KR100937230B1 - A Pharmaceutical Composition for Treating Inflammation Comprising siRNA Which Complementarily Binds with Nox4 Gene as Active Ingredient - Google Patents

Abstract

The present invention relates to a method for inhibiting the generation of reactive oxygen species induced by lipopolysaccharide (LPS) and activation of NF-κB in animal cells. The method for inhibiting the generation of reactive oxygen species induced by LPS and activation of NF-κB in the animal cells of the present invention is to introduce siRNA capable of complementary binding to the Nox4 gene into the cell, thereby inhibiting the expression of the Nox4 gene. Steps. According to the present invention, it is possible to suppress the overproduction of harmful reactive oxygen species induced by LPS caused by Gram-negative bacteria and the activation of NF-κB, which is known as an inflammatory factor, and thus is widely used for the treatment of inflammation caused by bacterial infection. Could be utilized.

Lipopolysaccharide (LPS), reactive oxygen species, Nox4, NF-κB

Description

A pharmaceutical composition for treating inflammation comprising siRNA which complementarily binds with nox4 gene as active ingredient}

1A is a genetic map of pFLAG-CMV-TLR4.

1B is a genetic map of pFLAG-CMV-CD14.

1C is a genetic map of pFLAG-CMV-MD2.

FIG. 1D shows that HEK293T cells are simultaneously transformed with pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2, and pCMV-βgal, and then treated with LPS, beta-galacto It is a graph showing the measurement result of the relative activity of luciferase with respect to the sidase activity.

FIG. 1E shows that the degree of DCF fluorescence when LK was treated after simultaneously transforming HEK293T cells with pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2 and pCMV-βgal Fluorescence micrograph showing.

2A is a genetic map of pGEX4T1-TLR4-C.

2B is a genetic map of pcDNA3.0-HA-Nox4-C.                 

Figure 2c is an immunoblot showing the interaction of GST-TLR4-C and HA-Nox4-C.

Figure 3a is a gene map of the siRNA expression vector pSUPER-Nox4 for the Nox4 gene.

Figure 3b shows that HEK293T cells are simultaneously transformed with pSUPER-Nox4 and pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2 and pCMV-βgal, and then treated with LPS. Fluorescence micrograph showing changes in the degree of formation of H ₂ O ₂ .

FIG. 3C shows that HEK293T cells are simultaneously transformed with pSUPER-Nox4 and pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2 and pCMV-βgal, and then treated with LPS. It is a graph showing the result of measuring the relative activity of luciferase to beta-galactosidase activity.

The present invention relates to a method for inhibiting the production of reactive oxygen species (ROS) induced by lipopolysaccharide (LPS) and activation of NF-κB in cells. More specifically, the present invention provides a method for generating NF- and reactive oxygen species that are retained by LPS in a cell, comprising introducing into a cell an siRNA capable of complementary binding to the Nox4 gene, thereby inhibiting expression of the Nox4 gene. It relates to a method of inhibiting the activation of κB.

LPS is a type of bacterial toxin that constitutes the cell surface of gram-negative bacteria and is known to play various roles in the interaction between pathogenic bacteria and eukaryotes. It is known to stimulate. When a mammal is infected with Gram-negative bacteria, the LPS directly binds to toll-like receptor 4 (TLR4) and activates intracellular NF-κB, thereby inducing an immune and inflammatory response. Activation of κB is known to involve myeloid differentiation primary response protein (MyD88), interleukin receptor-associated kinase (IRAK), and TNF receptor associated factor 6 (TRAF6). (See Akira et al., Nat. Immunol., 2: 675-680, 2001). Recent studies have shown that activation of NF-κB by LPS is regulated by reactive oxygen species such as superoxide anion (O ₂ ⁻ ) and hydrogen peroxide (H ₂ O ₂ ) (Asehnoune). et al., J. Immunol., 172: 2522-2529, 2004), the detailed mechanism of the generation of reactive oxygen species by LPS has not yet been identified.

Oxygen species, which cause oxidative damage to cells, are by-products generated by aerobic metabolism in living aerobic respiration such as mammals when the oxygen partial pressure is high. They are very reactive and react with various substances in vivo, causing oxidative damage, which may impair cell function and lead to apoptosis. Specifically, reactive oxygen species may be used for cardiac diseases such as ischemic-reperfusion injury through oxidative damage of DNA, proteins, lipids and small cell molecules (see Peterson et al., Biochem. Biophys. Res. Commun., 127 (1): 87-93, 1985), neurological disorders such as Alzheimer's disease (Perry et al., J. Alzheimers Dis., 1 (1): 45-55, 1998), mutations or cancer (Refer to Emerit I., Free Radic. Biol. Med., 16 (1): 99-109, 1994), which are known to be a major cause of aging and various diseases. By mediating the activation of NF-κB by LPS, it is a cause of diseases caused by inflammation such as arthritis.

On the other hand, there are substances that perform an antioxidant reaction that can remove reactive oxygen species in the cell itself, and enzymes that perform antioxidant reactions, substances other than enzymes that can react with reactive oxygen species, and the like. Specifically, the enzyme that performs the antioxidant reaction includes a superoxide dismutase (SOD) that decomposes superoxide anion, a catalase that converts hydrogen peroxide into water and oxygen, and selenium in the enzyme active site. In addition to hydrogen peroxide, there is glutathione peroxidase (GPX) that destroys other peroxides. Other than enzymes that can react with reactive oxygen species, glutathione, flavonoids, ubiquinol-10, glucose, albumin Etc.

In addition, it is possible to perform an antioxidant reaction using a substance that can be ingested from the outside, such substances are known vitamin C, E and A and provitamin A, a small amount of selenium and zinc, and more effective antioxidant reaction Efforts have been made to develop materials capable of carrying out or methods to prevent oxidation. For example, Korean Patent Publication No. 1989-14713 discloses a copolymer-bonded amine antioxidant, and Korean Patent No. 167559 discloses an olefin polymer containing a polymerizable antioxidant and a bound antioxidant. Korean Patent No. 149453 discloses an antioxidant composition including green tea extract and an anti-oxidation method of a maintenance food.

As in the prior art, it is more preferable to prevent the generation of reactive oxygen species in advance than to remove the already produced reactive oxygen species, but the research and development of a method for inhibiting the generation of reactive oxygen species The situation is still incomplete. For example, US Patent Publication No. US20040001818 discloses a method for inhibiting angiogenesis using an inhibitor of NADPH oxidase, and International Patent Application Publication No. WO0189517 discloses cell proliferation and substrate production by an antioxidant and an inhibitor of NAD (P) H oxidase. Although a method of suppressing the present invention has been disclosed, the prior art focuses on the anticancer effect, and thus cannot be considered as a method for inhibiting the generation of active oxygen species in full scale. Moreover, the generation and the generation of reactive oxygen species generated by LPS Method of selectively inhibiting only activation of NF-κB has not been developed.

On the other hand, in relation to gene suppression methods, siRNAs (small interfering RNAs) have been found as part of natural mechanisms that regulate genes in nematodes, fruit flies, and plants. It has been shown that siRNA can be used to induce the degradation of sequence-specific mRNA (messenger RNA) to block protein synthesis, thereby interfering with gene expression. Accordingly, the use of siRNA has suggested the possibility of treating the disease by suppressing the expression of exogenous and endogenous genes in vitro or in vivo (Xia et al., Nat. Biotechnol). , 20 (10): 1006-1010, 2002). However, a method for inhibiting the generation of reactive oxygen species induced by LPS and the activation of NF-κB has not yet been developed using siRNA.

Thus, by identifying the molecular biological mechanisms of the generation of reactive oxygen species induced by LPS and the activation of NF-κB and introducing siRNAs for the genes associated therewith into cells, the generation of reactive oxygen species induced by LPS and There is a constant need to develop a method that can selectively inhibit only the activation of NF-κB.

Accordingly, the present inventors have made intensive efforts to develop a method capable of specifically inhibiting the generation of reactive oxygen species induced by LPS and the activation of NF-κB. As a result, the siRNA capable of complementary binding to the Nox4 gene is directly expressed in cells. Inhibiting the expression of the Nox4 gene by incorporating or transforming a vector expressing the siRNA into an animal cell confirms that the production of reactive oxygen species induced by LPS and the activity of NF-κB are inhibited to a baseline level. This invention was completed.

After all, the main object of the present invention is to provide a method for specifically inhibiting the production of reactive oxygen species induced by LPS and activation of NF-κB in cells.

It is well known that when cells are exposed to LPS, NADPH oxidase in the electron transport system is activated to increase free radical species such as superoxide anion (O ₂ ⁻ ) or hydrogen peroxide (H ₂ 0 ₂ ) in the cell. However, the mechanism of increase of reactive oxygen species in specific cells is not clearly known. The present inventors treated the diphenyliodonium (DPI), which is known to be an inhibitor of NADPH oxidase, to HEK293T transformed to express toll-like receptor 4 (TLR4), which is known to be a receptor for LPS, and its subproteins, CD14 and MD2. It was confirmed that the production of reactive oxygen species by LPS was completely reduced, which strongly suggests that NADPH oxidase, a flavin-containing oxidase, is involved in ROS production and NF-κB activation by LPS. Nox isozyme, a major member of NADPH oxidase, is known to interact with accessory proteins such as p47 ^phox , p67 ^phox and rac through the carboxy terminus, and the TIR domains of TLR4 are diverse including MyD88 and IRAK. It is known to interact with signaling molecules.

Thus, the present inventors construct an expression vector expressing the carboxy terminus of Nox4, which is mainly expressed in HEK293T cells, to determine whether the interaction between the Nox isoenzyme and the TIR domain of TLR4 occurs. As a result of constructing and expressing GST (glutathione S-transferase) fusion protein expression vectors, the indirect evidence that the carboxy terminus of Nox4 interacts with the TIR domain of TLR4 was obtained. In addition, the siRNA capable of complementary binding to the Nox4 gene was assuming that inhibition of the expression of the Nox4 gene from the previous results would inhibit the generation of reactive oxygen species induced by LPS and the activation of NF-κB. When directly incorporating cells or introducing siRNA expression vectors expressing the siRNAs, it was confirmed that the generation of reactive oxygen species induced by LPS and the activation of NF-κB were inhibited.

In the method of inhibiting the generation of reactive oxygen species induced by LPS in the cells of the present invention, the step of inhibiting the expression of Nox4 gene by introducing into the cell siRNA capable of complementary binding to the human Nox4 gene (SEQ ID NO: 1) In this case, the introduction of the siRNA into the cell complementary to the Nox4 gene is not particularly limited, but may be carried out by directly incorporating the siRNA into the cell or transforming the cell with a vector expressing the siRNA. Preferably, siRNA capable of complementary binding to Nox4 gene is not particularly limited thereto, but preferably has a nucleotide sequence of SEQ ID NO: 2, and siRNA expression vector is not particularly limited thereto.

On the other hand, the method of directly incorporating siRNA capable of complementary binding to the aforementioned Nox4 gene into the cell is not particularly limited, but 2-5 μg of cationic liposomes per 1 μg of siRNA are mixed and lipofection is performed for 15 to 40 minutes. lipofection).

The method of inhibiting the generation of reactive oxygen species induced by LPS of the present invention and the activation of NF-κB is an expression vector expressing an siRNA or an electric siRNA for Nox4 gene, which is mixed with an injectable composition to prevent bacterial infection in mammals. Is administered by injection to the site of inflammation, or mixed with a gel composition or a transdermal absorption adhesive composition, and directly applied to the affected area, whereby the injectable composition is preferably an isotonic aqueous solution or suspension, The mentioned compositions contain sterile and / or adjuvants (eg, preservatives, stabilizers, wetting or emulsifier solution accelerators, salts for buffering osmotic pressure, buffers and / or liposome preparations), and the gel composition comprises carboxymethyl cellulose, methyl Gel preparations such as cellulose, acrylic acid polymers, carbopol and the like and pharmaceutically acceptable carriers and / or It contains a posome preparation, the percutaneous absorption pressure-sensitive adhesive, the active ingredient layer comprises a pressure-sensitive adhesive layer, the absorption layer for sebum absorption and the therapeutic drug layer, the therapeutic drug layer contains a pharmaceutically acceptable carrier and / or liposome preparation do. On the other hand, siRNA or siRNA expression vector for the aforementioned Nox4 gene, the pharmaceutical formulation can be carried out immediately before administration, if necessary, can also be used in the form of a formulation encapsulated in a substance such as liposomes (see Nabel et al., Proc. Natl. Acad. Sci., USA., 90 (23): 11307-11311, 1993), the dosage of the electric siRNA or siRNA expression vector is determined by the particular dosage form, route of administration and purpose and the mammal to be treated. It is appropriately determined according to the age, weight and symptoms of the animal. In general, for adults, the daily dosage is 10 ng to 100 mg / kg in the amount of active ingredient contained in the formulation.

The method of inhibiting the generation of reactive oxygen species induced by LPS and activation of NF-κB in the cells of the present invention, overproduction and inflammation of harmful reactive oxygen species induced by LPS following Gram-negative bacteria infection By inhibiting the activation of NF-κB known as a factor, it will be widely used in the treatment of inflammation caused by bacterial infection.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. will be.

Example 1 Analysis of Relationship between LPS-dependent Cell Signaling and Intracellular Redox Balance

To analyze the relationship between LPS-dependent cell signaling and intracellular redox balance, we measured the level of NF-κB activation and free radical generation in HEK293T cells.

Example 1-1 Cell Culture

First, HEK293T cells (ATCC, USA) were prepared with DMEM (Dulbecco's modified) containing 10% (v / v) fetal bovine serum and 1% (v / v) antibiotic-antimycotic solution (Life Technologies, USA). Eagle's medium, JBI, South Korea) was cultured in a culture dish with a 37 ℃, 5% (v / v) CO ₂ conditions.

Example 1-2 Construction of Expression Vectors Expressing TLR4, CD14 and MD2

Since HEK293T cells derived from renal epithelial cells do not express TLR4, an expression vector capable of expressing TLR4, CD14 and MD2, respectively, was constructed in order to express TLR4 gene and CD14 and MD2, which are auxiliary proteins of TLR4, in HEK293T cells.

First, in order to clone the cDNA of the electric TLR4, CD14 and MD2, using the RNA extraction kit (Trizol, Invitrogen, USA) to extract the total RNA from the macrophage (human macrophage) of the human, and the electric whole RNA As a template, reverse transcription of mRNA and subsequent PCR reaction was performed using RT-for-PCR Kit (Promega, USA). For TLR4, sense primer 5'-ctagcggccgcaggatgatgtctgcctcgcg-3 '(SEQ ID NO: 3) With antisense primer 5'-gtggtcgacctcttcagatagatgttgc-3 '(SEQ ID NO: 4), and for CD14 sense primer 5'-ctagcggccgcatggagcgcgcgtcctgcttg-3' (SEQ ID NO: 5) and antisense primer 5'-gtggtcgacatcttaggca (SEQ ID NO: 6) In the case of MD2, sense primer 5'-ctagcggccgcatcatgttaccatttctgtt-3 '(SEQ ID NO: 7) and antisense primer 5'-gtggtcgacattctaatttgaattaggttgg-3' (SEQ ID NO: 8) were used. The PCR products were then electrophoresed on a 1% (w / v) agarose gel to cut DNA bands corresponding to the sizes of the electric TLR4, CD14 and MD2 genes, respectively, and then the PCR product extraction kit (Wizard PCR Prep). Kit, Promega, USA) to extract the cDNA fragment of the electric gene. Then, the electric cDNA fragment and pFLAG-CMV1 vector were completely cleaved with restriction enzymes Not I and Sal I, respectively, and the respective cleaved cDNA fragments and a 4.7 kb linearized vector were linked using ligase to perform the electrolysis. Respective expression vectors pFLAG-CMV-TLR4, pFLAG-CMV-CD14 and pFLAG-CMV-MD2 for genes were constructed (see FIGS. 1A, 1B and 1C). 1A is a genetic map of pFLAG-CMV-TLR4, FIG. 1B is a genetic map of pFLAG-CMV-CD14, and FIG. 1C is a genetic map of pFLAG-CMV-MD2.

Example 1-3 Activity Analysis of NF-κB According to LPS Treatment

HEK293T cells were cultured to occupy about 50% of the bottom area of the culture plate, and then pNF-κB-Luc (Stratagene, USA), an NF-κB-induced luciferase expression vector using Effectene (Qiagen, USA), the present Example PFLAG-CMV-TLR4, pFLAG-CMV-CD14 and pFLAG-CMV-MD2 constructed in 1-2 and pCMV-βgal (Life Technologies, USA), a beta-galactosidase expression vector, were simultaneously transformed. Meanwhile, pFLAG-CMV1 was used as a control. After 48 hours after transformation, electrotransformed HEK293T cells were treated with LPS ( E. coli 055: B5, Sigma, USA) at a concentration of 1 μg / ml. After 6 hours after LPS treatment, luciferase activity was measured using the Luciferase Assay System (Dual Luciferase Assay System, Promega, USA), and the measurements were normalized to relative values for beta-galactosidase activity. (See FIG. 1D). FIG. 1D shows that HEK293T cells are simultaneously transformed with pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2, and pCMV-βgal, and then treated with LPS, beta-galacto It is a graph showing the measurement result of the relative activity of luciferase with respect to the sidase activity. As shown in Figure ID, HEK293T cells transformed with the electric pFLAG-CMV1 vector only and LPS treatment showed little activity of luciferase, whereas pFLAG-CMV-TLR4, pFLAG-CMV-CD14 and pFLAG-CMV- By transforming with MD2, when TLR4, CD14 and MD2 were expressed, it was confirmed that NF-κB was activated by LPS.

Example 1-4 : Analysis of H ₂ O ₂ Production in Cells after LPS Treatment

The transformed HEK293T cells were treated with LPS and analyzed for the production of H ₂ O ₂ after 30 minutes.

First, the electrotransformed HEK293T cells were washed with a buffer solution (Hank's balanced salt solution, pH 7.8), and 5 μM of 2 ', 7'-dichloride fluorescein diacetic acid (2', 7) at 37 ° C in dark conditions. '-dichlorofluorescein diacetate (DCF-DA, Molecular Probes, USA) was immersed in an electric buffer solution and left for 5 minutes to oxidize DCF-DA with H ₂ O ₂ to give strong fluorescence. It was converted to fluorescein dichloride (2 ', 7'-dichlorofluorescein: DCF). Then, a laser scanning cone equipped with an argon gas tuned to be excited at a wavelength of 488 nm, an LP505 radiation filter (Carl Zeiss, Germany) and a × 100 objective (Carl Zeiss, Germany) which selectively transmit wavelengths of 515-540 nm. Observation was performed using a focal microscope (model LSM 510, Carl Zeiss, Germany) (see FIG. 1E). FIG. 1E shows that the degree of DCF fluorescence when LK was treated after simultaneously transforming HEK293T cells with pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2 and pCMV-βgal Fluorescence micrograph showing. As shown in FIG. 1E, when LPS was treated to HEK293T cells transformed with pFLAG-CMV-TLR4, pFLAG-CMV-CD14, and pFLAG-CMV-MD2, DCF fluorescence was strongly observed, which indicates LPS in cells. When treating, it means that the production of reactive oxygen species through the cell signaling process via TLR4, CD14 and MD2 is increased.

Example 2 Analysis of the Interaction of TLR4 with Nox4 Protein

In order to check whether Nox4, a member of TLR4 and NADPH oxidase, interacted, GST pulldown (glutathione S-transferase pull-down) analysis was performed as follows.

Example 2-1 : Construction of expression vector of GST-TLR4 C-terminal fusion protein and Nox4 C-terminal expression vector

Example 2-1-1 : Construction of Expression Vector of GST-TLR4 C-Terminal Fusion Protein

Plasmids encoding glutathione S-transferase (GST) fusion proteins comprising amino acid sequences 676 to 835 of human TLR4 were constructed by the following method.

Reverse transcription and subsequent PCR reactions were carried out using the macrophage whole RNA extracted in Example 1-2 as a template, followed by PCR reaction using RT-for-PCR Kit (Promega, USA). -cgaattcgcctttgtatctactcaag-3 '(SEQ ID NO: 9) and antisense primer 5'-cggcggccgcttcctgccaattgcatcctg-3' (SEQ ID NO: 10) were used, and the PCR reaction was performed. A gene fragment of approximately 480 bp was obtained and inserted into the pGEX4T1 (Pharmacia Biotech, USA) cut with EcoR I and Not I using ligase to construct plasmid pGEX4T1-TLR4-C encoding the GST fusion protein ( See Figure 2a). The plasmid pGEX4T1-TLR4-C was then introduced into E. coli DH5α and transformed by heat shock therapy to obtain a transformant. The transformants were then obtained by culturing, cells were hemolyzed, and the GST-TLR4-C fusion protein was isolated from the hemolytes using glutathione attached sepharose beads.

Example 2-1-2 : Construction of Nox4 C-terminal Expression Vector

Expression vectors for amino acid sequences 248 to 575 of human Nox4 were constructed in the following manner.

First, a DNA fragment corresponding to an amino acid sequence (MYPYDVPDYA: SEQ ID NO: 11) corresponding to the N-terminus of hemagglutinin (HA) and capable of binding to a vector cleaved by restriction enzymes Hind III and EcoR I is prepared. To this end, a sense oligonucleotide 5'-gacctatgtacccctacgacgtgcccgactacgccg-3 '(SEQ ID NO: 12) and an antisense oligonucleotide 5'-aattcggcgtagtcgggcacgtcgtaggggtacata-3' (SEQ ID NO: 13) were synthesized, and the electric sense oligonucleotide and antisense oligonucleotide were respectively synthesized at 90 ° C. The mixture was heated for 5 minutes to denature, mixed and complementarily bound at 60 ° C. for 30 minutes. The DNA fragment thus produced was inserted into a pcDNA3.0 (Invitrogen, USA) vector digested with restriction enzymes Hind III and EcoR I to construct pcDNA3.0-HA. Then, the reverse transcription reaction with the macrophage whole RNA extracted in Example 1-2 as a template, followed by the PCR reaction using the RT-for-PCR Kit (Promega, USA), wherein the sense as a primer Primer 5'-gcgaattccatgaacctttccctgaagg-3 '(SEQ ID NO: 14) and antisense primer 5'-gcgcggccgctcatttattgtattcaaatccttgt-3' (SEQ ID NO: 15) were used. Subsequently, the PCR product was digested with restriction enzymes EcoR I and Not I to obtain a gene fragment of approximately 980 bp, and inserted into the electric pcDNA3.0-HA cut with restriction enzymes EcoR I and Not I using ligase. , The expression vector pcDNA3.0-HA-Nox4-C was constructed about the amino acid sequence 248-575 of human Nox4 (refer FIG. 2b).

Example 2-2 GST-Pulldown Assay

Obtained by transforming HEK293T cells with Lipofectamine (Life Technologies, USA) with pcDNA3.0-HA-Nox4-C constructed in Example 2-1-2, followed by hemolysis of electrotransformed HEK293T cells The hemolytes were reacted with Sepharose beads to which the GST-TLR4-C fusion protein isolated in Example 2-1-1 was attached. Electrical Sepharose beads were separated by centrifugation, washed three times, and immunoblot analysis was performed with anti-hemagglutinin (HA) antibody (Roche, USA) (see FIG. 2C). Figure 2c is an immunoblot showing the interaction of GST-TLR4-C and HA-Nox4-C. As shown in FIG. 2C, while the GST-TLR4-C fusion protein and the HA-Nox4-C fusion protein were bound, it was confirmed that the pure GST protein did not bind with the HA-Nox4-C, which is the carboxy terminus of TLR4. And the carboxy terminus of Nox4 directly interact.

Example 3 Introduction of siRNA Complementary to Nox4 Genes into Cells and Analysis of Inhibition of NF-κB Activation and Production of Reactive Oxygen Species

From the indirect evidence that the carboxy terminus of Nox4 and the TIR domain of TLR4 interact with each other in Example 2 on the assumption that Nox4 is involved in the cellular signaling process induced by LPS, the expression of the Nox4 gene is suppressed. In order to determine whether it is possible to inhibit the increase in the production of reactive oxygen species induced by, the expression of the Nox4 gene was suppressed, and then the degree of generation of reactive oxygen species and the inhibition of NF-κB activation were analyzed: Nox4 In order to suppress the expression of the gene, a method of introducing each siRNA capable of complementary binding to the mRNA of Nox4 directly into the cell or an expression vector capable of expressing the electric siRNA was used.

Example 3-1 : Direct Incorporation of siRNA into Cells and Analysis of the Generation of Reactive Oxygen Species

SiRNA capable of complementary binding to mRNA of Nox4 was constructed and then directly incorporated into HEK293T cells along with pFLAG-CMV-TLR4, pFLAG-CMV-CD14 and pFLAG-CMV-MD2, resulting in the generation of reactive oxygen species. The production was analyzed.

Example 3-1-1 Construction of siRNA Complementary to Nox4 mRNA

A specific nucleotide sequence of 19 nucleotides from Nox4 cDNA (SEQ ID NO: 1) was selected for the construction of siRNA expression vectors capable of expressing siRNA and electric siRNA. The specific nucleotide sequence of the first 19 nucleotides is 5'-gtcaacatccagctgtacc-3 '(SEQ ID NO: 16), and 5'-gucaacauccagcuguaccuucaagagagguacagcuggauguugacuu sequentially comprising an antisense sequence capable of complementary binding with the sense sequence, loop structure sequence, and the above sense sequence. SiRNAs having a sequence of -3 '(SEQ ID NO: 2) were constructed through oligonucleotide synthesis.

Example 3-1-2 : Incorporation of siRNA into Cells

HEK293T cells were treated with 10% (v / v) fetal bovine serum (FBS) and 1% (v / v) of an antibiotic-antimycotic solution at 37 ° C and 5% (v / v) CO ₂ . Example 1, when grown in a 35 mm diameter culture dish containing DMEM (Dulbecco's modified Eagle's medium, JBI, Korea) supplemented with Life Technologies, USA, and grown to occupy 60% of the area of the culture dish. SiRNAs constructed in 3-1-1 were directly incorporated into cells in the following manner, together with pFLAG-CMV-TLR4, pFLAG-CMV-CD14 and pFLAG-CMV-MD2 constructed in Examples 1-2 above.

First, aliquots of 0 to 8 μl of liposome preparations (siFECTOR ^™ , 1 mg / ml, B-Bridge International, USA) were dispensed in micronized centrifuge tubes in units of 1 μl, and fetal bovine serum and antibiotic-antifungal solutions were removed from the tubes. DMEM was added to adjust the total volume to 100 μl and then mixed well. 100 µl of an aqueous solution (10 µg / ml) in which siRNA was dissolved was added to the mixture, mixed well with a pipette and left at room temperature for 30 minutes. Meanwhile, 1 μl of pFLAG-CMV-TLR4, pFLAG-CMV-CD14, and pFLAG-CMV-MD2 diluted at a concentration of 1 μg / μl were dispensed, and Effectene (Qiagen, USA) used in Examples 1-3 above was added thereto. 6 μl was mixed and mixed with siRNA and siEFCTOR liposome preparation mixture for the aforementioned Nox4 gene. Then, the culture dish containing the electroculture cells was washed with DMEM without fetal calf serum and antibiotic-antifungal solution, 0.8 ml of DMEM without fetal calf serum and antibiotic-antifungal solution was added, and then the electroculture plate. Pipette 200 μl of the siFECTOR liposome preparation / siRNA / pFLAG-CMV-TLR4 / pFLAG-CMV-CD14 / pFLAG-CMV-MD2 / Effectene / DMEM mixture into the pipette and cover the entire culture plate evenly, at 37 ° C. and 5 Incubated for 10 hours under the condition of% (v / v). Subsequently, 1 ml of DMEM containing 20% fetal calf serum (v / v) and 2% (v / v) electric antibiotic-antimycotic solution (v / v) was added to the electric culture dish, and further incubated for 24 hours.

Example 3-1-3 : H ₂ O ₂ production analysis

LPS was treated to HEK293T cells in which siRNA and pFLAG-CMV-TLR4, pFLAG-CMV-CD14, and pFLAG-CMV-MD2 for the Nox4 gene were simultaneously incorporated by the method of Example 3-1-2, followed by H in cells. The concentration of ₂ O ₂ was measured.

First, cells grown to occupy more than 80% of the surface of the culture dish were washed with a buffer (Hank's balanced salt solution, pH 7.8), and treated with LPS (Sigma, USA) at a concentration of 1 µg / ml, followed by 37 ° C. Incubated for 30 minutes at. Subsequently, the resultant was washed with an electric buffer solution, immersed in an electric buffer solution containing 5 μM of DCF-DA (Molecular Probes, USA) at 37 ° C. in a dark condition, allowed to stand for 5 minutes, and then adjusted to be excited at a wavelength of 488 nm. Laser scanning confocal microscope (Model LSM 510, Carl Zeiss, Germany) equipped with an LP505 radiation filter (Carl Zeiss, Germany) and a × 100 objective (Carl Zeiss, Germany) for selectively transmitting a gas, wavelengths of 515-540 nm The observed images were stored at a resolution of 512 × 512 (pixel × pixel) and averaged for each group using an image analysis program (Zeiss vision system, LSM510, version 2.3, Carl Zeiss, Germany). Mean relative fluorescence intensity was measured. At this time, DCF fluorescence intensity was measured as a relative concentration by converting the DCF fluorescence measurement value corresponding to the concentration of H ₂ O ₂ measured from the cells without LPS treatment and not containing the siRNA into 100, as a relative concentration (see: Table 1).

Relative Concentrations of H ₂ O ₂ in HEK293T Cells Directly Incorporating siRNA for Nox4 Gene Liposomes / siRNA (μg / μg) H ₂ O ₂ generation rate (% control) 0 526 One 211 2 135 3 132 4 121 5 106 6 112 7 122 8 114

As shown in Table 1, the siRNA for the Nox4 gene was incorporated into HEK293T cells together with pFLAG-CMV-TLR4, pFLAG-CMV-CD14, and pFLAG-CMV-MD2, and LPS was treated to the cells. Increasing amount of H ₂ O ₂ was found to decrease generally.

On the other hand, in the case where during the introduction of the siRNA, when using the liposomes in an amount 2㎍ or more per siRNA 1㎍, the production of H ₂ O ₂ but found to be effectively reduced, processes more than 6㎍ liposomes include H ₂ O ₂ Since the decrease in production was not greatly improved and side effects such as apoptosis were observed, it was confirmed that it is preferable to use 2 to 5 μg of liposome per 1 μg of siRNA.

Example 3-2 Transformation of HEK293T Vertically and Expression of Active Oxygen Species and Inhibition of NF-κB Activation of an Expression Vector capable of Expressing siRNA for Nox4

In order to suppress the expression of the Nox4 gene, HEK293T cells were transformed with an expression vector capable of expressing siRNA for the Nox4 gene, and thus, generation of reactive oxygen species and inhibition of NF-κB activation were analyzed.

Example 2-2-1 : Construction of siRNA expression vector capable of complementarily binding to mRNA of Nox4 gene

A sense consisting of 60 nucleotides sequentially comprising a restriction region of restriction enzyme Bgl II, a DNA sequence corresponding to the siRNA sequence of SEQ ID NO: 2 constructed in Example 3-1-1, and a restriction enzyme Hind III recognition region. Antisense oligonucleotides consisting of 60 nucleotides capable of complementary binding to oligonucleotides and electrical sense oligonucleotides were synthesized. The nucleotides of the sense oligonucleotide and the antisense oligonucleotide were 5'-gatccccgtcaacatccagctgtaccttcaagagaggtacagctggatgttgacttttta-3 '(SEQ ID NO: 17) and 5'-agcttaaaaagtcaacatccagctgtacctctcttgaaggtacagctggatgttgacggg-3' (SEQ ID NO: 18). Electrosense and antisense oligonucleotides were hybridized and converted to double-stranded DNA, followed by phosphorylation using polynucleotide kinase and alkaline dephosphatase. Subsequently, the electrophosphorylated double-stranded oligonucleotide was inserted into a linearized pSUPER vector (OligoEngine, USA), and then ligase was used to connect the electric nucleotide and the electric vector to construct an expression vector pSUPER-Nox4 of siRNA for Nox4. (See FIG. 3A).

Example 3-2-2 : Transformation of siRNA Expression Vectors into Animal Cells

HEK293T cells were treated with 10% (v / v) fetal bovine serum (FBS) and 1% (v / v) of an antibiotic-antimycotic solution at 37 ° C. and 5% (v / v) CO ₂ . Life Technologies, USA) and cultured in a culture plate containing DMEM supplemented, siRNA expression vector pSUPER-Nox4 for Nox4 constructed in Example 2-2-1 in the following manner pNF-κB-Luc, HEK293T cells were simultaneously transformed with pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2, and pCMV-βgal. That is, approximately 2 × 10 ⁵ HEK293T cells were obtained by centrifugation, and then resuspended in Nucleofector ^™ solution (Amaxa Biosystems, Germany) and the siRNA expression vectors pSUPER-Nox4 and pNF-κB-Luc, pFLAG-CMV- TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2, and pCMV-βgal were mixed with 100 μl of cell suspension in 1 μg each and transferred to Amaxa certified cuvettes (Amaxa Biosystems, Germany) with a spacing of 2.0 mm. The transformation was performed by applying an electric shock, and the electrotransformed cells were immediately transferred to a 35 mm diameter dish containing a complete medium, and cultured at 37 ° C.

Example 3-2-3 : H ₂ O ₂ production analysis

The HEK293T cells co-transformed by the above 3-2-2 method were incubated to occupy about 80% of the bottom area of the culture dish, and then washed with a buffer solution (Hank's balanced salt solution, pH 7.8), and the LPS was washed with 1 Treated at a concentration of μg / ml, then incubated at 37 ° C. for 30 minutes. Subsequently, the resultant was washed with electric buffer, immersed in an electric buffer solution containing 5 μM of DCF-DA (Molecular Probes, USA) at 37 ° C., and left for 5 minutes, and then adjusted to excitation at a wavelength of 488 nm. Laser scanning confocal microscope (Model LSM 510, Carl Zeiss, Germany) equipped with an LP505 radiation filter (Carl Zeiss, Germany) and a × 100 objective (Carl Zeiss, Germany) for selectively transmitting a gas, wavelengths of 515-540 nm Was observed using (see FIG. 3B). Figure 3b shows that HEK293T cells are simultaneously transformed with pSUPER-Nox4 and pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2 and pCMV-βgal, and then treated with LPS. Fluorescence micrograph showing changes in the degree of formation of H ₂ O ₂ . As shown in FIG. 3B, HEK293T cells were simultaneously transformed with pSUPER-Nox4 and pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2 and pCMV-βgal and then treated with LPS When the production of reactive oxygen species is inhibited, the generation of reactive oxygen species was increased by LPS in HEK293T cells transformed with only pSUPER vector itself.

Example 3-2-4 : Analysis of activation level of NF-κB by LPS treatment

When LPS was treated with HEPS293T cells cotransformed with pSUPER-Nox4 and pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2 and pCMV-βgal, Luciferase activity induced by

Transformation was performed in the same manner as in Example 3-2-2, and luciferase activity was measured in the same manner as in Example 1-3 (see Fig. 3c). FIG. 3C shows that HEK293T cells are simultaneously transformed with pSUPER-Nox4 and pNF-κB-Luc, pFLAG-CMV-TLR4, pFLAG-CMV-CD14, pFLAG-CMV-MD2 and pCMV-βgal, and then treated with LPS. It is a graph showing the result of measuring the relative activity of luciferase to beta-galactosidase activity. As shown in FIG. 3c, it was confirmed that the activation of NF-κB induced by LPS was inhibited by inhibiting the gene expression of Nox4 in accordance with the result of Example 3-2-3.

According to the results of Example 3, it was confirmed that when the expression of the Nox4 gene is suppressed, the generation of reactive oxygen species induced by LPS and the activation of NF-κB can be effectively suppressed.

As described and demonstrated in detail above, the present invention is introduced into the cell siRNA capable of complementary binding to the Nox4 gene, the production of reactive oxygen species induced by LPS in the cell comprising the step of inhibiting the expression of the Nox4 gene And methods of inhibiting activation of NF-κB. The method of inhibiting the generation of reactive oxygen species induced by LPS and activation of NF-κB in the cells of the present invention, overproduction and inflammation of harmful reactive oxygen species induced by LPS following Gram-negative bacteria infection By inhibiting the activation of NF-κB known as a factor, it will be widely used in the treatment of inflammation caused by bacterial infection.

<110> BAE, Yoon Soo <120> Method for Inhibiting Lipopolysaccharide-Induced Production of          Reactive Oxygen Species and Activation of NF-kappa B from Animal          Cell <160> 18 <170> KopatentIn 1.71 <210> 1 <211> 2416 <212> DNA <213> Homo sapiens <400> 1 tgagtgggca gagctgaccc ggtgcgggtg ggagtcaggg cgcccggaaa acccggctct 60 gggtagcaga ccccgcccgg gctggctcgg cgccgggcct tcgggcttcc actcagtctt 120 tgaccctcgg tcctcgctca gcggcccggc aggccgcaca actgtaaccg ctgccccggc 180 cgccgcccgc tccttctcgg gccggcgggc acagagcgca gcgcggcggg gccggcggca 240 tggctgtgtc ctggaggagc tggctcgcca acgaaggggt taaacacctc tgcctgttca 300 tctggctctc catgaatgtc ctgcttttct ggaaaacctt cttgctgtat aaccaagggc 360 cagagtatca ctacctccac cagatgttgg ggctaggatt gtgtctaagc agagcctcag 420 catctgttct taacctcaac tgcagcctta tccttttacc catgtgccga acactcttgg 480 cttacctccg aggatcacag aaggttccaa gcaggagaac caggagattg ttggataaaa 540 gcagaacatt ccatattacc tgtggtgtta ctatctgtat tttctcaggc gtgcatgtgg 600 ctgcccatct ggtgaatgcc ctcaacttct cagtgaatta cagtgaagac tttgttgaac 660 tgaatgcagc aagataccga gatgaggatc ctagaaaact tctcttcaca actgttcctg 720 gcctgacagg ggtctgcatg gtggtggtgc tattcctcat gatcacagcc tctacatatg 780 caataagagt ttctaactat gatatcttct ggtatactca taacctcttc tttgtcttct 840 acatgctgct gacgttgcat gtttcaggag ggctgctgaa gtatcaaact aatttagata 900 cccaccctcc cggctgcatc agtcttaacc gaaccagctc tcagaatatt tccttaccag 960 agtatttctc agaacatttt catgaacctt tccctgaagg attttcaaaa ccggcagagt 1020 ttacccagca caaatttgtg aagatttgta tggaagagcc cagattccaa gctaattttc 1080 cacagacttg gctttggatt tctggacctt tgtgcctgta ctgtgccgaa agactttaca 1140 ggtatatccg gagcaataag ccagtcacca tcatttcggt cataagtcat ccctcagatg 1200 tcatggaaat ccgaatggtc aaagaaaatt ttaaagcaag acctggtcag tatattactc 1260 tacattgtcc cagtgtatct gcattagaaa atcatccatt taccctcaca atgtgtccaa 1320 ctgaaaccaa agcaacattt ggggttcatc ttaaaatagt aggagactgg acagaacgat 1380 ttcgagattt actactgcct ccatctagtc aagactccga aattctgccc ttcattcaat 1440 ctagaaatta tcccaagctg tatattgatg gtccttttgg aagtccattt gaggaatcac 1500 tgaactatga ggtcagcctc tgcgtggctg gaggcattgg agtaactcca tttgcatcaa 1560 tactcaacac cctgttggat gactggaaac catacaagct tagaagacta tactttattt 1620 gggtatgcag agatatccag tccttccgtt ggtttgcaga tttactctgt atgttgcata 1680 acaagttttg gcaagagaac agacctgact atgtcaacat ccagctgtac ctcagtcaaa 1740 cagatgggat acagaagata attggagaaa aatatcatgc actgaattca agactgttta 1800 taggacgtcc tcggtggaaa cttttgtttg atgaaatagc aaaatataac agaggaaaaa 1860 cagttggtgt tttctgttgt ggacccaatt cactatccaa gactcttcat aaactgagta 1920 accagaacaa ctcatatggg acaagatttg aatacaataa agagtctttc agctgaaaac 1980 ttttgccatg aagcaggact ctaaagaagg aatgagtgca atttctaaga ctttgaaact 2040 cagcggaatc aatcagctgt gttatgccaa agaatagtaa ggttttctta tttatgatta 2100 tttaaaatgg aaatgtgaga atgtggcaag atgaccgtca cattacatgt ttaatctgga 2160 aaccaaagag accctgaaga atatttgatg tgatgattca cttttcagtt ctcaaattaa 2220 aagaaaactg ttagatgcac actgttgatt ttcatggtgg attcaagaac tccctagtga 2280 ggagctgaac ttgctcaatc taaggctgat tgtcgtgttc ctctttaaat tgtttttggt 2340 tgaacaaatg caagattgaa caaaattaaa aattcattga agctgaaaaa aaaaaaaaaa 2400 aaaaaaaaaa aaaaaa 2416 <210> 2 <211> 49 <212> RNA <213> Artificial Sequence <220> <223> siRNA for Nox4 <400> 2 gucaacaucc agcuguaccu ucaagagagg uacagcugga uguugacuu 49 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer for TLR4 <400> 3 ctagcggccg caggatgatg tctgcctcgc g 31 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Antisense Primer for TLR4 <400> 4 gtggtcgacc tcttcagata gatgttgc 28 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer for CD14 <400> 5 ctagcggccg catggagcgc gcgtcctgct tg 32 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Antisense Primer for CD14 <400> 6 gtggtcgaca tcttaggcaa agccccgg 28 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer for MD2 <400> 7 ctagcggccg catcatgtta ccatttctgt t 31 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Antisense Primer for MD2 <400> 8 gtggtcgaca ttctaatttg aattaggttg g 31 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer for Cloning of TLR4-C <400> 9 cgaattcgcc tttgtatcta ctcaag 26 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Antisense Primer for Cloning of TLR4-C <400> 10 cggcggccgc ttcctgccaa ttgcatcctg 30 <210> 11 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Hemagglutinin N-terminal Sequence <400> 11 Met Tyr Pro Tyr Asp Val Pro Asp Tyr Ala   1 5 10 <210> 12 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Sense Oligonucleotide for Hemagglutinin N-terminal <400> 12 gacctatgta cccctacgac gtgcccgact acgccg 36 <210> 13 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Antisense Oligonucleotide for Hemagglutinin N-terminal <400> 13 aattcggcgt agtcgggcac gtcgtagggg tacata 36 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer for Cloning of Nox4-C <400> 14 gcgaattcca tgaacctttc cctgaagg 28 <210> 15 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Antisense Primer for Cloning of Nox4-C <400> 15 gcgcggccgc tcatttattg tattcaaatc cttgt 35 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DNA Sequence Selected from Nox4 cDNA for Construction of siRNA          Expression Vector <400> 16 gtcaacatcc agctgtacc 19 <210> 17 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Sense Oligonucleotide for Construction of Nox4 siRNA Expression          Vector <400> 17 gatccccgtc aacatccagc tgtaccttca agagaggtac agctggatgt tgacttttta 60                                                                           60 <210> 18 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Antisense Oligonucleotide for Construction of Nox4 siRNA          Expression Vector <400> 18 agcttaaaaa gtcaacatcc agctgtacct ctcttgaagg tacagctgga tgttgacggg 60                                                                           60  

Claims (4)

An inflammatory therapeutic agent comprising a siRNA capable of complementary binding to Nox4 gene (SEQ ID NO: 1) or a vector expressing siRNA as an active ingredient and a pharmaceutically acceptable carrier. delete The method of claim 1, siRNA has a nucleotide sequence of SEQ ID NO: 2 characterized in that Inflammatory medications. The method of claim 1, The vector expressing siRNA is pSUPER-Nox4 having the gene map of Figure 3a Inflammatory medications.

Images