KR100941882B1 - Mutant Anabaena Sensory Rhodopsin with Altered Absorption Maximum - Google Patents

Abstract

The present invention relates to an Anabaena sensor rhodopsin mutant protein with a changed maximum absorption wavelength. The present invention provides an Anabaena sensor rhodopsin mutant protein in which the 206th amino acid Pro is substituted with Asp or Glu in SEQ ID NO: 1. Since the maximum absorption wavelength of the Anabaena sensor rhodopsin mutant protein of the present invention is blue-shifted compared to that of the wild-type Anabaena sensor rhodopsin protein, it induces the sensor function of Anabaena sensor rhodopsin by irradiating light with high energy short wavelength. This can be very useful when it is necessary.

Anabaena Sensor Rhodopsin, Bacteriorhodosin, Retinine, Maximum Absorption Wavelength, Blue-Shift

Description

Mutant Anabaena Sensory Rhodopsin with Altered Absorption Maximum}

The present invention relates to an Anabaena sensor rhodopsin mutant protein whose maximum absorption wavelength is blue-shifted and changed.

Four families of photoactive retinylated proteins were found in the cytoplasmic membrane of Halobacterium salinarum during 1971-1981. The two types of family proteins identified first are the light-induced ion transporter bacteriohodopsin (BR) [18] and halohodopsin (HR). BR and HR use light energy to transport protons and chlorides through cell membranes [19]. The other two families are sensory rhodopsin (SR) I and II, which are not transport proteins, but are photosensor proteins. SR I and SR II are attractant and repellent phototaxis receptors for orange and blue-green light, which transmit signals through membrane transfer proteins to cell motility machinery [10] ].

Transport of high microorganisms Rhodopsin and sensors Rhodopsin are well studied in terms of atomic structure and function and are among the best studied membrane proteins [8, 17, 24, 26, 27].

Recently, genome project studies combined with expression in other regions have identified homologous proteins of the high microorganism rhodopsin outside the archaeal region. Homologous sequences were found in SAR86, an unexplored proteobacterial species, by DNA libraries obtained from sea picoplankton [3]. Esherichia When expressing the opsin (opsin) in the gene of the heterologous coli produces a protein which generates a photoactive dye coupled to the retinal performing efficient proton transport in a very fast light cycle characteristic (15 ms) of the transport rhodopsin [2]. Light cycle rates were performed on proteododoxin detected in membranes made directly from Monterey Bay picoplankton [3]. Thus, this experiment confirmed the presence of rhodopsin in the transport of eubacteria.

Opsin (apoprotein) sequences with additional homology have been found in cyanobacteria [7]. The rhodopsin (haloprotein) pigment of cyanobacteria confirmed that sensor rhodopsin was also present in sedative bacteria [14]. The gene encoding the opsin homolog is described by Anabaena ( Nostoc ) sp. In Kazusa Institute, Japan. It was discovered through the genome sequencing project of PCC7120. The opsin gene was expressed in E. coli and bound to all- trans retinal to form a pink pigment with a maximum absorption wavelength at 543 nm, which is the all- trans and 13- cis form of retinal in photoadapted Anabaena rhodopsin. Mixtures [12]. In addition, the maximum absorption wavelength of Anabaena rhodopsin was reported to be 549 nm in dark-adapted form [6].

Anabaena rhodopsin in the E. coli membrane exhibited a photochemical cycle with M photointermediate and 110 ms half-life cycle at pH 6.8, and interestingly 13- cis photocycle [4, 12, 21]. In the genome, the Anabaena opsin gene and another open reading frame (ORF) isolated by 16 bp present under the same promoter were found. This operon was predicted to encode 261-amino acid (opsin) and 125-amino acid (14 kDa) proteins, respectively.

When Anabaena rhodopsin and soluble transducer were coexpressed in E. coli , the light cycle increased by 20%, suggesting physical contact between the two proteins. This pigment did not show detectable proton transport activity when expressed in E. coli , and Asp96, a proton donor of B. bacteriododocin, was replaced with Ser86 from Anabaena rhodopsin. Generally, in BR, all- trans retinal, which is a chromophore, is covalently linked to the ε-amino group of a lysine residue located deep inside the membrane through a Schiff base. Cell receives a light, the all- trans retinal coupled to bacteriorhodopsin photon (photon) absorption and the 13- cis-retinal to proceed with the photo-isomerization-day (photoisomerization), by moving out through the plasma membrane proton all- trans retinoic He recovers day by day. Under dark conditions, the seed base is protonated, but when retinal is photoisomerized, it lowers the pKa of this group, releases its protons near the Asp85 (proton acceptor) residues, initiates successive proton hops and finally protons. Is released to the outer surface of the membrane [5]. After the protons are pumped, the seed base gets protons from Asp96 (proton donor) and Asp96 again gets protons from the cytoplasm. In contrast to BR, Anabaena Rhodopsin has a proton donor replaced with a Ser86 residue.

This observation is different from that of the high-microbial sensor Rhodopsin [8], which is unlikely to be transmitted by transmembrane helix-helix interactions with the transprotein . It reliably suggests that the cytosolic protein consisting of 125 amino acid residues, which acts as an optical sensor receptor in the environment, carries a signal from the photoreceptor [12].

Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

In an effort to find a mutant protein in which the maximum absorption wavelength of light in the Anabaena sensor rhodopsin is shorter compared to that of the wild type, the inventors found that the 206th amino acid of Pro in the wild type Anabaena sensor rhodopsin protein represented by SEQ ID No. 1 is Asp or Mutant Rhodopsin Protein Replaced by Glu with Wild-type Anabaena The present invention was completed by experimentally revealing that the maximum absorption wavelength of light is shorter than that of the sensor rhodopsin protein.

Accordingly, an object of the present invention is to provide an Anabaena sensor rhodopsin mutant protein in which the maximum absorption wavelength of light of the Anabaena sensor rhodopsin protein is shorter than that of the wild type.

Still another object of the present invention is to provide a nucleic acid molecule encoding the Anabaena sensor rhodopsin mutant protein.

Still another object of the present invention is to provide a vector comprising a nucleic acid molecule encoding the Anabaena sensor rhodopsin mutant protein.

Still another object of the present invention is to provide a transformant comprising a vector comprising a nucleic acid molecule encoding the Anabaena sensor rhodopsin mutant protein.

The objects and advantages of the present invention will become more apparent from the following detailed description, claims and drawings.

According to an aspect of the present invention, there is provided an Anabaena sensor rhodopsin mutant protein in which the 206th amino acid Pro is substituted with Asp or Glu in SEQ ID NO: 1.

The present inventors have found that the amino acid constituting the retinal binding pocket in the research efforts result, the wild-type Anabaena sensor rhodopsin protein represented by SEQ ID NO: 1 to find the changed mutant proteins shorter maximum absorption wavelength of the light is compared with that of wild type in Anabaena sensor rhodopsin Anabaena Substitutes Asp or Glu for 206th Amino Acid sensor Rhodopsin Mutant Protein Anabaena The present invention was completed by experimentally revealing that the wavelength of the maximum absorption light is shorter than that of the sensor rhodopsin wild type protein.

As used herein, the term “ Anabaena sensor rhodopsin protein” refers to a light-absorbing pigment protein of Anabaena microorganism having seven transmembrane domains and all- trans / 13- cis retinal bound as a chromophore. .

When light is irradiated to cells with Anabaena sensor rhodopsin, all- trans retinal bound to rhodopsin absorbs photons and 13- cis Through photoisomerization, which changes to retinal form, 13- cis The retinal reverts back to the original all- trans retinal. The signal generated by the conformational change generated in this process is transmitted into the cell through a transnasal protein (trnasducer) present in the cell membrane.

Preferably, the “wild type protein of Anabaena sensor rhodopsin” of the present invention is represented by the amino acid sequence of SEQ ID NO: 1.

The "206th" amino acid in SEQ ID NO: 1 of the present specification is one of about 22 conserved amino acid residues that make up the retinal-binding pocket in other microbial rhodopsin. The amino acids that make up the retinal-binding pocket, the conserved sequence of the microorganism rhodopsin, play an important role in regulating the properties of light absorbed by rhodopsin and ion transport or signal transduction by sensors.

The Anabaena sensor rhodopsin mutant protein (hereinafter referred to as “Pro206Glu” or “Pro206Asp”) in which Pro, the 206th amino acid of the wild-type Anabaena sensor rhodopsin of the present invention is substituted with Glu or Asp, has a maximum absorption wavelength of Anabaena sensor rhodopsin wild type protein. It is about 46 nm "blue-shifted" compared to.

The term "blue-shift" in the context of the present invention means that the maximum absorption wavelength of rhodopsin has shifted from the visible to the shorter, blue direction. "Pro206Glu" or "Pro206Asp" of the present invention Anabaena sensor rhodopsin mutant protein thereof, the maximum absorption wavelength of Anabaena sensor rhodopsin blue compared to the wild-type protein - because the shift, the sensor of Anabaena sensor rhodopsin by applying energy with high short wavelength of the light If the function is to be induced, for example, when the sensor must be operated through water or a solvent, the Anabaena sensor rhodopsin mutant protein of the present invention must be expressed so that the light must pass through a thin layer of moisture so that the light of the Anabaena sensor rhodopsin protein This can be very useful when a sensor function can be derived.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding the Anabaena sensor rhodopsin mutant protein in which the 206th amino acid Pro is substituted with Asp or Glu in the first sequence.

As used herein, the term “nucleic acid molecule” is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides that are the basic building blocks of nucleic acid molecules are natural nucleotides, as well as analogs in which sugar or base sites are modified. (analogue) (Scheit, Nucleotide Analogs , John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990).

Most preferably, the nucleic acid molecule of the present invention comprises a nucleotide sequence represented by SEQ ID NO: 2 (Pro206Asp) or 3 (Pro206Glu).

According to another aspect of the invention, the invention comprises (a) the above-described nucleic acid molecule of the invention encoding the Anabaena sensor rhodopsin mutant protein and (b) a promoter operatively linked to the nucleic acid molecule. Provide a vector

The vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are described in Sambrook et al., Molecular . Cloning , A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.

The nucleic acid molecule encoding the Anabaena sensor rhodopsin mutant protein of the present invention is operatively linked to a promoter operating in prokaryotic or eukaryotic cells. As used herein, the term “operably linked” refers to a functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and other nucleic acid sequences. The regulatory sequence will control transcription and / or translation of the other nucleic acid sequence.

Vectors of the present invention can typically be constructed as vectors for cloning or vectors for expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. It is preferable that the nucleic acid molecule of the present invention is derived from a prokaryotic cell, and the prokaryotic cell is used as a host in consideration of the convenience of culture.

For example, when the vector of the present invention is an expression vector and the prokaryotic cell is a host, a strong promoter capable of promoting transcription (for example, the tac promoter, lac Promoter, lac UV5 promoter, lpp promoter, p _L ^λ promoter, p _R ^λ promoter, rac 5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), ribosomal binding site for initiation of detoxification And transcription / detox termination sequences. When E. coli (e.g., HB101, BL21, DH5α, etc.) is used as the host cell, the promoter and operator sites of the E. coli tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol . , 158: 1018-1024 (1984 )) and the leftward promoter of phage λ ^(λ p _L promoter, Herskowitz, I. and Hagen, D. , Ann Rev Genet, 14:... may be used 399-445 (1980)) as a control region. When Bacillus bacteria are used as host cells, the promoter of the Bacillus Chuo toxin protein gene of ringen sheath (Appl Environ Microbiol 64: 3932-3938 ( 1998); Mol Gen Genet 250:...... 734-741 (1996) ) Or any promoter expressible in Bacillus may be used as a regulatory site.

On the other hand, vectors that can be used in the present invention are plasmids often used in the art (eg, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14). , pGEX series, pET series and pUC19, etc.), phage (eg, λgt4? λB, λ-Charon, λΔz1 and M13, etc.) or viruses (eg SV40, etc.).

On the other hand, when the vector of the present invention is an expression vector and the eukaryotic cell is a host, a promoter derived from the genome of the mammalian cell (e.g., a metallothionine promoter) or a promoter derived from a mammalian virus (e.g., adeno) virus late promoter, the vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and HSV tk Promoters) can be used, and generally have a polyadenylation sequence (eg, a plasmogenic hormone terminator and a SV40 derived poly adenylation sequence) as a transcription termination sequence.

Expression vectors for eukaryotic cells that can be used in the present invention can be selected from a variety of vectors known in the art. For example, the basic backbone may have the structure of an SV40 vector, papilloma virus vector, YIp5, YCpl9, an Epstein-Barr virus vector, pMSG, pAV009 / A ⁺ , pMAMneo-5, baculovirus pDSVE, pSecTag2B, or yT & A vector. Can be.

Vectors of the present invention may be fused with other sequences to facilitate purification of histone deacetylases expressed therefrom. Sequences to be fused include, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA).

Fusion proteins expressed by the vector containing the fusion sequence are purified by affinity chromatography. For example, when glutathione-S-transferase is fused, glutathione, which is a substrate of this enzyme, can be used, and when 6x His is used, a desired histone is performed using a Ni-NTA His-binding resin column (Novagen, USA). Deacetylase can be obtained quickly and easily. Preferably, the Anabaena sensor rhodopsin mutant protein of the present invention is fused (His-tagged) with six histidine (His) residues at the C-terminus. These rhodopsin His- tagged protein of the present invention are purified using a Ni ^{2 +} -NTA agarose beads (Qiagen, Valencia, CA, USA ).

Meanwhile, the vector of the present invention includes an antibiotic resistance gene commonly used in the art as an optional marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin And resistance genes for tetracycline.

According to another aspect of the present invention, the present invention provides a transformant comprising the vector of the present invention described above. Host cells capable of stably and continuously cloning and expressing the vectors of the present invention are known in the art and can be used with any host cell, for example E. coli JM109, E. coli Bacillus sp. Strains such as BL21 (DE3), E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium Enterobacteria and strains such as Um, Serratia Marcesons and various Pseudomonas species.

In addition, when transforming a vector of the present invention to eukaryotic cells, as host cells, yeast ( Saccharomyce cerevisiae ), insect cells and human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293 , HepG2, 3T3, RIN and MDCK cell lines) and the like can be used.

The method of carrying a vector of the present invention into a host cell is performed by the CaCl ₂ method (Cohen, SN et al., Proc . Natl . Acac . Sci . USA , 9: 2110-2114 (1973), when the host cell is a prokaryotic cell). ), One method (Cohen, SN et al., Proc . Natl . Acac . Sci . USA , 9: 2110-2114 (1973); and Hanahan, D., J. Mol . Biol . , 166: 557-580 (1983)) and electroporation methods (Dower, WJ et al., Nucleic . Acids Res . , 16: 6127-6145 (1988)). In addition, when the host cell is a eukaryotic cell, fine injection method (Capecchi, MR, Cell , 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et al., Virology , 52: 456 (1973)), Electroporation (Neumann, E. et al., EMBO J. , 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene , 10:87 (1980)), DEAE- Dextran Treatment (Gopal, Mol . Cell Biol . , 5: 1188-1190 (1985)), and gene bombardment (Yang et al., Proc . Natl . Acad . Sci . , 87: 9568-9572 (1990)) and the like can be injected into host cells. have.

The vector injected into the host cell can be expressed in the host cell, in which case a large amount of mutant protein of Anabaena sensor rhodopsin is obtained. For example, when the expression vector contains a lac promoter, the host cell may be treated with IPTG to induce gene expression.

The Anabaena sensor rhodopsin mutant protein of the present invention has an advantage in that it can be used very usefully when the maximum absorption wavelength of light having strong maximum wavelength is blue-shifted compared to wild type protein.

As described in detail above, the Anabaena sensor rhodopsin mutant protein of the present invention is blue-shifted as compared with the Anabaena sensor rhodopsin wild-type protein, the maximum absorption wavelength of blue light, it is very useful to apply when the energy has to use short wavelength light There is an advantage to this.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Experimental Materials and Methods

Bacterial Strains and Plasmids

E. coli transformants were cultured at 35 ° C. in LB (Luria-Bertani) medium in the presence of ampicillin (100 μg / ml) and chloramphenicol [9]. A sensory rhodopsin construct was expressed in the E. coli strain UT5600 under the PlacUV5 promoter of pMS107. Anabaena sp. Using DH5α. The operon gene was cloned from the genome DNA of 7120 (provided by James Golden, Texas A & M University, College Station, TX, USA). Anabaena sp. 7120 cells were cultured in BG11 [12, 15] medium at 25 ° C.

Retinal Synthase ( Retinal Synthase ) And various Opsins  Preparation of the coding plasmid

Restriction enzyme and T4 DNA ligase were purchased from NEB (MA, USA) and PFU DNA polymerase was purchased from Vivagen (Sungnam, Korea). Oligonucleotides were purchased from Cosmogentech (Seoul, Korea). Empicillin, chloramphenicol and all- trans retinal were purchased from Sigma (St. Louis, MO, USA). Mutants ASR_S86D, ASR_P206D, and ASR_P206E and double mutant ASR_S86D / P206D were prepared using a two-step PCR mutagenesis method by modification of megaprimers using wild-type genes as templates [13, 20]. PCR was performed for 30 cycles using PFU polymerase for 1 minute at 95 ° C., 1 minute at 55 ° C. and 3 minutes at 72 ° C. PCR products were purified and isolated, digested with NdeI and NotI, and introduced into E. coli expression vectors under the control of IPTG induction. Point mutations were confirmed by DNA sequencing of the PCR-prepared inserts in the final produced expression vector. His refers to a tag with six histidine residues attached to the C-terminus of the protein.

E. coli  Sensor of microorganisms in the cell Rhodopsin  Expression

ASR mutations were expressed using plasmid pKJ900-ASR in E. coli strain UT5600 for proton pumping measurements and plasmid in E. coli strain β-UT for western blotting and absorption spectroscopy. It was expressed using pKJ900-ASR. β-UT cells have a plasmid containing four carotenoid biosynthesis genes [16, 28]. Transformants were incubated overnight and then diluted 1: 100 and incubated at 35 ° C. and 600 nm until 0.4 absorbance units. To obtain the protein for proton transport measurement, all- trans retinal was added with 0.2% L-arabinose until a final concentration of 5 mM. To measure retinal-generated absorption spectra, apo-proteins were derived without the addition of retinal. β-UT cells were induced with 0.2% L-arabinose and 1 mM IPTG at 35 ° C. for 3 hours.

Membrane endoplasmic reticulum ( membrane vesicle Manufacturing

Cells containing various opsin constructs were inoculated into 500 ml of LB added with empicillin (50 μg / ml) and chloramphenicol (34 μg / ml) in a 1-L flask, and a gyrate shaker (gyratory shaker) was incubated for 16 hours at 180 rpm at 37 ℃. Cells were induced by the addition of 1 mM IPTG and 0.2% L-arabinose at A _{600 nm} = 0.4. After 12 hours the cells were recovered by centrifugation and resuspended in 50 mM Tris-HCl (pH 7.0) containing 150 mM NaCl. Rhodopsin-expressed E. coli cells were lysed by sonication at 4 ° C. and cell debris was removed with a low speed centrifuge (2,000 × g, 15 min). Finally, the membranes were precipitated at 100,000 × g, 4 ° C. for 1 hour and resuspended at 4 ° C. using 50 mM Tris (pH 7.0) containing 150 mM NaCl. The culture was vibrated gently at 4 ° C. for 4-6 hours in an extraction buffer (1% sodium dodecyl maltoside [DM], 150 mM NaCl, 50 mM Tris-buffer [pH 7.0]) to extract rhodopsin from the membrane. The extracted protein was obtained by centrifugation at 20,000 x g and taking the supernatant. Membranes without receptor proteins were prepared through the same procedure and used as controls.

His - Tagged Rhodopsin  Purification and Separation

Protein comprising 6 histidine residues at the C- terminal was separated using a Ni ₂ ⁺ -NTA agarose beads (Qiagen, Valencia, CA, USA ). E. coli membranes containing Anabaena sensor rhodopsin were dissolved in 1% DM with 150 mM NaCl, 10 mM imidazole and 50 mM Tris (pH 7.0) and incubated with beads for 16 hours at 4 ° C. Protein-bound beads were washed with 50 mM imidazole and eluted with 250 mM imidazole, 0.1% DM, and 50 mM Tris-buffer.

Weston Blotting  analysis

Cell pellets were recovered from 500 ml culture and washed once with buffer (50 mM Tris, 150 mM NaCl, pH 7.0) and then centrifuged at 4,000 × g and 4 ° C. for 15 minutes. Cells were disrupted by sonication, unbroken cells and large sized cell debris were removed by low speed centrifugation, and cell membranes were separated by ultrafast centrifugation at 100,000 × g for 1 hour. The separated membrane was resuspended in buffer (50 mM Tris, 150 mM NaCl, pH 7.0). Cell lysates and membrane preparations containing 20 μg of protein were used to perform SDS-PAGE and Western blotting assays. As a primary antibody, an anti 6 × His monoclonal antibody was diluted 1: 3,000, and as a secondary antibody, an anti mouse IgG HRP conjugate was diluted 1: 5,000. Responsive bands were visualized using ECL western blotting detection reagents.

Proton Pumping  Measure

To measure proton pumping of cells, E. coli cells expressing Anabaena sensor rhodopsin were centrifuged at 5,000 rpm for 15 minutes at 4 ° C and then pelleted, followed by unbuffered solution (10 mM NaCl, 10 mM) at room temperature. MgSO ₄ .7HO ₂ , 100 mM CaCl ₂ ) was washed twice [29]. The sample was irradiated at 100 watts / m ² at 500 ± 20 nm using a 150-watt tungsten halogen lamp in combination with a wide-band interference and heat-protection (CuSO ₄ and glass) filter. pH was monitored with a computerized Horiba F51 pH meter.

Absorption spectroscopy ( Absorption Spectroscopy )

Difference spectroscopy was used to measure retinal-produced absorption in E. coli membranes. After addition of the retinal solution, the spectra were recorded every 3 minutes with a Shimadzu 2450 spectrometer, after which no additional absorption change occurred. Λ _max at different pH values was measured according to spectra reconstituted with wild and mutant Anabaena . The maximum absorption point of the mixed form of the alkaline and acidic forms at different pH values did not linearly depend on the relative concentrations of the two forms because of the different structures and half-bands of these two spectra.

Experiment result

Inside and outside Retinal  Various in the presence Rhodopsin  produce

A number of archaea-type rhodopsin has recently been identified from Archaea, Eubacteria and eukaryotic cells [25]. Several bacteria rhodopsin have been shown to have been studied for ion transport and sensor function. Seven transmembrane helical domains were aligned based on amino acid residue sequence homology. To understand the function of these bacteria rhodopsin, we tried to overexpress these seven-membrane proteins in E. coli . Dr. Kamo's group was the first to succeed in overexpressing the bacterium rhodopsin in E. coli [22]. We have expressed various opsin in E. coli by externally adding or intrinsically synthesizing all- trans retinal, and using Ni ₂ ⁺ -NTA resin to de-modify detergent (DM) The pigment was purified within. Reproduction effects on rhodopsin in vivo were observed when co-expressed with retinal synthase in E. coli or when retinal was added externally. Co-expression of mouse retinal synthase did not significantly increase the production of microorganism rhodopsin, which was confirmed by Western immunoblotting (FIG. 2).

In the construct of the invention, a sequence encoding the 6-histidine residue was included at the C-terminus to provide an immunoactive epitope. Western analysis showed that both ASRs mutations were expressed and that the expression levels of the mutations were different from those of the wild type (increased in P206E mutations and decreased in S86D, P206D / S86D mutations; data not shown). In addition, the expression level increased when there was an N-terminal 18 amino acid leader sequence from BPR. Protein expression levels in the case of Anabaena sensor rhodopsin were maximal with external retinal in the absence of the leader sequence (FIG. 2).

Absorption spectrum and ASR of pKa  Measurement of values

Anabaena sensor rhodopsin (ASR) protein shows high identity with other proteins. The Schiff-base proton acceptor in ASR is identical to that of the proton pump, but the proton donors (D96 in BR) have been replaced with serine residues. ASR has proline (P206) before the 1-helical rotation of the Schiff-base-lysine (K210), which replaces aspartyl residues found in all other known microbial rhodopsin.

The inventors have purified rhodopsin from wild-type and the expression of all mutant rhodopsin and Anabaena sensor using a Ni ₂ ⁺ -NTA resin dodecyl silmal indeno furnace side (dodecylmaltopyranoside) having a 6-histidine tag in E. coli. Absorption spectra of the wild type ASR protein purified from the previous data showed a typical rhodopsin band width (˜100-nm half band width) and had a single peak at 545 nm in the present invention (FIG. 3). Absorption spectra of PR are shown as reference to proton pumping rhodopsin (FIG. 3). 2 and 3 show the visible absorption spectra of wild type (WT) ASR and P206D, S86D, S86S / P206D mutant ASR measured at room temperature.

The absorption spectrum obtained from the S86D mutation at pH 7.0 was similar to that of wild type ASR. However, the maximum absorption wavelength of P206D was blue-shifted compared to that of the wild type. PH-titration curves were obtained from wild-type and mutant ASRs in dodecylmaltopyranoside (DM) to determine pKa of spectral variation. The spectral change between pH 4.0 and 11.0 in wild type ASR was as small as xanthorhodopsin [1, 11] and P206D did not show any spectral change between pH 4.0 and pH 11.0 (FIG. 4).

Proton Of pumping  Measure

ASR did not show detectable proton pumping when expressed in E. coli . The inventors assumed that the difference in contact with the retinal between the ASR and the proton pump was important, and produced ASR mutant proteins that changed 86 (proton donor) and 206 positions by a two-step mega primer PCR method. Anabaena sensor rhodopsin has not been reported to deliver protons in E. coli membranes. If the 86 or 206 position is important for proton pumping, important proton pumping should be detected in these mutant proteins.

We used proteorhodopsin as a control to see activity in E. coli sparrowoplast. It was evident that protons were released because the pH reduction was induced by light in cells containing a proton pump proteodopsin driven by light in E. coli sparrowplast. Cells containing P206D, S86D and P206D / S86D mutations did not release protons like wild type ASR (FIG. 5). In E. coli membranes, proton influx is generated by the existing electrochemical potential of energized E. coli cells. The m-chloro-carbonylcyanide-phenylhydrazine (CCCP) compound passes through the membrane to eliminate the proton gradient. We examined proton influx with CCCP in E. coli cells and the results were similar to others (data not shown).

E. coli From Retinal Reorganized ASR  Absorption spectrum of membrane

All- trans retinal was added to hydroxylamine bleaching membranes prepared from E. coli membranes supplemented with wild-type and P206E mutant ASR. Absorption spectra were monitored every 5 minutes. At 5 minutes, peaks in the 550 nm (WT) and 524 nm (P206E) bands were evident and increased during incubation. After irradiation with white light, the maximum absorption wavelength shifted to 540 nm in wild type (WT) and 500 nm in P206E mutant. It showed in the ASR proteins as recovered to 13- cis form and 13- cis-retinal in the all- trans slow, but the detection of one of the flat type [23].

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

references

Balashov, SP, ES Imasheva, VA Boichenko, J. Anton, JM Wang, and JK Lanyi. Xanthorhodopsin: A proton pump with a light-harvesting carotenoid antenna. Science 309: 2061-2064.

2.Beja, O., EN Spudich, JL Spudich, M. Leclerc, and EF DeLong. 2001. Proteorhodopsin phototrophy in the ocean. Nature 411: 786-789.

3.Beja, O., L. Aravind, EV Koonin, MT Suzuki, A. Hadd, LP Nguyen, SB Jovanovich, CM Gates, RA Feldman, JL Spudich, EN Spudich, and EF DeLong. 2000. Bacterial rhodopsin: Evidence for a new type of phototrophy in the sea. Science 289: 1902-1906.

Bergo, VB, M. Ntefidou, VD Trivedi, JJ Amsden, JM Kralj, KJ Rothschild, and JL Spudich. 2006. Conformational changes in the photocycle of Anabaena sensory rhodopsin: Absence of the Schiff base counterion protonation signal. J. Biol . Chem . 281: 15208-15214.

5. Brown, LS and KH Jung. 2006. Bacteriorhodopsin-like proteins of eubacteria and fungi: The extent of conservation of the haloarchaeal proton-pumping mechanism. Photochem . Photobiol . Sci . 5: 538-546.

6. Furutani, Y., A. Kawanabe, KH Jung, and H. Kandori. FTIR spectroscopy of the all-trans form of Anabaena sensory rhodopsin at 77 K: Hydrogen bond of a water between the Schiff base and Asp75. Biochemistry 44: 12287-12296.

7. Gartner, W. and A. Losi. 2003. Crossing the borders: Archaeal rhodopsins go bacterial. Trends Microbiol . 11: 405-407.

Gordeliy, VI, J. Labahn, R. Moukhametzianov, R. Efremov, J. Granzin, R. Schlesinger, G. Buldt, T. Savopol, AJ Scheidig, JP Klare, and M. Engelhard. 2002. Molecular basis of transmembrane signalling by sensory rhodopsin II-transducer complex. Nature 419: 484-487.

9. Heo, Y.-J., KS Ko, J.-H. Song, and Y.-H. Cho. 2005. Profiling pyocins and competitive growth advantages of various Pseudomonas aeruginosa strains. J. Microbiol . Biotechnol . 15: 1368-1376.

10. Hoff, WD, KH Jung, and JL Spudich. 1997. Molecular mechanism of photosignaling by archaeal sensory rhodopsins. Annu . Rev. Biophys. Biomol . Struct . 26: 223-258.

11.Imasheva, ES, SP Balashov, JM Wang, and JK Lanyi. 2006. pH Dependent transition in xanthorhodopsin. Photochem . Photobiol . (In press).

12. Jung, KH, VD Trivedi, and JL Spudich. 2003. Demonstration of a sensory rhodopsin in eubacteria. Mol . Microbiol . 47: 1513-1522.

13. Jung, KH and JL Spudich. Suppressor mutation analysis of the sensory rhodopsin I-transducer complex: Insights into the color-sensing mechanism. J. Bacteriol . 180: 2033-2042.

14. Jung, KH and JL Spudich. 2004. Microbial rhodopsins: Transport and sensory proteins throughout the three domains of life. Section II Photobiology. In Horspool, WM and Lenci, F. (eds.). CRC Handbook of Organic Photochemistry and Photobiology , 2 ^nd Ed. Vol 3: 124-1-11.

15. Kim, J.-D. and C.-G. Lee. 2006. Diversity of heterocystous filamentous cyanobacteria (blue-green algae) from rice paddy fields and their differential susceptibility to ten fungicides used in Korea. J. Microbiol . Biotechnol. 16: 240-246.

16. Kim, J.-D., W.-S. Lee, B. Kim, and C.-G. Lee. 2006. Proteomic analysis of protein expression patterns associated with astaxanthin accumulation by green alga Haematococcus pluvialis (Chlorophyceae) under high light stress. J. Microbiol . Biotechnol . 16: 1222-1228.

17. Luecke, H., B. Schobert, JK Lanyi, EN Spudich, and JL Spudich. 2001.Crystal structure of sensory rhodopsin II at 2.4 angstroms: Insights into color tuning and transducer interaction. Science 293: 1499-1503.

18. Oesterhelt, D. and W. Stoeckenius. 1973. Functions of a new photoreceptor membrane. Proc . Natl . Acad . Sci . USA 70: 2853.

19. Oesterhelt, D. 1998. The structure and mechanism of the family of retinal proteins from halophilic archaea. Curr . Opin . Struct . Biol . 8: 489-500.

20. Seo, HS and SH Bhoo. 2006. Photochromism of phytochromes and Cph1 requires critical amino acids and secondary structure in the N-terminal domain. J. Microbiol . Biotechnol. 16: 1441-1447.

21.Shi, L., SR Yoon, AG Jr. Bezerra, KH Jung, and LS Brown. 2006. Cytoplasmic shuttling of protons in Anabaena sensory rhodopsin: Implications for signaling mechanism. J. Mol . Biol . 358: 686-700.

22. Shimono, K., M. Iwamoto, M. Sumi, and N. Kamo. 1997. Functional expression of pharaonis phoborhodopsin in Escherichia coli. FEBS Lett . 420: 54-56.

23. Sineshchekov, OA, VD Trivedi, J. Sasaki, and JL Spudich. 2005. Photochromicity of Anabaena sensory rhodopsin, an atypical microbial receptor with a cis-retinal light-adapted form. J. Biol . Chem . 280: 14663-14668.

24. Spudich, JL and H. Leucke. 2002. Sensory rhodopsin II: Functional insights from structure. Curr . Opin . Struct . Biol . 12: 540-546.

25. Spudich, J. L. and K. H. Jung. 2005. Microbial rhodopsins: Phylogenetic and functional diversity, pp. 1-24. In W. R. Briggs and J. L. Spudich (eds.). Handbook of Photosensory Receptors. Wiley-VCH.

26. Spudich, JL, C. Yang, KH Jung, and EN Spudich. 2000. Retinylidene proteins: Structures and functions from archaea to humans. Annu . Rev. Cell Dev . Biol . 16: 365-392.

27. Vogeley, L., OA Sineshchekov, VD Trivedi, J. Sasaki, JL Spudich, and H. Leucke. 2004. Anabaena sensory rhodopsin: A photochromic color sensor at 2.0 A. J. Biol . Chem . 280: 14663-14668.

28. von Lintig, J. and K. Vogt. 2000.Filling the gap in vitamin A research. J. Biol . Chem . 275: 11915-11920.

29. Wang, WW, OA Sineshchekov, EN Spudich, and JL Spudich. 2003. Spectroscopic and photochemical characterization of a deep ocean proteorhodopsin. J. Biol . Chem . 278: 33985-33991.

1 shows a comparative arrangement of the amino acid sequences of various microbial rhodopsin. Primary sequence comparisons between opsin obtained from Halobacterium salinarum, Haloterrigena, Natronomonas pharaonis (NpSRII), Anabaena, Guillardia, and Gloeobacter are shown. Conserved residues are indicated by black boxes. (HsBR, H. salinarum bacteriophage rhodopsin (bacteriorhodopsin); NpSRII, Natronomonas pharaonis sensor rhodopsin (sensory rhodopsin) Ⅱ; HsSRI, H. salinarum sensor rhodopsin I; MBP, Monterey Bay Proteorhodopsin; GR, Gloeobacter rhodopsin; ASR, Anabaena sensor rhodopsin; NR, Neurospora rhodopsin; LR, Leptosphaeria rhodopsin; CSRA, Chlamydomonas sensor rhodopsin A; GtSR, Guillardia theta sensor rhodopsin). Mutation sites (S86 and P206) are present in helices C and F. The residue KWG present in helix E is the best conserved part of the fungal rhodopsin.

2 shows Western blotting analysis of his-tagged various microorganisms of rhodopsin. E. coli β / UT5600 strain was prepared by transforming pORANGE plasmid for β-carotene synthesis into E. coli UT5600 strain. The pKJ900 plasmid contains various opsin genes and a mouse dioxygenase gene capable of producing all- trans retinal from β-carotene. Rhodopsin genes, including wild-type (WT) and leader sequences, were inserted into pKJ900 and transformed into E. coli β / UT for protein expression. Immunoassay of membrane proteins from E. coli UT5600 strains expressing tagged rhodopsin in several different plasmids was performed with anti-His antibodies. Membrane proteins were separated by 15% SDS-PAGE, transferred onto PVDF membrane and examined using antibody against 6 × His-tag. Lanes A and B include retinal systems added from outside; Lanes C and D comprise internally biosynthesized retinal; Lanes A, C include each rhodopsin; Lanes B, D comprise each rhodopsin comprising 19 leader sequence ATGGGTAAATTATTACTGATATTAGGTAGTGCTATTGCACTTCCATCATTTGCT (MGKLLLILGSAIALPSFA) derived from BPR. Each rhodopsin is SRI, SRII, NR, ASR, and GtSR.

3 is a diagram showing the absorption spectra of wild type (WT) and mutant ASRs. Absorbance spectra of 400-750 nm of purified C-terminal His-tagged wild type and site-directed mutant proteins of Anabaena sensor Rhodopsin (ASR) are shown. Absorption spectra of the purified wild-type ASR had a typical rhodopsin bandwidth, showing a single peak at 545 nm, and several mutations showed a pattern similar to wild-type. However, each of the mutations showed a different absorption maximum. It can be seen that the maximum absorption wavelengths of the P206D and S86D / P206D mutations in the retinal-binding pockets are blue-shifted.

4 is a graph showing the absorption spectrum of various mutant rhodopsin at different pHs. Absorption spectra of 400-800 nm of wild type and mutant of purified C-terminal His-tagged Anabaena sensor rhodopsin (ASR) are shown. The absorption spectrum of purified ASR was measured at different pHs. The change in each maximum absorption wavelength was less than 4 nm. Different amounts of protein were measured to better observe the peak wavelength from the spectrum.

FIG. 5 shows light-induced proton pumping of wild-type and mutant ASRs in vesicles. Proteorhodopsin (MBP) was used as a control for proton pumping activity. Light was irradiated every 60 seconds in the presence of a 440 nm cutoff filter. For dark adaptation, the protein was kept for 2 minutes under dark conditions. Pumping activity was measured using a pH electrode with varying pH in the speroplast suspension of each mutant.

6 shows absorption spectra of retinal-reconstituted membranes from WT ASR and P206E. An all- trans retinal was added to the membrane bleached with 3 ml hydroxylamine from UT5600. After reconstruction under dark conditions, light was irradiated to observe the light-adapted morphology. The time series of the spectrum is shown for reconstitution by insertion of all- trans retinal into wild type ASR and its mutant membrane.

7 is a 3D predictive diagram for Pro206Glu and Ser86Asp mutations. An X-ray crystallographic structural model of ASR is shown (PDB entry 1XIO). Hydrogen bonding network was shown using Swiss-Pdb viewer. The upper and lower portions represent extracellular and cytoplasmic portions, respectively. Each mutant residue was introduced by optimization by energy minimization program and overlapped with wild type ASR structure. Yellow molecules represent retinal and numbers represent hydrogen bond distances in angstroms. The structure of the Pro206Glu mutant showed that the negatively charged side chains changed the environment of the retinal. However, the Ser86Asp model structure shows that this residue is far from the retinal.

<110> Sogang University Corporation <120> Mutant Anabaena Sensory Rhodopsin with Altered Absorption Maximum <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 261 <212> PRT <213> Anabaena sp. <400> 1 Met Asn Leu Glu Ser Leu Leu His Trp Ile Tyr Val Ala Gly Met Thr   1 5 10 15 Ile Gly Ala Leu His Phe Trp Ser Leu Ser Arg Asn Pro Arg Gly Val              20 25 30 Pro Gln Tyr Glu Tyr Leu Val Ala Met Phe Ile Pro Ile Trp Ser Gly          35 40 45 Leu Ala Tyr Met Ala Met Ala Ile Asp Gln Gly Lys Val Glu Ala Ala      50 55 60 Gly Gln Ile Ala His Tyr Ala Arg Tyr Ile Asp Trp Met Val Thr Thr  65 70 75 80 Pro Leu Leu Leu Leu Ser Leu Ser Trp Thr Ala Met Gln Phe Ile Lys                  85 90 95 Lys Asp Trp Thr Leu Ile Gly Phe Leu Met Ser Thr Gln Ile Val Val             100 105 110 Ile Thr Ser Gly Leu Ile Ala Asp Leu Ser Glu Arg Asp Trp Val Arg         115 120 125 Tyr Leu Trp Tyr Ile Cys Gly Val Cys Ala Phe Leu Ile Ile Leu Trp     130 135 140 Gly Ile Trp Asn Pro Leu Arg Ala Lys Thr Arg Thr Gln Ser Ser Glu 145 150 155 160 Leu Ala Asn Leu Tyr Asp Lys Leu Val Thr Tyr Phe Thr Val Leu Trp                 165 170 175 Ile Gly Tyr Pro Ile Val Trp Ile Ile Gly Pro Ser Gly Phe Gly Trp             180 185 190 Ile Asn Gln Thr Ile Asp Thr Phe Leu Phe Cys Leu Leu Pro Phe Phe         195 200 205 Ser Lys Val Gly Phe Ser Phe Leu Asp Leu His Gly Leu Arg Asn Leu     210 215 220 Asn Asp Ser Arg Gln Thr Thr Gly Asp Arg Phe Ala Glu Asn Thr Leu 225 230 235 240 Gln Phe Val Glu Asn Ile Thr Leu Phe Ala Asn Ser Arg Arg Gln Gln                 245 250 255 Ser Arg Arg Arg Val             260 <210> 2 <211> 783 <212> DNA <213> Anabaena sp. <400> 2 atgaatttgg agagtctttt acactggatt tatgttgcgg gaatgacaat tggtgcattg 60 cacttttggt cacttagtcg aaatccgcgc ggtgttcccc agtacgaata ccttgtggcg 120 atgtttattc ccatttggtc gggactagcc tatatggcaa tggcaataga ccaaggtaaa 180 gttgaagcgg ctgggcaaat tgcccactat gcccgttata ttgattggat ggtgacaaca 240 ccattattac tgctatctct ttcttggaca gcgatgcagt ttatcaaaaa agattggaca 300 ctcattggtt ttttgatgag tacccagata gttgtaatta cctctgggtt aatcgcagat 360 ttatctgagc gcgattgggt gagatatcta tggtatatct gcggggtttg cgcttttctc 420 attattcttt ggggtatttg gaatccattg cgcgccaaaa ccagaactca aagttcagaa 480 ctagcgaact tatacgataa gcttgttact tattttacag tgctttggat aggctaccca 540 atagtctgga ttattggccc tagtggtttt ggctggataa atcaaactat agatacattt 600 ttgttttgtc tactggattt tttctccaag gttggattta gttttctgga tttacacggc 660 ttacgtaatc tcaatgattc ccgccaaact actggcgatc gctttgcgga aaatacttta 720 cagtttgtag aaaatattac attatttgct aactcacgac ggcaacaatc acgcagaaga 780 gtt 783  

Claims (5)

An Anabaena sensor rhodopsin mutant protein in which 206th amino acid Pro is substituted with Asp in SEQ ID NO: 1. A nucleic acid molecule encoding the Anabaena sensor rhodopsin mutant protein of claim 1. The nucleic acid molecule of claim 2, wherein the nucleic acid molecule is SEQ ID NO: 2 sequence. A vector comprising the nucleic acid molecule of claim 2 encoding (a) an Anabaena sensor rhodopsin mutant protein and (b) a promoter operatively linked to the nucleic acid molecule. A transformant comprising the vector of claim 4.

Images