KR100924822B1 - Diagnosis Chip for Lung Cancer Using Lung Cancer Specific Methylation Marker Gene - Google Patents

Abstract

The present invention relates to a method for screening a lung cancer specific marker gene, a nucleic acid chip for lung cancer diagnosis using the screened gene, and more particularly, a method for screening a lung cancer specific marker gene in which a promoter region is specifically methylated in lung cancer transformed cells. In addition, the present invention relates to a nucleic acid chip for diagnosing lung cancer and lung cancer progression stage in which promoter methylation of the marker gene can be confirmed.

By using the diagnostic kit and the diagnostic nucleic acid chip of the present invention, lung cancer can be diagnosed at an early transformation stage, thereby enabling early diagnosis and diagnosing the progression of lung cancer and lung cancer more accurately and faster than conventional methods.

Lung cancer, methylation, methylation marker, lung cancer diagnosis, early diagnosis

Description

Diagnosis Chip for Lung Cancer Using Lung Cancer Specific Methylation Marker Gene}

The present invention relates to a method for screening a lung cancer specific marker gene, a nucleic acid chip for lung cancer diagnosis using the screened gene, and more particularly, a method for screening a lung cancer specific marker gene in which a promoter region is specifically methylated in lung cancer transformed cells. In addition, the present invention relates to a nucleic acid chip for diagnosing lung cancer and lung cancer progression stage in which promoter methylation of the marker gene can be confirmed.

In the past, lung cancer was a very rare tumor, but in the 20th century, smoking began to increase rapidly, becoming the most common malignant tumor in both men and women in the West, and in Korea, the second most common malignancy after lung cancer. The frequency is surprisingly increasing in women. The increase in the incidence of lung cancer is due to the increase in smoking, air pollution and industrial pollution.

Today, even in advanced medicine, cancer, especially the majority of solid tumors (other than blood cancers), has a five-year survival rate of less than 50%, and about two-thirds of all cancer patients are found at an advanced stage. Most of them die within two years of diagnosis. The treatment effect of such low cancer is not only a problem of treatment, but it is because it is not easy to diagnose the actual cancer early and to accurately diagnose the advanced cancer and follow-up after treatment.

Recently, genetic testing has been actively attempted to diagnose cancer. The typical method is PCR to find the presence or absence of the Abelson Murine Leukemia Viral Oncogene Homolog: Breakpoint cluster region (ABL: BCR) fusion gene in the blood. In addition, a method of diagnosing cancer cells coexisting in blood cells is also attempted by identifying the presence of genes expressed by cancer cells by RT-PCR and blotting. However, the method is applicable only to some cancers, such as prostate cancer and melanoma, has a high false positive rate, difficult standardization of test and reading methods, and its usefulness is limited (Kopreski, MS et al. , Clin. Cancer Res ., 5: 1961, 1999; Miyashiro, I. et al., Clin. Chem ., 47: 505, 2001). In recent years, genetic testing using DNA in serum or plasma has been actively attempted. Cancer can be diagnosed by analyzing cancer-specific gene abnormalities such as mutations, loss, and malfunction of oncogenes and tumor suppressor genes with DNA released from the cancer.

On the other hand, in lung cancer patients, a method for finding the presence of cancer cells and cancer genes present in sputum or bronchoalveolar lavage by genetic or antibody testing has been attempted (Palmisano, WA et al., Cancer Res. , 60: 5954, 2000; Sueoka, E. et al., Cancer Res ., 59: 1404, 1999). However, in order to accurately diagnose cancers with multiple gene abnormalities and various mutations, a method capable of simultaneously and accurately analyzing multiple genes is required, but such methods are not established yet.

Recently, methods for diagnosing cancer through DNA methylation measurement have been proposed. DNA methylation occurs mainly at the cytosine of CpG island of the promoter region of a specific gene, and thus transcription factor As the binding is interrupted, the expression of specific genes is blocked, and detection of methylation of the promoter CpG island of tumor suppressor genes is very helpful for cancer research, which is called methylation specific PCR (hereinafter referred to as MSP) or autobase. Attempts have recently been made to use tests such as analysis to diagnose and screen cancer.

Although methylation of the promoter CpG islands directly causes carcinogenesis or secondary changes in carcinogenesis, tumor suppressor genes, DNA repair genes, and cell cycle regulation in many cancers are controversial. It has been confirmed that expression of these genes is blocked due to hypermethylation of genes and the like, and it is well known that hypermethylation occurs at the promoter region of specific genes, particularly in the early stage of cancer development. Therefore, promoter methylation of tumor-related genes is an important indicator of cancer, which can be used in various fields such as diagnosis and early diagnosis of cancer, prediction of carcinogenic risk, prediction of cancer prognosis, follow-up follow-up, and response to chemotherapy. have. Attempts have recently been made to investigate the promoter methylation of tumor-related genes in blood, sputum, saliva, feces, and urine and use them in various cancer treatments (Esteller, M. et al., Cancer Res. , 59: 67, 1999; Sanchez-Cespedez, M. et al., Cancer Res ., 60: 892, 2000; Ahlquist, DA et al. , Gastroenterol. , 119: 1219, 2000).

Currently, lung cancer can only be diagnosed through various tests, and if there are any suspected lung cancer symptoms, chest imaging, microscopic examination, videooscopy, biopsy, and metastasis screening can be used to determine whether lung cancer is present. Judge the progress. However, the diagnostic method is not only expensive equipment, expensive, difficult to sample, but also unsuitable for the early diagnosis of lung cancer. Therefore, in the case of lung cancer, the 5 year survival rate of the first stage with tumor size less than 3 cm is about 70%, which is best to diagnose early when the lesion range is small. As a result, it is possible to develop a lung cancer specific biomarker for use in a new diagnostic method that is more efficient than conventional lung cancer diagnosis methods, that is, it is possible to diagnose early, process a large amount of samples, and have high sensitivity and specificity. There is a great demand.

Therefore, the present inventors have found that the colorectal cancer specific expression gene LAMA2 (Laminin merosin alpha 2), FABP4 (Fatty acid binding protein 4), GSTA2 (Glutathione S-transferase A2), STMN2 (Stathmin-like 2), NR4A2 (Nuclear receptor) subfamily 4, group A, member 2), Down syndrome critical region gene 1-like 1 (DSCR1L1), Alpha-2-macroglobulin (A2M), and methylated promoters of methylated promoters of SEPP1 (Selenoprotein P, plasma, 1) The invention has been filed and filed for array and cancer diagnostic kits (Korean Patent Application 10-2004-0076765).

Thus, the present inventors performed gene expression analysis in transformed cells in lung tissue clinical samples to effectively screen for methylation-related tumor suppressor genes that are methylated specifically in lung cancer tissues. From this, a list of genes with reduced expression in tumor tissue cells compared to normal cells was prepared. In addition, a list of genes that were expressed more in the cells treated with the dimethylating agent than in the tumor tissue (transformed) cells without the dimethylating agent was prepared. By comparing the two gene lists, a common gene list was selected as a methylation related gene promoter marker. By using the screened genetic markers, the degree of methylation was measured using actual clinical samples diagnosed with dysplasia, which is a stage of cancer and early cancer progression, so that these genetic markers can differentially diagnose tissue undergoing transformation into lung cancer and cancer cells. It was confirmed that the present invention was completed.

An object of the present invention is a lung cancer diagnostic kit comprising a primer for amplifying a fragment comprising a CpG island of the lung cancer marker gene in which the promoter site is specifically methylated in lung cancer transformed cells and an agent that sensitively cleaves non-methylated nucleic acids. To provide.

Another object of the present invention is to provide a nucleic acid chip for diagnosing lung cancer and lung cancer progression, comprising a fragment capable of hybridizing with a fragment comprising a CpG island of the lung cancer specific marker gene.

In order to achieve the above object, the present invention comprises the steps of (a) comparing the gene expression list of the transformed cells and non-transformed cells, identifying a gene whose expression is reduced in the transformed cells; (b) treating the transformed cells with a dimethylating agent, comparing the gene expression list of the transformed cells with the gene expression list of the transformed cells not treated with the dimethylating agent, thereby expressing more in the cells treated with the dimethylating agent. Identifying a gene; And (c) screening methylated marker genes capable of confirming cell transformation from normal cells to lung cancer cells, comprising selecting a gene identified in common in steps (a) and (b) as a methylation marker gene. Provide a method.

In the present invention, the sequence of the identified gene can be reviewed, and further comprising the step of excluding the gene without the CpG island in the promoter sequence, wherein the dimethylating agent is 5 aza 2'-deoxy C. It may be characterized as a didine (DAC).

In the present invention, by analyzing the methylation of the gene commonly identified in cells transformed with cancer, the step of identifying a gene identified as methylated marker gene, the promoter region of the commonly identified gene It can be characterized.

In the present invention, the methylation analysis of the identified gene comprises the steps of (a) preparing a primer comprising a methylation site in the nucleic acid region to be amplified; (b) treating the genome of the transformed cell with a methylation specific restriction endonuclease; And (c) amplifying the nucleic acid by contacting the primers with the treated genomic nucleic acid, but if no amplification product is produced, the identified gene is considered unmethylated, and if the amplification product is produced, the identification Characterized in that it is carried out by the step of selecting the gene as methylated.

In the present invention, the genome treated with isochizomer of methylation-sensitive restriction endonuclease in which the transformed cell genome cleaves both methylated and unmethylated CpG sites is used as a control. can do.

In the present invention, the production of the amplification product may be characterized by being performed by hybridization using a probe.

In the present invention, the probe may be characterized in that it is immobilized on a solid substrate.

In the present invention, amplification may be performed by a method selected from the group consisting of PCR, real-time PCR, amplification, and linear amplification using isothermal enzymes.

The present invention also provides a kit for diagnosing lung cancer or diagnosing lung cancer progression stage of a sample containing a primer for amplifying a marker gene screened by the method and an agent for sensitively cutting an unmethylated nucleic acid.

In the present invention, the agent for sensitively cutting the unmethylated nucleic acid may be characterized in that the methylation sensitive restriction endonucleases, the methylation sensitive restriction endonucleases are Msp I, Hpa II, Bss HII, Bst UI And Not I may be selected from the group consisting of.

The present invention also provides CDO1 (NM_001801, cAMP responsive element modulator); CREM (AB209533, cAMP responsive element modulator); FABP4 (CB999901, fatty acid binding protein 4, adipocytes, fatty acid binding protein 4, adipocyte); G0S2 (CD511787, G0 / G1 switch gene); HYAL1 (NM_007312, hyaluronglucosaminidase 1, hyaluronoglucosaminidase 1); LPXN (BC034230, loupesin, leupaxin); NFKBIA (BM908726, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha); RRAD (BC057815, Ras-related associated with diabetes); THBD (NM-000361, thrombomodulin); TNNC1 (CF553054, troponin C, slow); And TOM1 (AK097926, target of myb1, chicken); And a primer for amplifying a fragment comprising a CpG island of a lung cancer marker gene selected from the group consisting of a combination thereof and an agent for sensitively cutting non-methylated nucleic acids.

The present invention also provides CDO1 (NM_001801, cAMP responsive element modulator); CREM (AB209533, cAMP responsive element modulator); FABP4 (CB999901, fatty acid binding protein 4, adipocytes, fatty acid binding protein 4, adipocyte); G0S2 (CD511787, G0 / G1 switch gene); HYAL1 (NM_007312, hyaluronglucosaminidase 1, hyaluronoglucosaminidase 1); LPXN (BC034230, loupesin, leupaxin); NFKBIA (BM908726, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha); RRAD (BC057815, Ras-related associated with diabetes); THBD (NM-000361, thrombomodulin); TNNC1 (CF553054, troponin C, slow); And TOM1 (AK097926, target of myb1, chicken); Provided are a nucleic acid chip for diagnosing lung cancer and lung cancer progression, comprising a fragment capable of hybridizing with a fragment containing a CpG island of a lung cancer marker gene selected from the group consisting of a gene and a combination thereof.

The present invention provides a method for screening lung cancer specific marker genes, a kit for diagnosing lung cancer and lung cancer progression stage and a nucleic acid chip for diagnosing lung and lung cancer progression stage, which can diagnose methylation of CpG island of the screened lung cancer specific marker genes. There is. By using the diagnostic kit and the diagnostic nucleic acid chip of the present invention, lung cancer can be diagnosed at an early transformation stage, thereby enabling early diagnosis and diagnosing the progression of lung cancer and lung cancer more accurately and faster than conventional methods.

One aspect of the present invention relates to a method for screening a methylation marker gene capable of confirming cell transformation from normal cells to lung cancer cells.

In the present invention, marker genes that regulate the process of transforming normal cells into lung cancer cells in lung tissue by methylation were selected. The methylation marker gene may comprise (1) comparing the gene expression list of the transformed cell or cell line and the non-transformed cell or cell line, and sorting the list of genes that are more expressed in the non-transformed cell or cell line; (2) treating the transformed cell or cell line with a methylation inhibitor and sorting the list of genes that are more expressed in the transformed cell or cell line treated with the methylation inhibitor as compared to the untreated transformed cell or cell line; And (3) comparing gene lists obtained in steps (1) and (2) to identify marker gene candidates that are regulated by methylation in cells converting genes present in both lists to the transformed form in a non-transformed state. Screened by a method consisting of the steps considered.

As an additional method of identification, the sequence of the gene can be determined to confirm the presence of a CpG sequence, and biochemical analysis can be performed to determine whether the gene is substantially methylated.

The screening method can find genes that are methylated in various stages of dysplasia in lung cancer as well as lung cancer, and the selected genes can be screened for lung cancer, risk assessment, prediction, disease identification, diagnosis of disease stages, and treatment targets. Can also be used for selection of.

Identifying genes that are methylated in lung cancer and at various stages of abnormality enables accurate and effective early diagnosis of lung cancer and can identify new targets for establishing and treating methylation lists using multiple genes. In addition, methylation data according to the present invention will be able to establish a more accurate lung cancer diagnosis system in conjunction with other non-methylated associated biomarker detection methods.

With the methods of the present invention, one can diagnose the progression of lung cancer at various stages or stages, including determining the methylation stage of one or more nucleic acid biomarkers obtained from a sample. Comparing the methylation step of the nucleic acid isolated from the sample of each stage of lung cancer with the methylation step of one or more nucleic acids obtained from a sample having no cell proliferative abnormality of the lung tissue, the specific stage of lung cancer of the sample can be identified. The step may be hypermethylation.

In one example of the invention, the nucleic acid may be methylated at the regulatory site of a gene. As another example, since methylation starts from the outside of the regulatory region of the gene and proceeds to the inside, detection of methylation at the outside of the regulatory region enables early diagnosis of genes involved in cellular transformation.

As another example, in the present invention, by detecting the methylation state of one or more nucleic acids of the following examples using a kit or a nucleic acid chip, cell growth abnormality (dysplasia) of lung tissue present in the specimen can be diagnosed: CDO1 (cysteine) Deoxynase, type I, cysteine dioxygenase, type I); CREM (cAMP responsive element modulator); FABP4 (fatty acid binding protein 4, adipocytes); G0S2 (G0 / G1 switch gene); HYAL1 (hyaluronoglucosaminidase 1, hyaluronoglucosaminidase 1); LPXN (Lupesin, leupaxin); NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha); RRAD (Ras-related associated with diabetes); THBD (thrombomodulin); TNNC1 (troponin C, slow); TOM1 (target of myb1, chicken); Genes and combinations thereof.

Using the diagnostic kit or nucleic acid chip of the present invention, it is possible to determine the cell growth abnormality propensity (dysplasia progression) of the lung tissue of the specimen. The method includes determining the methylation status of one or more nucleic acids isolated from the sample, wherein the methylation step of the one or more nucleic acids is compared with the methylation step of the nucleic acid isolated from the sample without cell growth abnormality (dysplasia) of lung tissue. It can be characterized by.

Exemplary nucleic acids include CDO1 (cysteine dioxygenase, type I); CREM (cAMP responsive element modulator); FABP4 (fatty acid binding protein 4, adipocytes); G0S2 (G0 / G1 switch gene); HYAL1 (hyaluronoglucosaminidase 1, hyaluronoglucosaminidase 1); LPXN (Lupesin, leupaxin); NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha); RRAD (Ras-related associated with diabetes); THBD (thrombomodulin); TNNC1 (troponin C, slow); TOM1 (target of myb1, chicken); Genes and combinations thereof.

In another embodiment of the present invention, the methylation gene marker can be used for early diagnosis of tissues capable of forming lung cancer. If a gene identified to be methylated in cancer tissue is methylated in a tissue that appears clinically or morphologically normal, the tissue that appears to be normal is in progress of cancer. Therefore, lung cancer-specific genes in the tissues that appear to be identifiable confirm methylation, thereby enabling early diagnosis of lung cancer.

By using the methylation marker gene of the present invention, it is possible to detect cell growth abnormality (heterogeneous progression) of lung tissue in a specimen. The method includes contacting a sample comprising one or more nucleic acids isolated from a sample with an agent capable of determining one or more methylation states. The method includes identifying the methylation status of one or more sites in one or more nucleic acids, wherein the methylation status of the nucleic acid is determined by the methylation status of the same site in the nucleic acid of the sample that does not have cell growth potential abnormalities (progressive dysplasia) of lung tissue. It may be characterized by a difference.

In another aspect, the present invention provides a method for diagnosing high abnormality (high risk group dysplasia) of lung dysplasia containing a target-specific primer for amplifying a gene identified as the lung cancer specific methylation marker gene and an agent for sensitively cutting non-methylated nucleic acid. Provide the kit.

In a further aspect of the invention the kit comprises a first container containing a carrier means for partitioning a sample contained therein and an agent that sensitively cleaves unmethylated nucleic acids and a second containing a target-specific primer for amplification of the biomarker It may be characterized by including one or more containers including the container.

In another embodiment of the present invention, screening the marker gene, (1) comparing the gene expression list of the transformed cells and non-transformed cells, identifying a gene whose expression is reduced in the transformed cells; (2) Treating the transformed cells with a dimethylating agent, comparing the gene expression list of the transformed cells with the gene expression list of the transformed cells not treated with the dimethylating agent, thereby expressing more genes in the cells treated with the dimethylating agent. Confirming; And (3) screening a methylation marker gene capable of confirming the transformation from normal cells to lung cancer cells, comprising identifying the gene commonly identified in steps (1) and (2) with a methylation marker gene. Method can be used.

The method may further include identifying the sequence of the screened gene through the above steps and excluding a gene without a CpG island in the sequence of promoter and exon 1 from the screened genes. In the above method, the comparison may be performed by direct comparison or indirect comparison. The dimethylating agent may be 5 aza 3′-deoxycytidine (DAC). The method of identifying methylation marker genes in the industry includes analyzing methylation of the commonly identified genes in transformed cells, wherein methylation is present at the promoter region of the commonly identified genes, The gene confirms the marker gene.

 In another embodiment, the analysis of methylation of the commonly identified genes according to the method comprises the steps of: (i) identifying a primer comprising a methylation site within the amplified nucleic acid site, (ii) transforming with a methylation specific restriction endonuclease Processing the genome of the cell, and (iii) confirming that the amplification was successful by contacting the primers with the genomic nucleic acid to confirm that the gene was methylated, and that the amplification product was not produced. By confirming that the gene is not methylated.

As a control, the transformed cell genome can be treated with isochiomers of methylation sensitive restriction endonucleases that cleave both methylated and unmethylated CpG sites.

In another aspect, the present invention provides a nucleic acid chip for lung cancer and lung cancer advanced stage diagnosis comprising a fragment capable of hybridizing with a fragment comprising a CpG island of a marker gene that detects the presence of the amplified nucleic acid by hybridization. It is about.

Additionally, the amplification can be performed by PCR or real-time PCR, amplification using isothermal enzymes or linear amplification. Cell transformation can be detected early by detecting methylation outside the promoter.

In an embodiment of the present invention, transformed lung cancer cells can be identified by examining methylation of the marker gene using the kit or nucleic acid chip of the present invention.

In another embodiment of the present invention, the progression of lung cancer or lung cancer can be diagnosed by examining the methylation of the marker gene using the kit or nucleic acid chip of the present invention.

In another embodiment of the present invention, the possibility of progressing to lung cancer can be diagnosed by examining methylation of the marker gene using a kit or nucleic acid chip of the present invention using a sample showing a normal phenotype. The sample may use solid or liquid tissue, serum or plasma.

In another embodiment of the present invention, by examining the methylation frequency of the gene specifically methylated in lung cancer, and determining the methylation frequency of tissues with the possibility of lung cancer progression, the possibility of tissue development into lung cancer can be evaluated.

In the present invention, "dimethylation agents" include, but are not limited to, chemical agents or enzymes that remove methyl groups from nucleic acids or inhibit methylation from occurring.

Examples of such dimethylated agents include 5-azacytidine, 5-acza 2-deoxycytidine (DAC), arabinofuranosyl-5-azacytosine, 5-fluoro- 5-fluoro-2'-deoxycytidine, pyrimidone, trifluoromethyldeoxycytidine, pseudoisocytidine, dihydro-5-azasai As competitive inhibitors such as thydine, AdoHcy, AdoMet / AdoHcy analogs, sinefungin and analogs, SIBA (5'-deoxy-5'-S-isobutyladenosine), MTA (5'-methylthio-5 ' Drugs that affect levels of AdoMet, such as deoxyadenosine and ethionine analogs, methionine, L-cis-AMB, cycloleucine, antifolates, and methotre Low levels of AdoHcy hydrolase such as methotrexate, drugs that affect levels of AdoHcy, and dc-AdoMet and MTA Third, 3-deaza-adenosine, neplanocin A, 3-dezaneplanocin, 4'-thioadenosine, 3-deza-aristeromycin 3-deza-aristeromycin, ornithine synthetase inhibitors, inhibitors of DFMO (α-difluoromethylornithine), spermine and spermidine syntheses, MTA (S -Methyl-5'-methylthioadenosine), L-cis-AMB, AdoDATO, MGBG, methylthioadenosine phosphorylase inhibitor, DFMTA (difluoromethylthioadenosine), metanin, spermine / spermidine , Sodium butyrate, procainamide, hydralazine, dimethylsulfoxide, free radical DNA adduct, UV, 8-hydroxy guanine, N-methyl-N-nitrosourea (N-methyl N-nitrosourea, nobiobiocine, phenolbarnital, benzo [a] pyrene, ethylmethanesulfonate, ethylnitrosourea (et hylnitrosourea), N-ethyl-N'-nitro-N-nitrosoguanidine, 9-aminoacridine, nitrogen mustard, N-methyl-N-nitro-N-nitroso Guanidine, diethylnitrosamine, chlordene, N-acetoxy-N-2-acethylaminofluorene, aflatoxin B1, nalidixic acid ), N-2-fluorenylacetamine, 3-methyl-4 '-(dimethylamino) azobenzene, 1,3-bis (2-chloroethyl) -1-nitrosourea , Cyclophosphamide, 6-mercaptopurine, 4-nitroquinoline-1-oxide, N-nitrosodiethylamine, hexamethylenebisacetamide, rethonic acid, cAMP and retionic acid , Antisense mRNAs for aromatic hydrocarbon carcinogens, dibutyryl cAMP or methyltransferases (Zingg et. al ., Carcinogenesis , 18: 869, 1997).

As used herein, "cell transformation" is characterized from one form to another, such as from normal to abnormal, from non-tumor to tumorous, from undifferentiated to differentiation, from stem cells to non-stem cells. It means to change. Additionally, the transformation can be recognized by the morphology, phenotype, biochemical properties, etc. of the cell. There are many examples of the transformation of such cells, but the present invention relates to the presence of abnormal and cancerous cells in the lung, and the marker for transformation of the tissue is a marker for conversion to lung cancer cells.

In the present invention, the term "direct comparison" is used to competitively probe probes between differently labeled nucleic acids separated from one or more sources in order to confirm the correspondence of one type of differently labeled nucleic acid with another. To combine.

In the present invention, the possibility of cancer is discovered before the "early confirmation" of cancer, preferably, before morphological changes are observed in sample tissue or cells. In addition, “early identification” of cell transformation refers to the possibility of transformation occurring at an early stage before the cell is transformed.

"Hypermethylation" in the present invention means methylation of CpG islands.

In the present invention, "indirect comparison" evaluates the level of nucleic acid isolated from the first source and the same allele level in the nucleic acid isolated from the second source using a reference probe hybridized to the nucleic acid isolated from the first source and the second source, respectively. And comparing the results to determine the relative amount of nucleic acid present in the sample without competing direct binding to the reference probe.

In the present invention, "sample" or "sample sample" means a wide range of samples including all biological samples obtained from individuals, body fluids, cell lines, tissue cultures, etc., depending on the type of assay being performed. As indicated above, biological samples include semen, lymph, body fluids, serum plasma, and the like. Methods of obtaining bodily fluids and tissue biopsies from mammals are commonly known. Preferred source is biopsy of the lung.

As used herein, "near tumor tissue" or "paired tumor tissue" refers to tissue that exhibits clinical and morphologically normal phenotypes present in the vicinity of cancerous tissue sites.

Screening of Methylation Regulated Biomarkers

In the present invention, a biomarker gene that is methylated is screened when the cell or tissue is transformed or the cell is changed to another form. Here, "transformed" cells means that the normal form is abnormal, non-neoplastic is neoplastic, undifferentiated form is differentiated into different forms (Fig. 1). ).

Therefore, in the present invention, the methylation regulatory marker gene in the transformation into lung cancer cells was identified by a systematic method. In one aspect of the method, (1) comparing the gene expression list of the transformed lung cancer cells and non-transformed cells or cell lines, and sorting the list of genes that are more present in the non-transformed cells or cell lines; (2) Genes present in more of the transformed lung cancer cells or cell lines treated with methylation inhibitors as compared to transformed lung cancer cells or cell lines treated with methylation inhibitors and untreated transformed lung cancer cells or cell lines. Sorting the list; And (3) comparing the gene lists obtained in steps (1) and (2) to control genes present in both lists by methylation in the genome of cells that are converting to a transformed lung cancer cell form in a non-transformed state. And a method consisting of the step of considering it as a marker gene.

In addition to the above, a nucleic acid methylation detection assay is performed to further refine the biomarker candidate list and confirm that the biomarker candidate is indeed methylated under conversion conditions. Numerous methods are available for detecting the methylation in DNA fragments. As one non-limiting example, the following method can be used. Genomic DNA is treated with methylation sensitivity restriction enzymes and the methylation site is contacted with a probe having a gene sequence specific for the marker. If a site to which the uncleaved probe is bound is detected, it means that methylation has occurred at the site to which the probe is bound.

The method of practicing the present invention using microarray technology is described below.

(1) The transformed cell expression library and the non-converted cell expression library are fluorescently labeled differently, preferably with greenish Cy3 and redish Cy5. The labeled library is competitively coupled to a microarray to which a probe set of known genes is immobilized. Identify genes that are more expressed in nontransformed cells. Optionally, an indirect comparison method is performed.

(2) The transformed cell line is treated with a dimethylation agent and the expression library is labeled with a fluorescent label. In addition, an expression library labeled differently is obtained from a conversion cell line not treated with a dimethylating agent. The two libraries bind competitively to a microarray substrate to which a set of known gene probes is immobilized. Genes that are more expressed in transformed cells treated with dimethylation agents are identified. The genes will be reactivated in dimethylation conditions. Optionally, an indirect comparison method is performed.

(3) Compare genes identified from the two methods and select genes that are common to both lists.

In addition, comparison of gene expression between transformed and non-transformed cells and between cells treated with a dimethylating agent and untreated cells can be performed by direct competition of the probe set. Optionally, the comparison may be an indirect comparison. For example, the expressed gene can be independently bound to each probe set of known standard comparative RNAs. Therefore, the relative amounts of genes expressed from different cells can be indirectly compared. The probe set of the comparative RNA is optimized because it contains a complete set of expressed genes (FIG. 1).

(4) Check whether the CpG island is present in the nucleic acid sequence of the promoter region or exon 1 region of the gene. Genes with exons 1 or promoters without CpG islands are deleted from the list. It measures the methylation levels of the genes in the list, which can be used in various ways. In one embodiment of the invention, the genome of the transformed cells is treated with methylation sensitive restriction endonucleases and nucleic acid amplification is performed using several primers with methylation sites located in the region to be amplified. If the amplification was successful at the end of the nucleic acid amplification step, methylation occurred because the gene was not cleaved by methylation sensitive restriction endonucleases. Without the amplification product, methylation did not occur because the gene was cleaved by methylation sensitive endonucleases.

Biomarkers for Lung Cancer

The present invention provides a biomarker for diagnosing lung cancer.

Use of cancer cells for comparison with biomarker-normal cells for lung cancer

In this example, "normal" cells refers to cells that do not exhibit abnormal cell morphology or changes in cytological properties. A "tumor" cell refers to a cancer cell, and a "non-tumor" cell refers to a cell that is part of the diseased tissue but is not considered to be a tumor site.

The gene expression list of lung tumor cells was indirectly compared with the gene expression lists of non-tumor cells and tumor cells in the form of competitive hybridization of microarrays. The common list of reference genes was compared with the list of genes of non-tumor cells, such as tissues near tumors, and the common list of reference genes was compared with the list of tumor cell genes. Compared with non-tumor cells, genes that are inhibited in tumor cells were found and recorded as tumor suppressor genes.

Alternatively, the list of gene expressions obtained from tumor cells can be compared directly with non-tumor and / or normal cells in the form of microarray hybridization to obtain tumor suppressor genes. In addition, both the direct and indirect comparison methods can be used to find a fungal inhibitor gene.

Separately, lung cancer cell lines A549, NCI-H146 and NCI-H358 were treated with DAC, a dimethylating agent, and the reactivation of genes normally inhibited in tumor cells was analyzed. Genes that overlap in the tumor suppressor gene set and the dimethylated reactivation gene set were considered lung cancer biomarker gene candidates and 48 overlapping genes were found. It was confirmed by in silico analysis that the genes have essential CpG islands. Fifteen genes without CpG islands were found and excluded from the list. In addition, a biochemical test is needed to confirm that 33 remaining genes are actually methylated when isolated from tumor cells.

Methylation sensitive enzyme / nucleic acid sequence based amplification (NASBA) analysis, such as HpaII / MsPI enzyme cleavage / PCR (or post enzyme digestion-PCR), excluded 22 genes that were not methylated in lung cancer cell lines. In order to further confirm by biochemical methods whether the candidate gene is indeed methylated in tumor cells, bisulfite sequencing was performed and all 11 genes were identified as methylated.

A gene expression list of the 11 genes was prepared. Expression levels of the 11 genes were measured in tumors and non-tumor tissues near the tumors. The degree of methylation of the gene was also determined using methylation sensitive enzyme / nucleic acid sequence based amplification (NASBA) analysis, such as HpaII / MsPI enzyme cleavage / PCR (or post-enzyme digestion-PCR) in clinical samples, as identified above. The genes were not methylated in normal cells. However, they were methylated in tumor cells as well as near tumor tumors. 5 and 6 further show that tumor cells are methylated more frequently than tissues near tumors.

 One aspect of the invention is based on the discovery of the association between lung cancer and promoter hypermethylation of the 11 genes described below: CDO1 (cysteine dioxygenase, type I); CREM (cAMP responsive element modulator); FABP4 (fatty acid binding protein 4, adipocytes); G0S2 (G0 / G1 switch gene); HYAL1 (hyaluronoglucosaminidase 1, hyaluronoglucosaminidase 1); LPXN (Lupesin, leupaxin); NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha); RRAD (Ras-related associated with diabetes); THBD (thrombomodulin); TNNC1 (troponin C, slow); TOM1 (target of myb1, chicken); gene.

In another use of the diagnostic nucleic acid chip of the present invention, the methylation step of one or more nucleic acids isolated from a sample may be determined to early diagnose cell abnormalities in lung tissue of the sample. The methylation step of the one or more nucleic acids may be compared with the methylation status of one or more nucleic acids isolated from a specimen that does not have cell growth potential of lung tissue. The nucleic acid is preferably a CpG-containing nucleic acid such as a CpG island.

In another use of the diagnostic nucleic acid chip of the present invention, one can diagnose abnormalities in cell growth of lung tissue of a sample comprising determining methylation of one or more nucleic acids isolated from the sample. The nucleic acid may be selected from CDO1 (cysteine dioxygenase, type I); CREM (cAMP responsive element modulator); FABP4 (fatty acid binding protein 4, adipocytes); G0S2 (G0 / G1 switch gene); HYAL1 (hyaluronoglucosaminidase 1, hyaluronoglucosaminidase 1); LPXN (Lupesin, leupaxin); NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha); RRAD (Ras-related associated with diabetes); THBD (thrombomodulin); TNNC1 (troponin C, slow); TOM1 (target of myb1, chicken); And encoding the gene and combinations thereof, wherein the methylation step of the one or more nucleic acids is compared with the methylation status of the one or more nucleic acids isolated from a sample that does not have a predisposition for abnormal cell growth of lung tissue. You can do

The term "prescription" means a property prone to abnormal cell growth. A cultivated sample does not yet have cell growth abnormalities, but refers to a sample in which cell growth abnormalities exist or have increased.

Another aspect of the invention involves contacting a sample comprising a nucleic acid of a sample with an agent capable of determining the methylation status of the sample and confirming methylation of one or more sites of one or more nucleic acids, wherein the cell growth abnormality of the lung tissue of the sample is determined. It provides a way to diagnose. Here, the methylation of one or more sites of one or more nucleic acids can be characterized as different from the methylation step of the same site of the same nucleic acid of a sample having no cell growth potential.

The methods of the present invention comprise determining methylation of one or more sites of one or more nucleic acids isolated from a sample. Here, "nucleic acid" or "nucleic acid sequence" means oligonucleotides, nucleotides, polynucleotides or fragments thereof, single stranded or double stranded genomic origin or synthetic genomic origin or synthesis of DNA or RNA, sense or antisense strands. Refers to DNA or RNA of origin, peptide nucleic acid (PNA) or DNA amount or RNA quantity material of natural or synthetic origin. If the nucleic acid is RNA, it is apparent to those skilled in the art that, instead of deoxynucleotides A, G, C, and T, it is replaced with ribonucleotides A, G, C, and U, respectively.

Any nucleic acid capable of detecting the presence of differently methylated CpG islands can be used. The CpG island is a CpG rich site in the nucleic acid sequence. The nucleic acid includes, for example, a sequence encoding the following gene (denoted GenBank Acession Number):

1. CDO1 (NT_0347); Cysteine dioxygenase, type I

Amplicon Size: 205bp

ctcaattttcgcaggctcctcacaattctctatttggaagaagtgtccctctccttcccttttcttttcctcctttactcagcgtcagtccccgcagccatctcctccgaccctttttgtctacgtcccagcgtcgcgaaccacagcggcggaggtggagcggggagaggcgttagg ccggcccc

CDO1-F: 5'-ctcaattttc gcaggctcct ca (SEQ ID NO: 2)

CDO1-R: 5'-actttaacgg cgcgttttag cc (SEQ ID NO: 3)

2. CREM (NT_0087); cAMP responsive element modulator

Amplicon Size: 245bp

accagctgtgactggctgtgaatatggaggaaaagggccactagtcaaggtatgtagatagcttttagaagtcagaagaagcacgcctgcagtcccagctactcaggaggctgagg ccgg aggatcgcttgagcctggggagatagaggttgcagagagccgagaccacgccactgacagtgt

MTPN-F: 5'-accagctgtg actggctgtg aa (SEQ ID NO: 5)

MTPN-R: 5'-gtttcttcct aacgccgcca ac (SEQ ID NO: 6)

3. FABP4 (NT_0081); Fatty acid binding protein 4, adipocyte

Amplicon Size: 1,018 bp

ccgg taatgaaggaaatgattggatctcattcccaattggtcattcctaagatcacatgttctgagcatctttaaaaggaagttatctggactcaagagggtcaca gcaccctcctgaaaactgcagc (SEQ ID NO: 7)

MTSS1-F: 5'-ggatacacag tgtagcgatg ca (SEQ ID NO: 8)

MTSS1-R: 5'-gctgcagttt tcaggagggt g (SEQ ID NO: 9)

4. G0S2 (NT_0218); G0 / G1 switch gene

Amplicon Size: 205 bp

gtcctggacaagggaagctgtgcacccgctgacaccagtaagaaggttgccgccatgtcagagatgtccgcggacacctccctgggct ccgg gtcctcccctgcgctcgcctggagtgggaccttcgcgtgcacactggccttcccacgcgccccgctgcgatggcacccgcg ccgg gccccctagctcacacagtcggagcgtg (SEQ ID NO: 10)

PELI2-F: 5'-gtcctggaca agggaagctg tg (SEQ ID NO: 11)

PELI2-R: 5'-cacgctccga ctgtgtgagc ta (SEQ ID NO: 12)

5. HYAL1 (NT_0225); Hyaluronoglucosaminidase 1

Amplicon Size: 215 bp

tgcagacggagtctctcaatggtgcccaggctggagtgcagtggcgtgatctcggctcgctacaacatccacctcccagcagcctgccttggcctcccaaagtgccgagattgcagcctctgc ccgg ccgccaccccgtctgggaagtgaggagcgtctgtgccgtgccccccgtgcccccc

PLEKHF2-F: 5'-tgcagacgga gtctctcaat gg (SEQ ID NO: 14)

PLEKHF2-R: 5'-actgggcagc caggcag (SEQ ID NO: 15)

6. LPXN (NT_0339); Lupesin (Leupaxin)

Amplicon Size: 244 bp

acttggatgcggtgcctgacctagagggaggcgaaagggttgtgagcgtgacatgactggtgacctacaccgagaagctgaagggtctcttaagctctgcgg ccgg aagccatctgcttctgcggtttatacaatagcaactttatcagaggttacttttctgcacgctagcgcttttgtgtaaaggtggt

RERG-F: 5'-acttggatgc ggtgcctgac (SEQ ID NO: 17)

RERG-R: 5'-agaggcccac tgcatcacca (SEQ ID NO: 18)

7. NFKBIA (NT_0264); Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha

Amplicon Size: 187 bp

aaagagggaccgcccatcaggtcggcgtccttgggatctcagcagccgacgaccccaattcaaatcgatcgtgggaaaccccagggaaagaaggctcacttgcagagggacaggattacagggtgcaggctgcagggaagta ccgg ggggagggggcctggtcggaaggactttccagccactcggc (sequence number)

THBD-F: 5'-aaagagggac cgcccatcag (SEQ ID NO: 20)

THBD-R: 5'-gccgagtggc tggaaagtcc (SEQ ID NO: 21)

8. RRAD (NT_0104); Ras-related associated with diabetes

Amplicon Size: 206 bp

tcagtctcacggggccagaccgaattcttctccagagggcagttgctgcttttggctgattgggtttaccccgctgcctgcctccccatcacgtactccccccgcaacctcgctctctctctccttctcacacacaccctcagct ccgg acctcgccta ccgg tcagcccccctattcccagacagctaccgcgact

TP53INP1-F: 5'-tcagtctcac ggggccagac (SEQ ID NO: 23)

TP53INP1-R: 5'-cgccagggga gtagcggtag (SEQ ID NO: 24)

9. THBD (NT_0113); Thrombomodulin

Amplicon Size: 194 bp

cccccactccccattcaaagccctcttctctgaagtct ccgg ttcccagagctcttgcaatccaggctttccttggaagtggctgtaacatgtatgaaaagaaagaaaggaggaccaagagatgaaagagggctgcacgcgtgggggcccgagtggtgggcggggacagtcgtcttgttacaggggtgctggcc

MGC11324-F: 5'-cccccactcc ccattcaaag (SEQ ID NO: 26)

MGC11324-R: 5'-ggccagcacc cctgtaacaa (SEQ ID NO: 27)

10. TNNC1 (NT_0225); Troponin C, slow

Amplicon Size: 206 bp

atcttggccccgccttcttcctgcgccctcgccccgcccccgcgcgtgactgacaggggccactcagggcgcgcgtgcgaggtgctcgcttgcgtaatctacctgcgtggcgccg ccgg cggtaccctgcacagcctgctagaaactgagacc ccgg gtggtgacagctctgggcatcgcc

ZFHX1B-F: 5'-atcttggccc cgccttcttc (SEQ ID NO: 29)

ZFHX1B-R: 5'-tgtcccctct tcccgaggac (SEQ ID NO: 30)

11.TOM1 (NT_0115); target of myb1 (chicken)

  Amplicon size; 250 bp

tcttggagcggggagaccttgacatcaaacaggaagagtctta ccgg gacaaggagacaacagcccagagaggctgtcacccagggtaggtgtgcagtcacagtgaggtcccaaggactaagggctatgaccctaagagtctcggcttctgtgtaactcacccagttc

Forward; 5'-tcttggagcg gggagacctt (SEQ ID NO: 32)

Reverse; 5'-taagccacgc ccctgacctt (SEQ ID NO: 33)

"Ccgg" underlined above means methylated site and is also the site recognized by methylation sensitive restriction enzyme HpaII.

Methylaton

Any nucleic acid in the purified or unpurified form of the present invention may be used, and any nucleic acid containing or suspected of containing a nucleic acid sequence containing a target site (eg, a CpG-containing nucleic acid) may be used. have. A nucleic acid site that can be differentially methylated is a CpG island, which is a nucleic acid sequence having a high CpG density compared to other dinucleotide CpG nucleic acid sites. Doublet CpG is only 20% probable in vertebrate DNA when predicted by the ratio of G * C base pairs. At certain sites, the density of double CpG is ten times higher than at other sites in the genome. CpG islands have an average G * C ratio of about 60%, with the average DNA G * C ratio of 40%. CpG islands are typically about 1 to 2 kb in length and there are about 45,000 CpG islands in the human genome.

In many genes, CpG islands start upstream of the promoter and extend to the transcriptional site downstream. Methylation of CpG islands in promoters usually inhibits expression of genes. CpG islands may also surround the 3 'region of the gene coding region, as well as the 5' region of the gene coding region. Therefore, CpG islands are found at several sites, including upstream of a coding sequence of a regulatory region comprising a promoter region, a coding region (eg exon region), downstream of a coding region, eg, an enhancer region and an intron. .

Typically, the CpG-containing nucleic acid is DNA. However, the method of the present invention may apply for example a sample containing DNA or RNA containing DNA and mRNA, wherein the DNA or RNA may be single stranded or double stranded, or DNA-RNA hybrids. It may be characterized by the contained sample.

Nucleic acid mixtures may also be used. The specific nucleic acid sequence to be detected may be a fraction of a large molecule, and from the beginning the specific sequence may exist in the form of isolated molecules that make up the entire nucleic acid sequence. The nucleic acid sequence need not be a nucleic acid present in pure form, and the nucleic acid may be a small fraction in a complex mixture, such as containing whole human DNA. Nucleic acids included in the sample used to measure the degree of methylation of nucleic acids contained in the sample or used to detect methylated CpG islands are described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY., 1989). It can be extracted by various methods described in.

The nucleic acid may comprise a regulatory site, which is a DNA site that encodes information or regulates transcription of the nucleic acid. The regulatory site comprises at least one promoter. A "promoter" is the minimum sequence necessary to direct transcription and can regulate inducibility by cell type specific, tissue specific or external signal or agent in a promoter-dependent gene. The promoter is located at the 5 'or 3' site of the gene. Nucleic acid numbers of all or part of a promoter site can be applied to measure methylation of CpG island sites. Methylation of the target gene promoter proceeds from outside to inside. Therefore, the early stages of cell turnover can be detected by analyzing methylation outside of the promoter region.

The nucleic acid isolated from the sample is obtained by biological sample of the sample. If you want to diagnose lung cancer or the progression of lung cancer, the nucleic acid should be separated from the lung tissue by scrap or biopsy. Such samples may be obtained by various medical procedures known in the art.

In one embodiment of the invention, the degree of methylation of the nucleic acid of the sample obtained from the sample is measured in comparison to the same nucleic acid portion of the sample without cell growth abnormality of the lung tissue. Hypermethylation refers to the presence of methylated alleles in one or more nucleic acids. Samples without cell growth abnormality in lung tissues do not show methylation alleles when the same nucleic acid is tested.

Sample

The present invention describes early identification of lung cancer and utilizes lung cancer specific gene methylation. Methylation of lung cancer specific genes also occurred in tissues near the tumor site. Therefore, the early identification method of lung cancer can confirm the presence or absence of methylation of lung cancer-specific genes in all samples including liquid or solid tissue. The sample includes, but is not limited to, serum or plasma.

Individual genes and panels

The present invention can be used individually as a diagnostic or predictive marker, or a combination of several marker genes in the form of a panel display, and several marker genes can be used to improve reliability and efficiency through an overall pattern or a list of methylated genes. It can confirm that it improves. The genes identified in the present invention can be used individually or as a gene set in which the genes mentioned in this example are combined. Alternatively, genes can be ranked, weighted, and selected for the level of likelihood of developing cancer according to the number and importance of the genes methylated together. Such algorithms belong to the present invention.

Methylation Detection Method

Detection of Differential Methylation—Methylation Sensitivity Restriction Endonuclease

Detection of differential methylation can be accomplished by contacting the nucleic acid sample with a methylation sensitive restriction endonuclease that cleaves only unmethylated CpG sites.

In a separate reaction, the samples were contacted with isochimers of methylation sensitive restriction endonucleases that cleave both methylated and unmethylated CpG sites, thereby cleaving the methylated nucleic acids.

Specific primers were added to the nucleic acid sample and the nucleic acid was amplified by conventional methods. If there is an amplification product in the sample treated with methylation sensitive restriction endonuclease, and there is no amplification product in the isomerized sample of methylation sensitive restriction endonuclease that cleaves both methylated and unmethylated CpG sites , Methylation occurred in the analyzed nucleic acid site. However, no amplification products were present in the samples treated with methylation sensitive restriction endonucleases, and the amplification products were also found in the samples treated with isosomeomers of methylation sensitive restriction endonucleases that cleave both methylated and unmethylated CpG sites. Existence means that no methylation occurs in the analyzed nucleic acid site.

Here, "methylation sensitive restriction endonuclease" is a restriction enzyme that contains CG at the recognition site and has activity when C is methylated compared to when C is not methylated (eg, SmaI). Non-limiting examples of methylation sensitivity limiting endonucleases include Msp I, Hpa II, Bss HII, Bst UI and Not I. The enzymes may be used alone or in combination. Other methylation sensitivity limiting endonucleotides include, but are not limited to, for example, SacII and EagI.

Isochimers of methylation sensitive restriction endonucleases are restriction endonucleases that have the same recognition site as methylation sensitive restriction endonucleases, but cleave both methylated and unmethylated CGs, e.g., Msp. I can be mentioned.

The primers of the present invention are designed to have "alternatively" complementarity with each strand of the locus to be amplified and, as described above, include the appropriate G or C nucleotides. This means that the primers have sufficient complementarity to hybridize with the corresponding nucleic acid strands under the conditions for carrying out the polymerization. The primer of the present invention is used in the amplification process, which is an enzymatic continuous reaction in which the target locus, such as PCR, increases to an exponential number through many reaction steps. Typically, one primer (antisense primer) has homology to the negative (-) strand of the locus, and the other primer (sense primer) has homology to the positive (+) strand. When primers are annealed to the denatured nucleic acid, the chain is stretched by enzymes and reactants such as DNA polymerase I (Klenow) and nucleotides, resulting in newly synthesized + and-strands containing the target locus sequence. The newly synthesized target locus is also used as a template, so that the cycle of denaturation, primer annealing and chain extension is exponentially synthesized. The product of the continuous reaction is an independent double stranded nucleic acid having an end corresponding to the end of the specific primer used in the reaction.

The amplification reaction is preferably a PCR that is commonly used in the art. However, alternative methods such as real-time PCR or linear amplification with isothermal enzymes can also be used, and multiplex amplification reactions can also be used.

Detection of Differential Methylation-Bisulfite Sequencing Method

Other methods of detecting nucleic acids containing methylated CpG include contacting a sample containing nucleic acid with an agent that modifies unmethylated cytosine and amplifying the CpG-containing nucleic acid of the sample using CpG-specific oligonucleotide primers. It includes. Here, the oligonucleotide primer may be characterized by detecting the methylated nucleic acid by distinguishing the modified methylated and unmethylated nucleic acid. The amplification step is optional and desirable but not necessary. The method relies on a PCR reaction that distinguishes between modified (eg, chemically modified) methylated and unmethylated DNA. Such methods are disclosed in US Pat. No. 5,786,146, which is described in connection with bisulfite sequencing for the detection of methylated nucleic acids.

temperament

Once the target nucleic acid site is amplified, the nucleic acid amplification product can be hybridized with a known gene probe immobilized on a solid support (substrate) to detect the presence of the nucleic acid sequence.

Here, a "substrate" is a mixture means comprising a substance, structure, surface or material, abiotic, synthetic, inanimate, planar, spherical or specific binding, flat surface material, hybridization or enzyme recognition site Or many other recognition sites beyond many other recognition sites or many other molecular species composed of surfaces, structures or materials. Such substrates include, for example, semiconductors, (organic) synthetic metals, synthetic semiconductors, insulators and dopants; Metals, alloys, elements, compounds and minerals; Synthesized, degraded, etched, lithographic, printed and microfabricated slides, devices, structures and surfaces; Industrial, polymers, plastics, membranes, silicones, silicates, glass, metals and ceramics; Wood, paper, cardboard, cotton, wool, cloth, woven and non-woven fibers, materials and fabrics, but are not limited to these.

Some types of membranes are known in the art to have adhesion to nucleic acid sequences. Specific and non-limiting examples of such membranes include membranes for gene expression detection, such as nitrocellulose or polyvinylchloride, diaotized paper and commercially available membranes such as GENESCREENTM, ZETAPROBETM (Biorad) and NYTRANTM. have. Beads, glass, wafers and metal substrates are also included. Methods of attaching nucleic acids to such objects are well known in the art. Alternatively, screening can also be performed in the liquid phase.

Hybridization conditions

In nucleic acid hybridization reactions, the conditions used to achieve stringent specific levels vary depending on the nature of the nucleic acid being hybridized. For example, the length of the nucleic acid region to be hybridized, degree of homology, nucleotide sequence composition (eg, GC / AT composition ratio), and nucleic acid type (eg, RNA, DNA) select hybridization conditions. Is considered. An additional consideration is whether the nucleic acid is immobilized, for example in a filter or the like.

Examples of very stringent conditions are as follows: 2X SSC / 0.1% SDS at room temperature (hybridization conditions); 0.2XSSC / 0.1% SDS at room temperature (low stringency conditions); 0.2XSSC / 0.1% SDS at 42 ° C. (conditions with moderate stringency); 0.1X SSC at 68 ° C. conditions with high stringency. The washing process can be carried out using one of these conditions, for example, conditions having a high stringency, or each of the above conditions can be used, and each of the conditions described above in each of 10 to 15 minutes in the order described above. Or some iterations. However, as described above, the optimum conditions vary with the particular hybridization reaction involved and can be determined experimentally. In general, conditions of high stringency are used for hybridization of critical probes.

Label

Important probes are labeled so that they can be detected, for example, with radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Proper labeling of such probes is a technique well known in the art and can be carried out by conventional methods.

Kit

According to one aspect of the present invention, there is provided a kit useful for detecting a cell growth abnormality of a specimen. Kits of the invention include a compartmentalized carrier means for holding a sample, a first container containing an agent that sensitively cleaves unmethylated cytosine, a second container containing a primer for amplifying a CpG containing nucleic acid, and a cleaved or uncleaved nucleic acid. One or more containers including a third container containing means for detecting the presence. Primers used in accordance with the present invention include the sequences set forth in SEQ ID NOS: 1-33, functional combinations, and fragments thereof. Functional combinations or fragments are used as primers to detect whether methylation has occurred on the genome.

The carrier means is suitable for containing one or more containers, such as bottles, tubes, each container containing independent components used in the method of the invention. In the context of the present invention, one of ordinary skill in the art can readily dispense the required formulation in the container. For example, a vessel containing methylation sensitive restriction endonucleases can be configured as one vessel. One or more containers may contain primers that have homology with important nucleic acid locus. In addition, one or more of the containers may contain isoxisomers of methylation sensitive restriction enzymes.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example 1 Identification of Genes Inhibited in Lung Cancer

To identify genes that are inhibited in lung cancer, microarray hybridization was performed. Microarray hybridization was performed using standard protocols (Schena et al ., Science , 270: 467, 1995). Tissues near the tumor and tumor tissue were isolated from the lung cancer patients in pairs and total RNA was isolated therefrom. In order to indirectly compare the relative differences in gene expression levels of the paired tumor surrounding tissues and tumor tissues, standard comparative RNAs (indirect comparisons) were constructed. To prepare a standard comparative RNA, lung cancer cell line A549 (Korea Cell Line Bank (KCLB) 10185), gastric cancer cell line AGS (KCLB 21739), kidney cancer cell line Caki-2 (KCLB 30047), colon cancer cell line HCT116 (KCLB 10247), cervical cancer Cell line Hela (KCLB 10002), blood cancer cell line HK-60 (KCLB 10240), HT1080 (KCLB 10121), breast cancer cell line MDA-MB2 (KCLB 30026), liver cancer cell line SK-hep1 (KCLB 30052) and T cell derived cell line Molt- Total RNA was isolated from 11 human cancer cell lines of 4 (KCLB 21582), brain cancer cell line U-87MG (KCLB 30014). Total RNA from cell lines and lung tissues was isolated using Tri Reagent (Sigma, USA). To prepare standard comparative RNAs, total RNA isolated from 11 cell lines were mixed in equal amounts. The standard comparative RNA was used as an internal control. In order to compare relative gene expression levels of the paired near-tumor and tumor tissues, RNAs isolated from non-tumor and tumor tissues were compared indirectly with standard RNA. 100 μg of total RNA was labeled with Cy3-dUTP or Cy5-dUTP. The standard RNA was labeled with Cy3, and RNA isolated from lung tissue was labeled with Cy5. The two cDNAs labeled with Cy3- and Cy5- were purified using a PCR purification kit (Qiagen, Germany). Purified cDNA was mixed and concentrated to a final volume of 27 μl using Microcon YM-30 (Millipore Corp., USA).

A total of 80 μl of the hybridization reaction solution included: 27 μl of labeled cDNA target, 20 μl of 20X SSC, 8 μl of 1% SDS, 24 μl of formamide (Sigma, USA) and 20 μg of human Cot1 DNA (Invitrogen Corp. , USA). The hybridization reaction solution was heated at 100 ° C. for 2 minutes and immediately hybridized to a human 22K oligonucleotide (GenomicTree, Inc., Korea) microarray. The hybridization was performed for 12-16 hours at 42 ℃ in HybChamber X (GenomicTree, Inc., Korea) humidity-controlled. After hybridization, the microarray slides were read using Axon 4000B (Axon Instrument Inc., USA). Signal and background fluorescence intensities were measured for each probe by averaging the intensity of all the pixels inside the target site using GenePix Pro 4.0 software (Axon Instrument Inc., USA). Spots showing obvious abnormalities were excluded from the analysis. All data were subjected to normalization, statistical analysis and cluster analysis using GeneSpring 7.2 (Agilent, USA).

To determine the relative differences in gene expression levels of non-tumor and tumor tissues, statistical analysis for indirect comparison (ANOVA, p <0.05) was performed. From the results of the statistical analysis, it was confirmed that all of the 1047 genes were down regulated (tumor regulated) in tumor tissues as compared to the tissues near the paired tumors (FIG. 1).

Example 2. Confirmation of Methylation Regulator Gene Expression

To confirm whether the expression of the gene identified in Example 1 is regulated by promoter methylation, a dimethylating agent in lung cancer cell lines A549 (KCLB 10185), NCI-H146 (KCLB 30173) and NCI-H358 (KCLB 25807), 5 Aza-2-deoxycytidine (DAC, Sigma, USA) was treated for 3 days at 200 nM concentration. Untreated cell lines and treated cell lines were treated with Tri reagent to separate total RNA. To determine gene expression changes by DAC treatment, the level of transcription was directly compared between untreated and treated cell lines. As a result, 767 genes with increased expression were identified when the DAC was treated, compared to the control without the DAC. Comparing the list of 1047 tumor suppressor genes obtained in Example 1 and the genes re-expressed by 767 dimethylation, 48 common genes were found (FIG. 1).

Example 3. Methylation Structure of Identified Genes

(1) In silico analysis of promoter site CpG islands

MethPrimer (http://itsa.ucsf.edu/~urolab/methprimer/index1.html) was used to find the presence of CpG islands at the promoter regions of the 48 genes. 15 of the 48 genes did not have CpG islands and the 15 genes were excluded from the list of common genes.

(2) Biochemical Analysis of Methylation

To biochemically confirm the methylation status of the remaining 33 genes, the restriction enzymes HpaII (methylation-sensitive) and MspI (methylation-insensitive) were treated, followed by PCR to detect the methylation status of each promoter (Fig. 2).

The two enzymes identically recognize the 5'-CCGG-3 'sequence. HpaII does not show activity when the internal cytosine residues are methylated, whereas MspI is not affected by methylation of the internal cytosine residues. If the cytosine residues of the CpG site are not methylated, both types of enzymes can cleave the target sequence. To determine the methylation status of a particular gene, a PCR target was selected that has one or more HpaII sites on the CpG island of the promoter region. 100 ng of genomic DNA isolated from A549 (KCLB 10185), NCI-H146 (KCLB 30173) and NCI-H358 (KCLB 25807) were treated with 5 U HpaII and 10 U MspI, respectively, and purified by Quiagen PCR purification kit. Specific primers were used to amplify important sites. The purified genomic DNA 5ng was amplified by PCR using a set of gene-specific primers. The PCR reaction was carried out for 30 cycles by treating one minute at 94 ° C., one minute at 66 ° C., and one minute at 72 ° C., and finally extended at 72 ° C. for 10 minutes. Each amplification product was run on a 2% agarose gel containing ethidium bromide. If the band density of the HpaII treated product was greater than 1.5 times greater than the MspII treated product, the target site was considered methylated, and if the band density of the HpaII treated product was less than 1.5 times untreated. As a result, 22 of the 33 genes were unmethylated, down-regulated in tumor tissues, up-regulated in dimethylation conditions, containing CpG islands in the promoter, and in cancer cell lines. Only 11 candidate genes were left that met the conditions that were substantially methylated (FIG. 3).

(3) bisulfite sequencing of methylated promoters

To further confirm the methylation status of the 11 genes, bisulfite sequencing of each promoter was performed. Treatment of DNA with bisulfite leaves unmethylated cytosine modified with uracil and methylated cytosine remains unchanged. The bisulfite modification was performed by the method of Sato et al . (Sato et al ., Cancer Research , 63: 3735, 2003). 1 μg of genomic DNA of lung cancer cell lines A549, NCI-H146, and NCI-H358 were treated with bisulfite using a methylation-specific PCR (MSP) bisulfite modification kit (In2Gen, Inc., Korea). The bisulfite treated A549, NCI-H146, and NCI-H358 genomic DNA were amplified by PCR, and then sequenced by PCR product. As a result, it was confirmed that all of the above genes were methylated.

Example 4. Reactivation of 11 Identified Genes by Dimethylating Agent Treatment

4 shows reactivation of the 11 genes identified. As shown in Figure 4, it can be seen that the gene expression is reactivated compared to the lung cancer cells not treated in lung cancer cells treated with dimethylation preparation (DAC).

Example 5 Promoter Methylation Assay in Clinical Samples

To confirm the clinical applicability of the methylated promoters of the 11 genes selected in the present invention, methylation assays were performed using clinical samples of normal tissue, near tumor and early lung cancer tissue from non-patients. Methylation assays were performed by the methods described in the examples above, using restriction enzyme / PCR methods.

5 and 6 show the consolidation of the methylation assay for early lung cancer, in which no gene methylation occurred in normal tissues obtained from normal samples (Biochain). However, methylation occurred not only in lung cancer tissues but also in all genes in the tissues near the tumors that are associated with them. As expected, all genes were methylated in cancer samples but not methylated in normal cells. In addition, as shown in FIGS. 5 and 6, since 11 identified genes were methylated in the tissues near the paired tumors, it was confirmed that the 11 identified genes were useful for early detection of lung cancer.

The methylation frequency of the marker in tumor tissue was obtained by dividing the number of tumor tissue samples to which the marker was methylated by the total number of samples including the tumor tissue and the tissues near the tumor paired thereto, and the frequency of methylation of the markers in the adjacent tumor tissue. Was obtained by dividing the number of methylated markers of tissue samples near paired tumors by the total number of samples, expressed as a percentage.

As described above in detail a specific part of the content of the present invention, for those skilled in the art, such a specific description is only a preferred embodiment, which is not intended to limit the scope of the present invention. It is intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

1 is a schematic diagram showing a method of selecting a lung cancer marker gene.

2 is a schematic diagram illustrating a method of confirming methylation by restriction enzyme cleavage and gene amplification to confirm that the marker candidate gene is actually methylated.

Figure 3 shows the reactivation of 11 lung cancer markers after treatment with the dimethylating agent.

4 shows the promoter methylation status of 11 identified methylation genes in lung cancer cell lines A549, NCI-H146 and NCI-H358 cells.

Figure 5 shows the frequency of methylation of 11 lung cancer markers in normal tissues and tumor tissues taken from normal persons.

Figure 6 shows the methylation frequency of 11 lung cancer markers in normal tissues and tissues near tumors taken from normal persons.

<110> genomictree <120> DIAGNOSIS KIT AND CHIP FOR LUNG CANCER USING LUNG CANCER SPECIFIC          METHYLATION MARKER GENE <160> 33 <170> KopatentIn 1.71 <210> 1 <211> 205 <212> DNA <213> Homo sapiens <400> 1 ctcaattttc gcaggctcct cacaattctc tatttggaag aagtgtccct ctccttccct 60 tttcttttcc tcctttactc agcgtcagtc cccgcagcca tctcctccga ccctttttgt 120 ctacgtccca gcgtcgcgaa ccacagcggc ggaggtggag cggggagagg cgttaggccg 180 ggcggctaaa acgcgccgtt aaagt 205 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctcaattttc gcaggctcct ca 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 actttaacgg cgcgttttag cc 22 <210> 4 <211> 245 <212> DNA <213> Homo sapiens <400> 4 accagctgtg actggctgtg aatatggagg aaaagggcca ctagtcaagg tatgtagata 60 gcttttagaa gtcagaagaa gcacgcctgc agtcccagct actcaggagg ctgaggccgg 120 aggatcgctt gagcctgggg agatagaggt tgcagagagc cgagaccacg ccactgcagc 180 ccagcctgga cagaggtgag acgctcgcgg accttagctt ggggttggcg gcgttaggaa 240 gaaac 245 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 accagctgtg actggctgtg aa 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gtttcttcct aacgccgcca ac 22 <210> 7 <211> 1017 <212> DNA <213> Homo sapiens <400> 7 ggatacacag tgtagcgatg catcactctg aaatatttta gtttcttttt ttcccctaaa 60 tctgggtatt tcgtgggaat ttgcagcaca tgtgaacaac ttctgtcatt cttgcatgag 120 gcaaagggaa ttgaaaacca cgattacttt agaaaactag tttcacagat tggtcactgt 180 ataaaagaag gatattggtt ttggtagctt gtgaccacac accatttctg atctgaataa 240 attcagaact tataatacag ttcagaaatt gaatgcagtt tctcaatatg aggaaagtat 300 tttagaataa ggcctatttt tcaaaggatc tgtggaaatc aatgctatgc tctcatttag 360 gagatggaaa gagtgaggtt aaattatcat ttcgattaaa tctacagtcc agattactgg 420 tggatgaatt gaatgtactt ttttattcat ataaaacatt tgaaatcaga aatctggagt 480 acttttaaat cccattattt attttgtttt aatcgccagg taattcctga gacaggagtg 540 tcccgaagag cctttgcaat tatgtaagaa tctccgaggc agttcttatg ttcctcaatt 600 caaaagaacc acataactgc aatttaaata acaccccaca cacacacaaa ataaggtcga 660 agtttatctc aaaataattt cccctctcta cactgggata aatatgtata ggaataatag 720 ggggaaattc agtgcactga gcattaagct gtcaaaacag gaatgtttaa aatatcctgt 780 tagtggttta aaaataattt gtactctaag tccagtgact atttgccagg gagaaccaaa 840 gttgagaaat ttctattaaa aacatgactc agagaaaaaa atgcagaggc cggtaatgaa 900 ggaaatgatt ggatctcatt cccaattggt cattcctaag atcacatgtt ctgagcatct 960 ttaaaaggaa gttatctgga ctcaagaggg tcacagcacc ctcctgaaaa ctgcagc 1017 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ggatacacag tgtagcgatg ca 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gctgcagttt tcaggagggt g 21 <210> 10 <211> 205 <212> DNA <213> Homo sapiens <400> 10 gtcctggaca agggaagctg tgcacccgct gacaccagta agaaggttgc cgccatgtca 60 gagatgtccg cggacacctc cctgggctcc gggtcctccc ctgcgctcgc ctggagtggg 120 accttcgcgt gcacactggc cttcccacgc gccccgctgc gatggcaccc gcgccgggcc 180 ccctagctca cacagtcgga gcgtg 205 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gtcctggaca agggaagctg tg 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 cacgctccga ctgtgtgagc ta 22 <210> 13 <211> 215 <212> DNA <213> Homo sapiens <400> 13 tgcagacgga gtctctcaat ggtgcccagg ctggagtgca gtggcgtgat ctcggctcgc 60 tacaacatcc acctcccagc agcctgcctt ggcctcccaa agtgccgaga ttgcagcctc 120 tgcccggccg ccaccccgtc tgggaagtga ggagcgtctc tgcctggccg cccatcgtct 180 gggatgtgag gagcccctct gcctggctgc ccagt 215 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tgcagacgga gtctctcaat gg 22 <210> 15 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 actgggcagc caggcag 17 <210> 16 <211> 244 <212> DNA <213> Homo sapiens <400> 16 acttggatgc ggtgcctgac ctagagggag gcgaaagggt tgtgagcgtg acatgactgg 60 tgacctacac cgagaagctg aagggtctct taagctctgc ggccggaagc catctgcttc 120 tgcggtttat acaatagcaa ctttatcaga ggttactttt ctgcacgcta gcgtatgaca 180 ttaatttgtc ttcctgattc atcaaaggga atttccgttg cagttggtga tgcagtgggc 240 ctct 244 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 acttggatgc ggtgcctgac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 agaggcccac tgcatcacca 20 <210> 19 <211> 187 <212> DNA <213> Homo sapiens <400> 19 aaagagggac cgcccatcag gtcggcgtcc ttgggatctc agcagccgac gaccccaatt 60 caaatcgatc gtgggaaacc ccagggaaag aaggctcact tgcagaggga caggattaca 120 gggtgcaggc tgcagggaag taccgggggg agggggcctg gtcggaagga ctttccagcc 180 actcggc 187 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 aaagagggac cgcccatcag 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 gccgagtggc tggaaagtcc 20 <210> 22 <211> 206 <212> DNA <213> Homo sapiens <400> 22 tcagtctcac ggggccagac cgaattcttc tccagagggc agttgctgct tttggctgat 60 tgggtttacc ccgctgcctg cctccccatc acgtactccc cccgcaacct cgctctctct 120 ctccttctca cacacaccct cagctccgga cctcgcctac cggtcagccc ctctattccc 180 agacagctac cgctactccc ctggcg 206 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 tcagtctcac ggggccagac 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 cgccagggga gtagcggtag 20 <210> 25 <211> 194 <212> DNA <213> Homo sapiens <400> 25 cccccactcc ccattcaaag ccctcttctc tgaagtctcc ggttcccaga gctcttgcaa 60 tccaggcttt ccttggaagt ggctgtaaca tgtatgaaaa gaaagaaagg aggaccaaga 120 gatgaaagag ggctgcacgc gtgggggccc gagtggtggg cggggacagt cgtcttgtta 180 caggggtgct ggcc 194 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 cccccactcc ccattcaaag 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ggccagcacc cctgtaacaa 20 <210> 28 <211> 206 <212> DNA <213> Homo sapiens <400> 28 atcttggccc cgccttcttc ctgcgccctc gccccgcccc cgcgcgtgac tgacaggggc 60 cactcagggc gcgcgtgcga ggtgctcgct tgcgtaatct acctgcgtgg cgccgccggc 120 ggtaccctgc acagcctgct agaaactgag accccgggtg gtgacagctc tgggcatcgc 180 ccctgggtcc tcgggaagag gggaca 206 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 atcttggccc cgccttcttc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 tgtcccctct tcccgaggac 20 <210> 31 <211> 250 <212> DNA <213> Homo sapiens <400> 31 tcttggagcg gggagacctt gacatcaaac aggaagagtc ttaccgggac aaggagacaa 60 cagcccagag aggctgtcac ccagggtagg tgtgcagtca cagtgaggtc ccaaggacta 120 agggctatga ccctaagagt ctcggcttct gtgtaactca cccaagtcac ttccctggtc 180 tacgacccag tttcccaaat gtgtaaaggg tcctttagac ctcgccctaa aaggtcaggg 240 gcgtggctta 250 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 tcttggagcg gggagacctt 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 taagccacgc ccctgacctt 20  

Claims (2)

delete Comprising a promoter CpG island of lung cancer marker gene selected from the group consisting of Base selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 28, and SEQ ID NO: 31 A nucleic acid chip for diagnosing lung cancer or lung cancer progression, comprising a fragment having a sequence and a probe capable of hybridization: (1) CDO1 (NM_001801) -cAMP responsive element modulator; (2) CREM (AB209533)-cAMP responsive element modulator; (3) FABP4 (CB999901)-fatty acid binding protein 4, adipocytes; (4) G0S2 (CD511787) -G0 / G1 switch gene; (5) HYAL1 (NM — 007312) —hyaluronoglucosaminidase 1; (6) LPXN (BC034230) -leupaxin; (7) NFKBIA (BM908726)-nuclear factor enhancer of kappa light polypeptide gene in B-cell inhibitors, alpha (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha); (8) RRAD (BC057815)-Ras-related associated with diabetes; (9) THBD (NM-000361) -thrombomodulin; (10) TNNC1 (CF553054)-troponin C, slow; And (11) TOM1 (AK097926)-target of myb1, chicken.

Images