtgaa 70 <210> 69 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP1386 probe <400> 69 gtatggtgca ttgcttactg catactcttc ttactcttat gacatgatcc aaaggtacgg 60 tcaatccgaa 70 <210> 70 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> VP1517 probe <400> 70 tcggtcgatt agtcgagcag caatggtcag gtagagaaaa aaaatacata tacaatgcac 60 agaaccgaat 70 <210> 71 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0005 probe <400> 71 gatattgatt actgtgctta atatcaggat agagcatacg ggccagtttt agcgtgcaaa 60 tccattgacc 70 <210> 72 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0007 probe <400> 72 gctcacccga cttcatcagc attatggcta tctctgtgaa cagatcgaag aaatcgaaag 60 agagttaaaa 70 <210> 73 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0009 probe <400> 73 tttagttcgt tcagcgctgg tgcctgatag tcttccggaa catattgtta atactatcat 60 gtctgcattt 70 <210> 74 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0011 probe <400> 74 aaatacagga atgagacacg gcgagatatg cgcattaagt tgggaagata tcgacactaa 60 aaattggact 70 <210> 75 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0013 probe <400> 75 ttttaactct ctttcgattt cttcgatctg ttcacagaga tagccataat gctgatgaag 60 tcgggtgagc 70 <210> 76 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0014 probe <400> 76 ttgcagatca aagacattct ttcagagaac ccggcagtct tcagtatttc ggtgccataa 60 tacataatca 70 <210> 77 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0015 probe <400> 77 gattgtcttg ccaactaatt gcttcaattg acaagatcgg ttgtagtgag ttttcatttg 60 gcgtgtatcc 70 <210> 78 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0016 probe <400> 78 tactcaaaaa aagaagtacc aaaaacctga ttaaaagcac aatgaccacg cacactgtcg 60 gcaactaaac 70 <210> 79 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0017 probe <400> 79 tcttcaacct gccttcacct tgcaagatcg agtttttgag gtttgtcagc agtctgatat 60 taatcttact 70 <210> 80 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> YE0020 probe <400> 80 tgatattgga aatgttgttc acccaacata aaagggagat tcagtgaagc ggtcaaatta 60 atcagtcggg 70 <210> 81 <211> 70 <212> DNA <213> Artificial Sequence <220> <0112> Z0146 probe <400> 81 agattgcgtc atggtatata ggtaccaatg accagccgtg gatcaacttt tacattgaca 60 atgactcttt 70 <210> 82 <211> 70 <212> DNA <213> Artificial Sequence <220> <0112> Z0152 probe <400> 82 ctgaagttca ggaactgaca ttagacgcag aaggtaaagg ccagtacgta tttaacgcat 60 cttacgttaa 70 <210> 83 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Z0372 probe <400> 83 caataggtgg agtgacattt attcgtcgtc caacttttaa cgatcgcttc atcgtggaag 60 atggaaatac 70 <210> 84 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Z0502 probe <400> 84 gatttcttca tccggatacg tatctgccga taaactgcac aaactctata agacaaattt 60 ggaagacgcg 70 <210> 85 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Z1019 probe <400> 85 gtactgatac atacaaacag taaaagatct gttaacgcaa ttaactgatg gcatggagct 60 cttcgcgctg 70 <210> 86 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Z1139 probe <400> 86 tgcattctgg ttctgtcagc actgataata tccttttggc tggatgttga ctctgttact 60 cgagtattac 70 <210> 87 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Z1140 probe <400> 87 tatgttttta gttgtcgggg agacagcaag aagtcaaaac tatgctctga atggatattc 60 tcgtggtacc 70 <210> 88 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Z1535 probe <400> 88 taggtcaaac tgaagatggt cggacagcgc ttattgagtt cggaaaaatt aatatgaccg 60 acacctattt 70 <210> 89 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Z1543 probe <400> 89 gcgatcgttg gagtattcgc gggtttgaaa atagcgtagg tttgtcaggg aatgatggtt 60 tttatataaa 70 <210> 90 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Z1554 probe <400> 90 tttataaaaa ccagtaaccc ggaattgatt tgggtgacgg tggtattacc tattttgaca 60 gcaacaggtg 70 <210> 91 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY0201 probe <400> 91 tgaaaagtag ttcgagcgcc cagatggtac tcaaacctaa cgactcaagc tcaatttata 60 aagataccac 70 <210> 92 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY0322 probe <400> 92 acgatgttga tactatcggt tttcagggga aagggctatt tttttctgac agactgatcg 60 atgcaataca 70 <210> 93 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY1076 probe <400> 93 attttttaaa tatgtcgacc acatcatttt ccaataacag tcaggagtta gcagcccaca 60 gttcaccagg 70 <210> 94 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY1607 probe <400> 94 gcatttctta agagtgcgtt tgaacactta catgcactaa gtaaggctgg tgaaccactt 60 agtcttgaaa 70 <210> 95 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY2020 probe <400> 95 ataattgttt tctcgaatta gccagagaat cattgcagca caatggtgag caatggacac 60 gtaatgctat 70 <210> 96 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY3673 probe <400> 96 ttatgtaaat tatcaggagt actaagccaa gcctgtcaat cgacgctgat tcctcaggat 60 gagtttgaac 70 <210> 97 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY3922 probe <400> 97 gaaatgtacc ggaatgttgg atgagaatat cgtctattcg acatttaatg ctgatcccgt 60 tgattccagc 70 <210> 98 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY0314 probe <400> 98 aagcggttgt atctgaattt aatttgtcag atataaatcg cggtggaatg acgaaagcac 60 aggcagaaaa 70 <210> 99 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY1891 probe <400> 99 aaatatctgg acctatccgc tttttgttaa taccttttca gcaaatgctc ttgtgggact 60 atcatcgtgc 70 <210> 100 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STY2356 probe <400> 100 aaataaaacg ggtgattttt ataagcccag gcaggcttat ggtgatttgg catcggtaaa 60 catggttata 70 <210> 101 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM0159 probe <400> 101 ccggtgagca cagaatattg aaaactgact ttgcattact ttgcccaaat tgtcacaaag 60 ctgttcatat 70 <210> 102 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM2743 probe <400> 102 tgacggagtt cgctttgagg acttgttttc aaaaataatg tactataagt cgccagattt 60 tcagcaggtg 70 <210> 103 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM2747 probe <400> 103 gaatccatta tgattcgccg tgtagtggta aaccagaagt aataaatgct gtgcaattat 60 tgcgctctca 70 <210> 104 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM2754 probe <400> 104 tgatttaata ggcaaaaaaa gcgaagaata tgcattaaac tgggaaaaaa accgcctaat 60 cggtctcggc 70 <210> 105 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM2761 probe <400> 105 taagcaagat tgagctgtta gagttagttc gacgtggacg tataaaattc gtcgcattcc 60 aaaatctcca 70 <210> 106 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM2762 probe <400> 106 cgtagctaat acgaaaaaag aaacagaaaa aatcggagcg acgataaagg tagtgctagg 60 cgttttcgtt 70 <210> 107 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM0654 probe <400> 107 ttattacatc ggaaaaggta tcaaacaaga ttaccagcag gcaatatact ggtttcgaaa 60 agcggcagac 70 <210> 108 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM0762 probe <400> 108 tatgcaaaaa aagaacaact tgcatgctgc catgataccg gcacttgtat cgttataatg 60 gaaattggac 70 <210> 109 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM0763 probe <400> 109 gcatttccga gagatttatc cagagatgga actctctctt gttgaagagg ggacttttgg 60 tttacatgat 70 <210> 110 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> STM0764 probe <400> 110 aaacaaccca gtcttgtttt ttcagcaacg catgctttgt ctttctcttt tgtaccgcat 60 ttgttaaaac 70 <210> 111 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> tubulin bete-4 chain probe <400> 111 aagtccagtg tctgtgatat tgcaccaaag ggtttgaaaa tggcgtctac tttcattggt 60 aactcaacct 70 <210> 112 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> actin 3 probe <400> 112 aggttcttta ccagccatct atgattggta tggagaatgc tggtatccat gaaaccacct 60 ataactccat 70 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin3-f primer <400> 113 ctcttgacta cgagcaggaa 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin3-r primer <400> 114 agtccttcct gatgtcgaca 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tb4-f primer <400> 115 aagaggttga cgagcagatg 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tb4-r primer <400> 116 gcctttctcc tgaacatagc 20  

Claims (7)

delete Oligonucleotide of SEQ ID NO: 1 to 30 comprising a nucleotide, a bar-less silral neck (Order Bacillales) sikjungdokgyun oligonucleotide for detection oligonucleotide probe set. A microarray having a substrate on which an oligonucleotide probe set according to claim 2 is immobilized. Contacting the sample's genomic DNA with the oligonucleotide probe set according to claim 2 to hybridize the target sequence and the probe sequence in the sample; And Comprising the step of detecting the degree of hybridization between the target sequence of the probe and the sample bar-less silral neck (Order Bacillales) method for detecting sikjungdokgyun. The method of claim 4, wherein the target sequence is labeled with a detectable labeling substance. The method of claim 4, wherein the probe set is immobilized on a substrate of a microarray. Including a nucleotide probe oligonucleotide set according to claim 2, wherein the bar-less silral neck (Order Bacillales) sikjungdokgyun detection kit.

Images